ID: 962290978

View in Genome Browser
Species Human (GRCh38)
Location 3:134136119-134136141
Sequence AAGCTGACAGTAAAGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962290978_962290981 3 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 104
962290978_962290983 11 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290983 3:134136153-134136175 CCTGGCAAAAACTGGTGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 116
962290978_962290985 25 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290985 3:134136167-134136189 GTGTTCTGGAAGTGTTTTGTGGG 0: 1
1: 0
2: 2
3: 21
4: 235
962290978_962290984 24 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290984 3:134136166-134136188 GGTGTTCTGGAAGTGTTTTGTGG 0: 1
1: 0
2: 2
3: 14
4: 234
962290978_962290986 29 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290986 3:134136171-134136193 TCTGGAAGTGTTTTGTGGGATGG 0: 1
1: 0
2: 3
3: 19
4: 267
962290978_962290979 -7 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290979 3:134136135-134136157 TCAGCTTCTCCTACGCTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962290978 Original CRISPR AAGCTGACAGTAAAGAGACC TGG (reversed) Intronic
901527266 1:9831454-9831476 AAGCTTAGAGTCAGGAGACCTGG + Intergenic
904187088 1:28713995-28714017 AAACTGAGAGTCAGGAGACCTGG - Intronic
904474062 1:30753156-30753178 AAGCATACAGTAAAGATCCCTGG + Intronic
905915913 1:41684167-41684189 AGGCAGACAGTGAGGAGACCTGG - Intronic
906545482 1:46616781-46616803 AGGCTGACAGGAGAGAGAACAGG - Intronic
906646663 1:47479973-47479995 AAGCTGAAAGAGAAGAGGCCCGG - Intergenic
907957420 1:59243132-59243154 AACATGGCAGTAAACAGACCAGG - Intergenic
909084967 1:71159579-71159601 GGGCTGACAGTCAAGCGACCTGG - Intergenic
910531843 1:88245355-88245377 AAGCTGACAGCAAAAAGAATAGG + Intergenic
911068266 1:93811493-93811515 AAACTAAGAGGAAAGAGACCCGG - Intronic
911247449 1:95534643-95534665 AAGTTGAGAGTGAAGAGACAGGG + Intergenic
911802745 1:102163930-102163952 CAGCTGCCAGTAAAGAGTGCTGG - Intergenic
912046766 1:105468898-105468920 AAGCCGAGAAGAAAGAGACCTGG + Intergenic
916646492 1:166791305-166791327 AAGCTGACATCAAACAGAACAGG + Intergenic
917776538 1:178342329-178342351 AAACTGACAATAAGGAGATCTGG - Intronic
918595955 1:186293354-186293376 ATGCGGAGAGTAAAGAGACATGG - Intergenic
920047446 1:203142637-203142659 AAGGTGAGAGTCAGGAGACCAGG - Intronic
921622744 1:217344131-217344153 AAGCTGACAGGAATGAGCACAGG - Intergenic
922900409 1:229132145-229132167 AGGTTGACAGGAAAGAGACAAGG - Intergenic
924404581 1:243729900-243729922 AAGGTGTCAGTAGAGAGACTTGG - Intronic
1063660548 10:8033032-8033054 AAGCTGACAGGAAAGACTCCAGG + Intergenic
1068152010 10:53144642-53144664 AAAATAACAGTAAAGGGACCAGG + Intergenic
1068572156 10:58642068-58642090 AAGCTGGCCTTGAAGAGACCTGG - Intronic
1070536141 10:77378667-77378689 ACCCTGAAAGTAATGAGACCTGG - Intronic
1071484198 10:86087561-86087583 AAACTGACAAGACAGAGACCAGG + Intronic
1075158929 10:120005739-120005761 AAGCTGCAAATAATGAGACCTGG + Intergenic
1076671877 10:132125616-132125638 AATCTAACAGTAAATACACCAGG - Intronic
1078401352 11:11030230-11030252 TAACTTACAGTAAAGAAACCTGG - Intergenic
1078657264 11:13253334-13253356 AGGTTGACAGTAAAGAGACAAGG - Intergenic
1083835553 11:65264494-65264516 AGACTCAGAGTAAAGAGACCAGG - Intronic
1084253329 11:67920307-67920329 AAGCAGAGGGTAAGGAGACCTGG + Intergenic
1084819551 11:71675625-71675647 AAGCAGAGGGTAAGGAGACCTGG - Intergenic
1088134152 11:106533426-106533448 AACCTGACAATAAAGAGAACAGG + Intergenic
1088753145 11:112862772-112862794 AAGCTGACACTAATGAGATGGGG - Intergenic
1093697780 12:22181804-22181826 AAGCAAACAGAAAAGAGACTGGG + Intronic
1097066341 12:56323353-56323375 AAGATGGCAGTAAAGAAACACGG - Exonic
1099029460 12:77507130-77507152 AAGTTTACAATTAAGAGACCAGG - Intergenic
1101569217 12:105937630-105937652 AAACTGGGAGTCAAGAGACCTGG - Intergenic
1101806469 12:108068559-108068581 AAGCAGACATTACAGAGACTTGG - Intergenic
1102024764 12:109708113-109708135 AAGCTGGGAGTCAAGAGACTTGG - Intergenic
1102726091 12:115066368-115066390 AATATGACAGGAAAGAGGCCAGG + Intergenic
1103312518 12:120022606-120022628 AAGCTGGCATAACAGAGACCAGG + Intronic
1106197324 13:27504942-27504964 GAGCTGGGAGTAAACAGACCAGG - Intergenic
1107015321 13:35704188-35704210 AACGTGACAGTGAAGAAACCTGG - Intergenic
1107015528 13:35705597-35705619 ATGCCGACAGGACAGAGACCTGG + Intergenic
1107838843 13:44435348-44435370 AAGCTGACATCACAGAAACCTGG + Intronic
1110389587 13:74958751-74958773 AAGCTGAATGTACAGAAACCAGG - Intergenic
1110516545 13:76419430-76419452 AATGTGGCAGTAAATAGACCAGG - Intergenic
1110584551 13:77173067-77173089 AAGATGTCAGAAGAGAGACCCGG + Intronic
1110631666 13:77714875-77714897 AAACTGACAGAAAACAGATCAGG - Intronic
1114373932 14:22122728-22122750 AGGCGGAAAGAAAAGAGACCAGG - Intergenic
1115601161 14:34957087-34957109 ATGCTGACTGCAAAGAGACAAGG + Intergenic
1118725061 14:68623149-68623171 AACCTGACAGCAAACAGCCCTGG - Intronic
1119174464 14:72559138-72559160 GAGATGAGAGTAAAGAGACGGGG + Intronic
1119372488 14:74158967-74158989 AAGCAGAGATTAGAGAGACCTGG - Intronic
1120639378 14:86991629-86991651 ATGGAGACAGTAAAAAGACCAGG - Intergenic
1120735501 14:88047596-88047618 AAGTTGACAGAACAGAGAACTGG - Intergenic
1120739020 14:88087343-88087365 AAAATGAAAGAAAAGAGACCAGG + Intergenic
1120872869 14:89353659-89353681 ATGTTGACAGTGCAGAGACCTGG - Intronic
1121280255 14:92692615-92692637 AAACTGACACTGAAGAGGCCTGG + Intergenic
1122154254 14:99740951-99740973 CAGCTTACAGCACAGAGACCTGG - Intronic
1123113753 14:105884613-105884635 CAGCTGGCAGTGAAGGGACCAGG + Intergenic
1123187638 14:106535727-106535749 AAGTTTACAGTAAAGAAACTGGG - Intergenic
1124633116 15:31348522-31348544 AAGCTGCCAGCATAGAGCCCAGG + Intronic
1125298896 15:38233451-38233473 AGTCTGGCAGTAAGGAGACCTGG + Intergenic
1127075688 15:55323269-55323291 AGGCTGTGAGTAAATAGACCTGG - Intronic
1127650331 15:61000610-61000632 AACCTGACGGAAAATAGACCTGG + Intronic
1129503922 15:76065234-76065256 AAACTGACAGTTAAAAGACAGGG - Intronic
1130628684 15:85542781-85542803 AAGAGGACAGTGAAGAGAGCCGG + Intronic
1131731079 15:95282094-95282116 AAGCAGACAGTAAAAAGAGAGGG + Intergenic
1133637368 16:7680967-7680989 AAGCTTAATGCAAAGAGACCAGG + Intronic
1134023185 16:10935609-10935631 AACTTGACAGTGGAGAGACCTGG + Intronic
1134835411 16:17356771-17356793 TGGCTGACAGTAAAGAGAGTAGG - Intronic
1137227352 16:46526314-46526336 ATGCTGGCAGTAAAGACACATGG + Intergenic
1141535085 16:84673566-84673588 AAGCTGAAATTCAAGAGGCCTGG + Intergenic
1142503568 17:348202-348224 ATGGAGACAGTAAAAAGACCAGG + Intronic
1142702087 17:1669012-1669034 AACCTGACAGGAAAGAGGTCTGG - Intronic
1143215933 17:5224956-5224978 AAGCTGACAGACCAGAGACCGGG + Intronic
1143870844 17:9956456-9956478 AAGATGACAGCAAAGCCACCCGG - Intronic
1147047759 17:37767437-37767459 AAGATGACAGGAAAGATGCCTGG - Intergenic
1148617310 17:49010788-49010810 AAACTGAGAGTACAGAGTCCAGG + Intronic
1151539870 17:74759425-74759447 AAGCCCACAGCACAGAGACCAGG + Intronic
1152030828 17:77841947-77841969 ATGCTGGCAGTCAAGAGGCCTGG - Intergenic
1152282314 17:79392162-79392184 GAGCTAACAGTAAAGAAAACTGG + Intronic
1154141992 18:11832387-11832409 AAGATGACAGAAAACAGATCTGG - Intronic
1155945665 18:31847480-31847502 AACCTAACAGTAAAAATACCGGG - Intronic
1157328382 18:46685640-46685662 AAGCTTAAAGCAAAGAGACTTGG - Intronic
1159120082 18:64158843-64158865 GAGCTGTCAGTAAAGAGAATGGG - Intergenic
1161204471 19:3033896-3033918 AAGTTGACATTCAAGTGACCGGG - Intronic
1162882327 19:13668992-13669014 AAGCCGACACAAAGGAGACCAGG - Intergenic
1163770338 19:19187179-19187201 AAGAGGACATTAATGAGACCGGG + Intronic
1164094038 19:21988979-21989001 ATGCAGAGAGTAAAGAGAGCTGG + Intronic
1164473906 19:28558236-28558258 ATGGAGAAAGTAAAGAGACCCGG + Intergenic
1164856115 19:31524856-31524878 AACTTTACAGTGAAGAGACCTGG - Intergenic
1168423189 19:56218325-56218347 AAGCTGGCAGAAAAGGAACCCGG + Intergenic
1168425113 19:56233894-56233916 AAGCTGGCAGAAAAGGAACCCGG + Intronic
926361317 2:12090135-12090157 AAGCTCAGAGGAAAGAGTCCCGG - Intergenic
926455117 2:13057592-13057614 AAGCTGAAAGTTAGGACACCTGG + Intergenic
926775469 2:16417994-16418016 AAGCTGACAGTCATGAGTCTGGG + Intergenic
930261271 2:49149414-49149436 AATCTGAGAGTCAAGAGGCCTGG + Intronic
934920716 2:98343059-98343081 AAGCTGACCTGAAAGAGACAGGG + Intronic
937380503 2:121372296-121372318 GAGCTGACAGGAGGGAGACCAGG - Intronic
937381340 2:121380266-121380288 AAGCTGACTGAGAAGAGACCTGG + Intronic
937965535 2:127505525-127505547 ACTCTGAGAGTGAAGAGACCAGG - Exonic
941483241 2:166044812-166044834 AAGTTGACAGTCAGGAGAACTGG - Intronic
942351463 2:175057508-175057530 AGGGTCACAGTAAAGACACCAGG - Intergenic
942746520 2:179240584-179240606 AAGCCGCCAGTCAAAAGACCAGG + Intronic
944536261 2:200713444-200713466 AAGTTGGCATTAAAGAGAGCTGG + Intergenic
946437331 2:219665947-219665969 AAGCTGACAGTAGACAGGCTGGG - Intergenic
947065242 2:226217179-226217201 AAGCTGCCAGCAAACAGAACTGG + Intergenic
947094599 2:226551610-226551632 AAGCTGACAGCAAAGACTCCAGG + Intergenic
947681709 2:232039798-232039820 AAGCTGTAAGTCAAGAGATCTGG - Intronic
1170103975 20:12733574-12733596 AAGCTAACAGTAATGAGATGTGG - Intergenic
1170346237 20:15389934-15389956 AAACACAAAGTAAAGAGACCAGG + Intronic
1170515771 20:17128899-17128921 AAGATGACAGCAAAGAGAGAGGG - Intergenic
1170675388 20:18474955-18474977 AAGCTAACAGTAAAGAATGCTGG - Intronic
1171490269 20:25511932-25511954 AAGCTGAGAGCACAGAGAGCAGG + Intronic
1173607334 20:44340965-44340987 AAGCTCAGAGTCAAGAGATCTGG + Intronic
1173643181 20:44617524-44617546 AAGCTGAAAGTGAGGAGACTTGG + Intronic
1175043398 20:56077785-56077807 AAGATGACTGAAAAGAAACCCGG + Intergenic
1178119864 21:29458454-29458476 AAGCTTTCAGTAAGCAGACCAGG - Intronic
1180917986 22:19502890-19502912 AAGCAGACAGAAAAGAGACAGGG + Intronic
1181295563 22:21835881-21835903 AAGCTGACAGTAATCAAAACAGG + Intronic
1184818150 22:46888013-46888035 AAGCTGACCTGAAAGAGAGCGGG - Intronic
951419835 3:22471352-22471374 AAGCTACCAGTACAGGGACCAGG + Intergenic
956231555 3:67022362-67022384 GAGCTGAGAGAAAAGTGACCTGG - Intergenic
957067402 3:75536771-75536793 AAGCAGAGGGTAAGGAGACCTGG + Intergenic
957487798 3:80885250-80885272 AATTTCACAGTAAAGAAACCTGG - Intergenic
959813611 3:110649132-110649154 ATGCTGGCTGAAAAGAGACCAGG - Intergenic
961101458 3:124202617-124202639 AAGGTGAAGGAAAAGAGACCAGG - Intronic
961655027 3:128436394-128436416 ATGGTGACAGTACAGAGAGCAGG - Intergenic
961900992 3:130211713-130211735 AAGCAGAGGGTAAGGAGACCTGG + Intergenic
962290978 3:134136119-134136141 AAGCTGACAGTAAAGAGACCTGG - Intronic
963991140 3:151655832-151655854 AAGATCACAGTTAAGATACCAGG + Intergenic
964024525 3:152056736-152056758 AAGCAGAATGTAAAGAGAACAGG - Intergenic
964430429 3:156600052-156600074 TAGCTTACAGAAAAGAGCCCAGG - Intergenic
965509653 3:169554487-169554509 ACGCTGAAAGTAAAGAGAATAGG - Intronic
965837554 3:172868057-172868079 AGGCAGAAAGTAAAGAGAACTGG + Intergenic
969247433 4:5944790-5944812 AAGCTGGCAGTTCAGAGGCCTGG + Intronic
969742102 4:9036383-9036405 AAGCAGAGGGTAAGGAGACCTGG - Intergenic
973152806 4:46909103-46909125 AAGCTGACAGTTATAAGACATGG - Intronic
975793961 4:77986125-77986147 AATCCTACAGTCAAGAGACCAGG - Intergenic
976412633 4:84733607-84733629 ACGCTGACAGGAAAGAGTCCAGG + Exonic
980991669 4:139743543-139743565 AAGCTGACACTAAATATACATGG + Intronic
981660218 4:147157953-147157975 AAGCTGACAGTTTATAGAACTGG - Intergenic
981691305 4:147512724-147512746 GACCTAACAGTAAAGAGAACAGG - Intronic
984531886 4:180925987-180926009 AAACTGATAGTAATGAGAACAGG + Intergenic
986168791 5:5298558-5298580 AAGCTGAAAGTACAGAGGCCAGG - Intronic
987677580 5:21094819-21094841 TAGCTGACAGTGCAGAAACCAGG + Intergenic
988383010 5:30523794-30523816 AAATTGACAGTAAAACGACCTGG - Intergenic
990403845 5:55468111-55468133 AAGGTTACAGTAAACAGACAGGG + Exonic
992521102 5:77552260-77552282 AAGCTGACATTAAAAACACAGGG + Intronic
994800727 5:104371126-104371148 CAGATGACAGTAAAGAGGACTGG + Intergenic
994955651 5:106527920-106527942 AAGATGATAGCAAGGAGACCAGG + Intergenic
997124953 5:131216736-131216758 AAGCTGCCAATAAAATGACCTGG + Intergenic
997980866 5:138466666-138466688 GAGCTGCCAGGCAAGAGACCGGG - Intronic
998390974 5:141786895-141786917 AAGCTGACAGTGAAGACCCGGGG - Intergenic
999670285 5:153953712-153953734 AGGCTGAAAATCAAGAGACCTGG + Intergenic
1002162654 5:177324943-177324965 AATCGGAGAGTTAAGAGACCAGG + Intergenic
1003307728 6:4944810-4944832 AACTTTACAGTAAAGAAACCTGG + Intronic
1004594829 6:17089274-17089296 ACGATGACAGAACAGAGACCAGG - Intergenic
1004637022 6:17479042-17479064 AAACTGACAGGGGAGAGACCAGG - Intronic
1006660088 6:35634153-35634175 AAGCTGAGAGTTAAGATAACAGG - Intronic
1007487515 6:42191966-42191988 AAGCTGAGATTAAAGATTCCAGG + Intronic
1008169836 6:48189543-48189565 AACTTTACAGTAAAGAAACCTGG + Intergenic
1009960527 6:70515562-70515584 ATGGTGACAGTAAAAAGATCCGG + Intronic
1010449836 6:75990282-75990304 AACCTGACAATACAGAGAACGGG + Intronic
1011336133 6:86261602-86261624 AAACTGACAGTTAAAAGACTTGG - Intergenic
1011349209 6:86403757-86403779 AAGCTGAGGGTAAAGAGGCTAGG + Intergenic
1011773709 6:90704839-90704861 AAGCTGGTATTAAAGAGACATGG - Intergenic
1012934130 6:105348103-105348125 AAGGTAACATTAAAGACACCAGG - Intronic
1015425925 6:133067380-133067402 GAGCTTACAGTAAATAGACTTGG + Intergenic
1016771565 6:147857882-147857904 AAGGTGACAGTAAAGGTATCTGG - Intergenic
1017237926 6:152136723-152136745 AGGCTGACAGCAAGGAGAGCCGG - Exonic
1019349680 7:548686-548708 AACCTCACAGTACAGAGACAGGG + Intergenic
1020813942 7:12880900-12880922 AATAGGACAGTAAAGAGAACTGG - Intergenic
1022257551 7:28674399-28674421 AAGTGGACAGGAAAGAGTCCTGG - Intronic
1025160095 7:56650759-56650781 AAAATGAGAGTAAAGAGAGCTGG + Intergenic
1025726661 7:64068807-64068829 AAAATGAGAGTAAAGAGAGCTGG - Intronic
1028357564 7:89927640-89927662 AAGCTGAGCATAAAGAGAACTGG + Intergenic
1030431741 7:109456457-109456479 AAACTGGCACTAAAGAGATCAGG - Intergenic
1031566824 7:123309280-123309302 AAGTGGCCAGTAAAGAGAGCAGG + Intergenic
1034629969 7:152523196-152523218 AAGCTGAGAGTCAAGGGTCCAGG - Intergenic
1035674796 8:1449121-1449143 AAGATGAGAGGAAAGAGAACAGG - Intergenic
1035773181 8:2166240-2166262 AAGGTGAAAATAAAAAGACCAGG - Intergenic
1036253502 8:7185432-7185454 AAGCTCAGGGTAAGGAGACCTGG + Intergenic
1036363991 8:8102046-8102068 AAGCTCAGGGTAAGGAGACCTGG - Intergenic
1038649851 8:29392720-29392742 AACCTGGAAGTTAAGAGACCTGG + Intergenic
1039697806 8:39931078-39931100 AACCTGAGAGTCAAGAGACCAGG + Intergenic
1039943557 8:42111225-42111247 CAGCTGTCAGTACAGAGAACGGG + Intergenic
1039947088 8:42139740-42139762 AAGCTGCCATTAAAGAGTACAGG - Intergenic
1040714849 8:50238366-50238388 AAGCTGACAATAAAAAGAAATGG + Intronic
1042959305 8:74286168-74286190 AAGGTGACAGTCAAGAGAAATGG - Intronic
1045376037 8:101575043-101575065 AACCTCACAGTAAAGAGAGTTGG - Intronic
1047283848 8:123469379-123469401 AAGCTTACAGACAAGAGACTAGG + Intergenic
1048014683 8:130486799-130486821 AAGCTGAAAATAGAGAGAACAGG - Intergenic
1048355450 8:133650248-133650270 AAGCTGGCATCAGAGAGACCTGG - Intergenic
1048908872 8:139115254-139115276 AAACGGACAGTAATGAGAACAGG + Intergenic
1050782913 9:9361485-9361507 AATCTGGCAGTAAAGAGCCATGG - Intronic
1053593685 9:39537532-39537554 AAGCTGAAAGTACAGTGACATGG + Intergenic
1053851467 9:42292577-42292599 AAGCTGAAAGTACAGTGACATGG + Intergenic
1054572620 9:66827749-66827771 AAGCTGAAAGTACAGTGACATGG - Intergenic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1059656086 9:116358763-116358785 CAGCTTACAGTCAAGAGACATGG + Intronic
1060896248 9:127219523-127219545 GGGCTGACAGCAAAGAGGCCTGG - Exonic
1061730794 9:132612253-132612275 GAGCTGAAAGAAAAGAGAGCGGG + Exonic
1187289473 X:17939389-17939411 AAGCTGAGAGGAAAGAGAACAGG + Intergenic
1188250736 X:27890836-27890858 ATGCTGACAGGAAAGAGATGAGG + Intergenic
1188818152 X:34740692-34740714 AATTGGACAGTAAAGAGAGCAGG - Intergenic
1189229421 X:39440629-39440651 ATGGTGACTGTAGAGAGACCAGG - Intergenic
1190322120 X:49185514-49185536 ATGCTGAGAGTCAAGAGACTGGG - Intronic
1190505555 X:51122243-51122265 ATGCAAACAGTAAAGAGAGCTGG - Intergenic
1191927793 X:66333248-66333270 AAGCTGACAGTAAAGAGCAATGG - Intergenic
1194199500 X:90937609-90937631 GAGCAAACAGTAATGAGACCTGG + Intergenic
1196203562 X:112913274-112913296 AAGTTGAAAGTAAGAAGACCTGG + Intergenic
1196934263 X:120713948-120713970 AAGCTGAAGGTACAGGGACCAGG + Intergenic
1197821506 X:130545245-130545267 AACTGGAAAGTAAAGAGACCTGG - Intergenic
1197985664 X:132264339-132264361 AAGCAGAGAGCAAAGACACCAGG - Intergenic
1199823754 X:151477042-151477064 GGGCTGACAGTGAAGAGACCTGG + Intergenic
1201941739 Y:19467425-19467447 TAGCTAACAGGAAAGAGACATGG + Intergenic