ID: 962290981

View in Genome Browser
Species Human (GRCh38)
Location 3:134136145-134136167
Sequence CTACGCTGCCTGGCAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962290975_962290981 24 Left 962290975 3:134136098-134136120 CCTGAGGAGCCTGCAGTGGGTCC 0: 1
1: 0
2: 3
3: 23
4: 259
Right 962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 104
962290977_962290981 15 Left 962290977 3:134136107-134136129 CCTGCAGTGGGTCCAGGTCTCTT 0: 1
1: 0
2: 3
3: 13
4: 150
Right 962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 104
962290978_962290981 3 Left 962290978 3:134136119-134136141 CCAGGTCTCTTTACTGTCAGCTT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962290981 Original CRISPR CTACGCTGCCTGGCAAAAAC TGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
903621430 1:24701029-24701051 CTGCTATGCCTGGCAAAACCTGG - Intergenic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
907944671 1:59124580-59124602 CTACCCTGCCTGGGTCAAACAGG + Intergenic
913539894 1:119808714-119808736 CTGAGCTGCCTGGCCAAAACAGG - Exonic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG + Intergenic
917195515 1:172460882-172460904 CAAAGCTGCCTGCCAAAGACAGG - Intronic
918094202 1:181321284-181321306 CTAGGTTGCCAGGCAAAAAGTGG - Intergenic
918725859 1:187922711-187922733 TACTGCTGCCTGGCAAAAACTGG - Intergenic
923734026 1:236583772-236583794 CTACCGTGCCTGGCCAAAATAGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1066270626 10:33819516-33819538 CCAGGCTGCCTGGCAAGAAGGGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1071549858 10:86558306-86558328 CCATGCTGCCTGACAAAAATGGG + Intergenic
1075902483 10:126054339-126054361 CAAGGCTGCCTGACAAAATCAGG - Intronic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1082172272 11:49019776-49019798 CTATGCTGCCTGGGGAAACCTGG - Intergenic
1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG + Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1088172555 11:107015810-107015832 TTACGCTGCCTGGGAAATATTGG + Intronic
1088684321 11:112272259-112272281 CTAAACTGCCTGGCAATATCAGG - Intergenic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1114452232 14:22834946-22834968 CTTGACTGCCTGGCCAAAACTGG - Exonic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1116429540 14:44830015-44830037 CTAAAATGCCTGGCAAAAATAGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1128624421 15:69185014-69185036 CAACTCTGAGTGGCAAAAACTGG - Intronic
1128659196 15:69485327-69485349 CTACCCTGCCTGGGCAAAGCGGG - Intergenic
1129237217 15:74230873-74230895 CTCCGGTGCCTGGCAGAACCAGG + Intergenic
1129814267 15:78538343-78538365 CTAAGCTGCCTGGTTACAACTGG + Intergenic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131147501 15:90023804-90023826 CTAGGCAGCATGGCAAAACCCGG + Intronic
1132323102 15:100941833-100941855 CCAGGCTGCCTGGCACAAGCTGG + Intronic
1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG + Exonic
1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG + Intronic
1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG + Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143667974 17:8375359-8375381 CATTGCTGCCTGGCAATAACTGG + Intronic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1151274662 17:73025001-73025023 CTACCGCGCCTGGCCAAAACTGG + Intronic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1164845911 19:31432441-31432463 CTACTCTGCCTGGACACAACAGG + Intergenic
925262463 2:2540490-2540512 CTCCGCTGCCTGGCAAGAGAGGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
931264769 2:60650844-60650866 CTACATTGCCTGGCATGAACAGG + Intergenic
932347949 2:71007775-71007797 CTCCTCTGCCTGGCACACACAGG - Intergenic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG + Intergenic
939203415 2:139068595-139068617 CTATGATGCCTGGCAAAATAAGG + Intergenic
939986764 2:148836594-148836616 TTACCCTACCTGGCAAAACCAGG + Intergenic
940033524 2:149289374-149289396 CTTAGCTGCCTGTCAAAATCTGG - Intergenic
944229584 2:197379206-197379228 CTCCGCTGCCTGGCAACTGCTGG + Intergenic
948303765 2:236931265-236931287 CTACTATGCCTGGAAACAACTGG - Intergenic
1174508027 20:51029511-51029533 CTTTCCTGCCTGGCAAAAATTGG + Intergenic
1175434890 20:58938204-58938226 CAAAGCTCCCTGGCAAAGACTGG - Intergenic
1175889611 20:62310434-62310456 CCCCGCTGCCTGGGAAGAACAGG + Exonic
1181766109 22:25093251-25093273 CTAGGCTGCCTGCTCAAAACTGG - Intronic
1183260427 22:36791490-36791512 ATACGCTCCCTGGCACAAAGGGG - Intergenic
950904095 3:16521817-16521839 CAAGGCTGCCTGCCAAAACCGGG - Intergenic
953327079 3:42021527-42021549 CGAAGCTGCCTGTCATAAACAGG - Intronic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954702283 3:52456514-52456536 GTGGGCTGCCTGGCAAAAACCGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963439473 3:145319609-145319631 ATACGCTGCCTAGAAGAAACTGG - Intergenic
964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG + Intergenic
965803211 3:172515545-172515567 CTCCTCTGGCTGGCAAAATCTGG + Intronic
970137213 4:12938011-12938033 CTAGGCTGCCTGGCAGACAAAGG - Intergenic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG + Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
984181767 4:176491722-176491744 CCAGGCTGCCTTTCAAAAACTGG + Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
996410229 5:123151139-123151161 CTCAGCTGCTTGGCGAAAACTGG + Intronic
1001557738 5:172647852-172647874 CTCATCTGCCTGGTAAAAACTGG + Intronic
1002620151 5:180482508-180482530 CTGCACTGCCTGGCAACAGCGGG - Intergenic
1007055125 6:38875399-38875421 CCATGCTGCCTGTCTAAAACAGG + Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1009790525 6:68395656-68395678 CTCCATTGCCTGGCAAAAATAGG + Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1013339924 6:109203936-109203958 CTAGGCAACCTGGCAACAACAGG + Intergenic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG + Intronic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1047801897 8:128318782-128318804 CCACGCTGCCTGGGAAGAAGGGG + Intergenic
1053223561 9:36331898-36331920 CAAAGCTGCCTGGCATAAGCTGG + Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1203519777 Un_GL000213v1:34603-34625 CTGCGCTGCCTGGGAAGAAAGGG - Intergenic
1186115935 X:6305186-6305208 ATATGCTACCTGGCAAAAACTGG + Intergenic
1190132976 X:47768362-47768384 CTGGGCTTCCTGGCAAAAGCAGG + Intergenic
1190769985 X:53506143-53506165 CTACCTTGCCTGGCAAGAATAGG - Intergenic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic