ID: 962296117

View in Genome Browser
Species Human (GRCh38)
Location 3:134189138-134189160
Sequence TCATATACTTAGTTTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962296117_962296119 21 Left 962296117 3:134189138-134189160 CCATATCTAAACTAAGTATATGA 0: 1
1: 0
2: 0
3: 16
4: 299
Right 962296119 3:134189182-134189204 AATAAACTAATGATATAGCCAGG 0: 1
1: 0
2: 1
3: 35
4: 344
962296117_962296120 29 Left 962296117 3:134189138-134189160 CCATATCTAAACTAAGTATATGA 0: 1
1: 0
2: 0
3: 16
4: 299
Right 962296120 3:134189190-134189212 AATGATATAGCCAGGAGCATTGG 0: 1
1: 0
2: 0
3: 28
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962296117 Original CRISPR TCATATACTTAGTTTAGATA TGG (reversed) Intronic
900424835 1:2571984-2572006 TCATATATATATTTGAGATAGGG - Intergenic
901209001 1:7514016-7514038 TGATACAATTAGTTAAGATAAGG - Intronic
901354774 1:8635673-8635695 TCATATACTTTGTTTAGAATGGG - Intronic
901688204 1:10956302-10956324 TCACATACATGGTCTAGATAGGG + Intronic
901990848 1:13112659-13112681 CCATATACTTATATTATATAAGG - Intergenic
904748085 1:32723674-32723696 TCATTTATTTATTTTAGAGATGG - Intergenic
905728911 1:40280754-40280776 TTTTATATTTATTTTAGATAAGG - Intronic
906977159 1:50588256-50588278 TCATATATTTTGTATAGACAGGG + Intronic
907590589 1:55664174-55664196 GCATATACATAGTATATATATGG + Intergenic
908950083 1:69550145-69550167 TCAGATACGTAGATTATATAAGG + Intergenic
909522747 1:76588280-76588302 TCATACACTTTATTTGGATATGG - Intronic
910878672 1:91902824-91902846 TCAGAGACTTAGTTTAGGAAAGG + Intronic
911885096 1:103288124-103288146 TCATAGGCTTATTTTAGATGAGG - Intergenic
912168711 1:107070946-107070968 TCATATGTATAGATTAGATATGG - Intergenic
912406350 1:109441448-109441470 TCAAAGAGTTATTTTAGATAGGG - Intergenic
914734794 1:150405270-150405292 TCAGATTTTTAATTTAGATATGG + Intronic
916447126 1:164882865-164882887 CTATATACTTAGTTTAAATTTGG + Intronic
917639701 1:176971093-176971115 TTATTTACCTAGTTTAGAAAAGG - Intronic
918692596 1:187500498-187500520 TTATCTCCTTTGTTTAGATAAGG + Intergenic
919762843 1:201109073-201109095 TCATATTTTTAGTTGAGATGGGG - Intronic
924698068 1:246420560-246420582 TCATAAACTTTCTCTAGATAAGG - Intronic
1063665819 10:8059776-8059798 TCAATTACTTTGTTTAGAAATGG - Intronic
1064906697 10:20354842-20354864 TCATATTCTAACTTTAGAGATGG - Intergenic
1064997611 10:21310341-21310363 TCATTTACTTAATTTTGAGACGG - Intergenic
1065572406 10:27084694-27084716 TTATATTTTTAGTTGAGATAGGG - Intronic
1065576619 10:27126865-27126887 TCATAAATTTAATTTGGATATGG + Intronic
1066194424 10:33084906-33084928 TCATATTCTTAGGATAAATATGG - Intergenic
1067131370 10:43568547-43568569 TCAACTACTTAGTTTAGAAGAGG - Intronic
1068365771 10:56048163-56048185 TTATAAACTGAGTTTAGAAAAGG + Intergenic
1068465884 10:57390703-57390725 TGATATATTCAGTATAGATATGG - Intergenic
1069039893 10:63684619-63684641 TTATTTACTTATTTGAGATAGGG - Intergenic
1069291940 10:66790682-66790704 TCATATAATAAGATTAGTTATGG - Intronic
1070183261 10:74035165-74035187 TCTTGTACTTAGTCTAGCTAAGG + Intronic
1070513686 10:77183900-77183922 GCATATAGTTAGTCTATATAGGG - Intronic
1071442074 10:85708228-85708250 TCATATTTTTAGTTGAGATGGGG - Intronic
1072158064 10:92741835-92741857 TCATATTTTTAGTAGAGATAGGG - Intergenic
1073485200 10:103813042-103813064 TCATATACCTACTAAAGATAAGG + Intronic
1073743339 10:106436887-106436909 TCATATAATTAGTCTAGACTAGG - Intergenic
1075388728 10:122076940-122076962 TCATATTTTTAGTAGAGATAGGG - Intronic
1076216637 10:128699473-128699495 TCATGTGCTTAGTTCAGATATGG + Intergenic
1076320188 10:129573980-129574002 TCATATACTTAGTTTTACTGTGG + Intronic
1078223477 11:9371291-9371313 TCATATTTTTAGTAGAGATAGGG + Intergenic
1078493708 11:11795052-11795074 TTATATAATTAGTTAAGACAAGG + Intergenic
1079375408 11:19887600-19887622 ACATATAATCAGTTCAGATATGG + Intronic
1080223785 11:29936836-29936858 TCAAATTCTTAGTTGACATATGG - Intergenic
1080226408 11:29966107-29966129 TGACATATTTAGTTTTGATATGG + Intergenic
1080869060 11:36221173-36221195 TTATATACTTAGTAGAGATGGGG - Intronic
1081116025 11:39202315-39202337 TTGTTTACTTATTTTAGATATGG + Intergenic
1085290747 11:75397591-75397613 TCATATTTTTAGTAGAGATAGGG - Intergenic
1086097786 11:83067953-83067975 TTATATATTTAGTAGAGATAGGG - Intronic
1086132070 11:83411224-83411246 TTATATACTTAGTAGATATAAGG - Intergenic
1087320863 11:96656758-96656780 ACATATTCTTAGTTTACATTAGG + Intergenic
1087520842 11:99233494-99233516 TAATATTCTTTGTTTATATATGG + Intronic
1087534931 11:99431273-99431295 TCATGTACTTAATATAGAAACGG + Intronic
1088561829 11:111123010-111123032 TAAATTATTTAGTTTAGATAAGG - Intergenic
1088727069 11:112648674-112648696 TCATGGACTTAGTCTAAATAAGG - Intergenic
1089951438 11:122531487-122531509 TCATATTTTTAGTAGAGATAGGG - Intergenic
1090009032 11:123029574-123029596 TCATATTTTTAGTAGAGATAGGG + Intergenic
1090140305 11:124251322-124251344 TCCTATACTTAGCTTAAATGAGG - Intergenic
1090569634 11:128032082-128032104 TTATTTACTTATTTTAGAGACGG - Intergenic
1091004339 11:131938949-131938971 TCATAAACTTAGTGTATCTAAGG - Intronic
1093318489 12:17681541-17681563 TCATAGAATAAGTTAAGATATGG + Intergenic
1093861986 12:24176997-24177019 TCATCAATTTAGTTTAGATTTGG + Intergenic
1097527634 12:60758197-60758219 TCCTATACTTATTTAATATAAGG - Intergenic
1097531322 12:60803614-60803636 TTGTATACTTAACTTAGATAAGG + Intergenic
1097900486 12:64868245-64868267 TCATTTACTTACTTTAGGTTTGG + Intronic
1097979459 12:65722820-65722842 TCATAAACTTAGCTGAGTTAGGG - Intergenic
1097991769 12:65842821-65842843 TCACATACCTAGTTTAGTGATGG + Intronic
1098289808 12:68947422-68947444 TCATATTTTTAGTAGAGATATGG - Intronic
1099768245 12:87018897-87018919 TTTTTTTCTTAGTTTAGATAAGG - Intergenic
1100764618 12:97849909-97849931 AGATATAATTAGTTAAGATAAGG + Intergenic
1101199942 12:102424951-102424973 TCATGTGCTTAGTAAAGATATGG + Intronic
1101365014 12:104063531-104063553 TTATTTATTTATTTTAGATAGGG - Intronic
1101606483 12:106250566-106250588 TCATTTAATTATTTTTGATAAGG - Intronic
1102136028 12:110576262-110576284 ACATATAATTATTTTATATAAGG - Intronic
1103743386 12:123106381-123106403 TTATTTACTTATTTTAGAGATGG - Intronic
1107445148 13:40463952-40463974 AGATATAATTAGTTTAGATGAGG + Intergenic
1107501460 13:40981777-40981799 TCTTATCCTTAGCTTTGATATGG - Intronic
1108230445 13:48333893-48333915 ACATATTCATAGTTGAGATAGGG + Intronic
1109509317 13:63349167-63349189 TCATAGACTGAGTTTAAATAAGG + Intergenic
1110618152 13:77564533-77564555 TCAAATTTTTAGTTTAGATTTGG + Intronic
1111041333 13:82752908-82752930 TCATTTAATTAGTTTTAATATGG + Intergenic
1113283705 13:108820967-108820989 TCATATACTTATTTAATAAATGG + Intronic
1113673603 13:112193505-112193527 TCATATAGTTAGTGTACATTTGG + Intergenic
1114710752 14:24775526-24775548 TCCTATACTTATTTTAAATTTGG - Intergenic
1114941432 14:27615899-27615921 TCATTTATTTATTTGAGATAAGG + Intergenic
1114997825 14:28379405-28379427 TTATATACATAGCTAAGATAGGG + Intergenic
1115066853 14:29273538-29273560 TAATATACTTTTATTAGATATGG + Intergenic
1115209192 14:30947804-30947826 TAAGTTCCTTAGTTTAGATATGG - Intronic
1115841753 14:37479788-37479810 TCTTTTTCTTAGTCTAGATAAGG - Intronic
1117085247 14:52194243-52194265 TTCTAAAATTAGTTTAGATATGG + Intergenic
1118043542 14:61942092-61942114 TCTTATTTTTATTTTAGATAAGG + Intergenic
1119995693 14:79251359-79251381 TCATTTCTCTAGTTTAGATAGGG + Intronic
1120946517 14:90002904-90002926 CCACATATTTAGTTTAGAAAAGG - Intronic
1121247071 14:92469332-92469354 TCATATTTTTAGTTGAGACAGGG - Intronic
1122356813 14:101127722-101127744 TCTTATACTTATTTCAGAGAAGG + Intergenic
1124010202 15:25831976-25831998 AGATATAGTTAGTTAAGATAAGG + Intronic
1124949943 15:34308450-34308472 TCATATTCTTAGTAGAGACAGGG - Intronic
1126013648 15:44328469-44328491 TCATTTATTTATTTGAGATAGGG - Intronic
1126052722 15:44701521-44701543 TCATATTTTTAGTAGAGATAGGG - Intronic
1127675875 15:61238428-61238450 ACATATCCTTAGTTATGATAGGG - Intergenic
1128832458 15:70781899-70781921 AGATATAATTAGTTAAGATAAGG - Intergenic
1129357814 15:75003801-75003823 TTATTTATTTATTTTAGATAGGG - Intronic
1130057343 15:80537882-80537904 GCATATAGTTAGTTAAGATGAGG + Intronic
1131924353 15:97365609-97365631 TTATTTATTTATTTTAGATATGG + Intergenic
1133295797 16:4751683-4751705 TGATATAATTAGTTAAGATGAGG + Exonic
1134306303 16:13035701-13035723 TCATATTTTTAGTAGAGATAGGG + Intronic
1134622305 16:15698686-15698708 TCGTATTTTTAGTATAGATAGGG - Intronic
1135605782 16:23823348-23823370 TCATATTTTTAGTAGAGATAGGG - Intergenic
1136557151 16:31013994-31014016 TCATATATTTAGTAGAGACAGGG - Intergenic
1138066710 16:53949009-53949031 TCATATACTTTGTTTATAAAAGG - Intronic
1140304376 16:73789142-73789164 TCATATAGGTATTTTATATATGG + Intergenic
1140545323 16:75802345-75802367 TCATATATATACTTGAGATAGGG - Intergenic
1140636572 16:76921962-76921984 TCATATACTTAAATAAGTTATGG + Intergenic
1141025670 16:80544952-80544974 ACATATAATTAGTTAAGATGAGG - Intronic
1141812914 16:86388064-86388086 TCATAGACATAATTAAGATAAGG - Intergenic
1143910772 17:10246953-10246975 TCATATTTTTAGTAGAGATAGGG + Intergenic
1143982635 17:10883289-10883311 TCATGTATTTAGTTTATAGAGGG + Intergenic
1146754618 17:35417779-35417801 TTACATACTGAGTTTATATAAGG - Intronic
1146994564 17:37307492-37307514 TCATATACTTACTTGACATTTGG + Intronic
1147352028 17:39856443-39856465 TCATATTTTTAGTAGAGATAAGG + Intronic
1147473834 17:40690585-40690607 TCATATACTTTCATAAGATAAGG - Intergenic
1148897449 17:50847382-50847404 TCATATTTTTAGTAGAGATAGGG + Intergenic
1148942103 17:51223661-51223683 TCATATTTTTAGTAAAGATAGGG - Intronic
1149065821 17:52478159-52478181 TCATATTTTTAGTAGAGATAGGG - Intergenic
1149144737 17:53476686-53476708 AGATATACTTAGTTAAGATAAGG - Intergenic
1149449946 17:56742155-56742177 ACATGTAATTAGTTAAGATAAGG + Intergenic
1151539202 17:74756449-74756471 TCATATTTTTAGTTGAGACAGGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1155297254 18:24396977-24396999 TGATATTCTTAGCTTAAATAAGG - Intronic
1156061519 18:33082464-33082486 TCATATTCTTCTTTTTGATATGG - Intronic
1156705431 18:39875724-39875746 TCATTTACTTATTTTTGAGATGG - Intergenic
1156872200 18:41958585-41958607 TAAAATACTTGGTTTCGATATGG - Intronic
1159305701 18:66639575-66639597 TGATGTACTTAGTTTATATGAGG + Intergenic
1160482165 18:79251685-79251707 TCATATATTTAGTTTATATCTGG - Intronic
1162469270 19:10862655-10862677 TCATATTCTTAGTAGAGATAGGG - Intronic
1164020314 19:21296958-21296980 TTATATATTTAGTTGAGATGGGG - Intronic
1164906114 19:31969546-31969568 TCAAATGCTTAGTTCAGATTTGG - Intergenic
1167199694 19:48055804-48055826 TCATATATTTAGTAGAGACAGGG + Intronic
1168690679 19:58375084-58375106 TCATATTTTTAGTATAGACAGGG - Intronic
927161578 2:20267917-20267939 TCGTATCCATAGTTTACATAAGG - Intronic
927231583 2:20829370-20829392 TTCTATTCTTAGTATAGATAGGG + Intergenic
927231606 2:20829506-20829528 TTCTATTCTTAGTATAGATAGGG + Intergenic
928563627 2:32518687-32518709 AGATATAATTAATTTAGATATGG - Intronic
929826723 2:45314585-45314607 TCATTTATTTAGTTTTGAAACGG - Intergenic
930696983 2:54421710-54421732 CCTTATACTTGGTTGAGATAGGG - Intergenic
931122545 2:59235869-59235891 AGATATAATTAGTTTAAATAAGG - Intergenic
933298663 2:80518855-80518877 TCAGATACTAGGTTTAGATTTGG - Intronic
935027988 2:99295804-99295826 TCATTTTCTTAGGTCAGATATGG - Intronic
935523565 2:104139384-104139406 TCATATAATTAGTTGGGAAAAGG + Intergenic
936695590 2:114943444-114943466 TTATATTCTTAGTAGAGATAGGG + Intronic
938723694 2:134088452-134088474 TTATATACTTTGTTTACAAAAGG + Intergenic
939934697 2:148276311-148276333 TTATTTATTTATTTTAGATAGGG - Intronic
941929465 2:170925695-170925717 TCATATATTTAGTAGAGATGGGG - Intergenic
943508584 2:188794862-188794884 TCGTATTTTTAGTTGAGATAGGG + Intergenic
944111845 2:196140735-196140757 TCATATTTTTAGTAGAGATAGGG + Intronic
944485164 2:200197943-200197965 TCTTATCCTTAGTGTAGAAATGG + Intergenic
945736917 2:213612177-213612199 TCTTATCTTTAGTTTAGATATGG + Intronic
946316632 2:218919612-218919634 TCGTATACTTAGTAGAGATGGGG + Intergenic
946522505 2:220481984-220482006 TCATATTCTTAGTAGAGATGGGG + Intergenic
947237126 2:227952703-227952725 TCATTTCCTTAGTTCAAATAAGG + Intergenic
1170122907 20:12929287-12929309 TCATTTGTGTAGTTTAGATAAGG + Intergenic
1170807468 20:19645368-19645390 TAATATAATTATTTTAGATCAGG + Intronic
1171089367 20:22269537-22269559 TCACATACTTGGATAAGATAAGG + Intergenic
1172361379 20:34314994-34315016 TCATATTTTTAGTAGAGATAGGG - Intergenic
1173053321 20:39586593-39586615 TCATTTACCTAGTTTAAATTAGG + Intergenic
1173053829 20:39592020-39592042 TCTTATACTTCTCTTAGATAGGG + Intergenic
1174817480 20:53699233-53699255 TCATTTATTTATTTTAGAGATGG + Intergenic
1175005472 20:55677715-55677737 TCAAGCACTTAGTTTAGTTATGG + Intergenic
1176225018 20:63992432-63992454 TCATATTTTTAGTATAGATGGGG + Intronic
1177832019 21:26149589-26149611 TATTATACTTAGTTCAGATTTGG - Intronic
1178035386 21:28576881-28576903 TCATATTTTTAGTAAAGATAGGG + Intergenic
1178181960 21:30171727-30171749 TCATATTTTTAGTAGAGATAGGG - Intergenic
1181449257 22:23007128-23007150 TTATTTACTTAGTTTAGAAATGG - Intergenic
1181890645 22:26060200-26060222 ACATATAATTTGTTTACATATGG + Intergenic
1184028506 22:41876367-41876389 TCATATACTTAATTTTACTAAGG + Intronic
950538683 3:13596936-13596958 TTATTTATTTATTTTAGATAAGG + Intronic
951385920 3:22042408-22042430 TTCTATACTTAGTTGTGATAGGG + Intronic
954192818 3:48976381-48976403 TTATATTCTTAGTATAGATGCGG + Intronic
954225255 3:49177055-49177077 TCAAGTACTCAGTTTAGCTATGG - Intergenic
954445668 3:50545599-50545621 TCATATTTTTAGTAGAGATAGGG + Intergenic
957294111 3:78314102-78314124 TCAAATACTTAATTTAGGCATGG - Intergenic
957799076 3:85051262-85051284 TCATAAACTTATTTTAAAAATGG - Intronic
958709402 3:97698799-97698821 TCCTATACTCAGTTTACTTATGG - Intronic
959826479 3:110803133-110803155 AAATATAATTAGTTTAGATGAGG + Intergenic
959848791 3:111064174-111064196 TCATATAATTAGTTTAAAAGGGG - Intergenic
959949068 3:112158906-112158928 TCTTTTTCTTAGTCTAGATAAGG + Intronic
960481341 3:118194181-118194203 TCTTTTACTTAGTCTAGCTAAGG + Intergenic
962296117 3:134189138-134189160 TCATATACTTAGTTTAGATATGG - Intronic
963370607 3:144395059-144395081 AAATATAATTAGTTTAGATAAGG - Intergenic
964158984 3:153623224-153623246 TAATATATTTAGTATAAATATGG + Intergenic
964185188 3:153934092-153934114 TCATATCCTTTGTAGAGATATGG + Intergenic
965086665 3:164108761-164108783 TCATAGACTCAGTGTACATATGG - Intergenic
965398514 3:168189554-168189576 TCAAATAGTTGGTTTAAATAGGG - Intergenic
969953380 4:10863798-10863820 TCAAATACTATGTTTAGGTATGG + Intergenic
972126696 4:35776230-35776252 TATTATACTTAGTATAGATCAGG - Intergenic
972496942 4:39642983-39643005 TTATTTACTTATTTTAGAGATGG + Intergenic
972800553 4:42471504-42471526 TCAGATAAGTAGTTTAAATAGGG + Intronic
973270929 4:48262665-48262687 TCAAAGACTTCGTTTAGAAAAGG + Intronic
973667061 4:53171878-53171900 TCATTTTCTTAGTTTAGCTAGGG + Intronic
974384499 4:61187375-61187397 TCATTTACCTACTTTAGATATGG - Intergenic
975822430 4:78285602-78285624 TCATATTTTTAGTAGAGATAGGG + Intronic
976637084 4:87296981-87297003 TTATTTATTTATTTTAGATAGGG - Intergenic
977072816 4:92413595-92413617 TCATTTAATGAGTTTACATATGG + Intronic
979839361 4:125418980-125419002 TCAGATAATTAATTTAGAAATGG + Intronic
979884976 4:126015356-126015378 TCAGATACATTGTTTAGGTAGGG - Intergenic
980274970 4:130638595-130638617 TCATATTCTTAGTAGAGATGGGG + Intergenic
981095264 4:140772835-140772857 TCATATTCTTAGTAGAGATGGGG + Intergenic
981350502 4:143723866-143723888 ACATATACTTAGAGTATATAAGG + Intergenic
984352241 4:178610799-178610821 TCATATTTATAGTATAGATAGGG + Intergenic
985295913 4:188437010-188437032 TCATATAATTTGTTTATCTAAGG + Intergenic
985715222 5:1454372-1454394 TCATATTCTTAGTAGAGACAGGG + Intergenic
986069093 5:4264922-4264944 TCATTTGCTTAGTCAAGATATGG - Intergenic
986118840 5:4810606-4810628 TGAAATAATTTGTTTAGATAGGG + Intergenic
986647472 5:9931664-9931686 TAATAAACTTACATTAGATAAGG + Intergenic
986660428 5:10054764-10054786 TCATATTTTTAGTAGAGATAGGG - Intergenic
986942595 5:12973110-12973132 TCTTATACTTAGTGAACATATGG - Intergenic
988381862 5:30507620-30507642 CCATATACTTAGGTGAGAAAAGG - Intergenic
988903410 5:35758831-35758853 TTATATATTTAGTAGAGATAGGG - Intronic
990069445 5:51762048-51762070 TCACAGATTTAGTTTATATAGGG - Intergenic
990869183 5:60412883-60412905 TCAAATACTTTTTATAGATAAGG + Intronic
991162557 5:63521231-63521253 ACATATAATTAGTTAAGATGAGG + Intergenic
991388896 5:66121434-66121456 AGATATACTTAGTTAAGATGAGG + Intergenic
991672925 5:69064869-69064891 TCGTATTCTTAGTAGAGATAGGG + Intergenic
991684504 5:69169241-69169263 TCATATTTTTAGTATAGATGGGG + Intronic
991983251 5:72255668-72255690 TAATATACTTACCTTATATAGGG - Intronic
992915106 5:81441867-81441889 TCAAAAGCATAGTTTAGATATGG + Intronic
993025566 5:82641754-82641776 TTAAATACTTAATTTAGAGAAGG + Intergenic
993236306 5:85314361-85314383 TCATATTTTTAGTAGAGATAGGG - Intergenic
993319973 5:86459639-86459661 ATATACACTTACTTTAGATATGG + Intergenic
994004874 5:94826244-94826266 TCATTTACTAACTTTAGATTTGG + Intronic
994010579 5:94897535-94897557 TCATATTTTTAGTAGAGATAGGG + Intronic
994937997 5:106281061-106281083 TTATTTACTTATTTTAGAGATGG + Intergenic
996842565 5:127863785-127863807 TGACATTGTTAGTTTAGATAAGG + Intergenic
999443882 5:151623449-151623471 TCATATAGTGAGTCTAGAGAAGG + Intergenic
1000303619 5:159976492-159976514 TCATATATTTAGTAGAGACAGGG - Intergenic
1000487169 5:161861583-161861605 TCAGCTACTAAGTCTAGATATGG - Intronic
1003229450 6:4238255-4238277 TGATCTTCTTAGTTTAGATGGGG - Intergenic
1003294424 6:4811797-4811819 TAATTTATTTAGTTTAGAGATGG + Intronic
1004574378 6:16880312-16880334 TCATATTCTTAGTAAAGACAGGG - Intergenic
1004969942 6:20898777-20898799 TCATAAAATTATTTTAAATAGGG - Intronic
1005241253 6:23831311-23831333 TCTTATAATTTCTTTAGATATGG + Intergenic
1005484138 6:26283672-26283694 TTATATACTTAGTTGAAATCAGG - Intergenic
1005486399 6:26304511-26304533 TCATGTTTTTTGTTTAGATATGG + Intergenic
1005666209 6:28059081-28059103 TCATCATCTAAGTTTAGATAAGG + Intergenic
1006585152 6:35105349-35105371 TTGTATACTTAGTAGAGATAGGG - Intergenic
1008245456 6:49165836-49165858 TCATATATTTTGATTAGCTATGG + Intergenic
1008608322 6:53162504-53162526 TCTTGTGCTTAGTTTAGAAAAGG + Intergenic
1010308926 6:74359786-74359808 ACATACATTTTGTTTAGATATGG + Intergenic
1010413657 6:75589202-75589224 ACATATACAAAGTTTAGAAAGGG + Intergenic
1010648158 6:78419217-78419239 TCATTTACTGAGTTCAGCTAGGG - Intergenic
1011592996 6:88988730-88988752 TCATATTTTTAGTAGAGATAGGG + Intergenic
1011894989 6:92214854-92214876 TCATAAACTTATTTTCTATATGG + Intergenic
1012321486 6:97852688-97852710 TCACATACAGTGTTTAGATAAGG + Intergenic
1014310682 6:119797188-119797210 TTATATTCTTATTTTAGATTCGG - Intergenic
1016053766 6:139557272-139557294 TCATTTACTTATTTTTGAGACGG + Intergenic
1016524549 6:144986779-144986801 TCATACACTTATCTGAGATATGG + Intergenic
1016838087 6:148499347-148499369 TCACATAATTAGTTTATAAAAGG + Intronic
1017885125 6:158592656-158592678 TCATATATTTAGTAGAGATGGGG + Intronic
1019025517 6:168959444-168959466 TCGTATTTTTAGTGTAGATAGGG + Intergenic
1020186712 7:5964618-5964640 ACATATACATATTTGAGATAGGG + Intronic
1020296204 7:6760156-6760178 ACATATACATATTTGAGATAGGG - Intronic
1020799468 7:12716244-12716266 TCATTTATTTATTTTAGACAGGG + Intergenic
1020827225 7:13044442-13044464 ACATATAATTAGTTAAGATGAGG + Intergenic
1020989207 7:15175427-15175449 TCATGTAATTAATTTAGATAGGG + Intergenic
1021320691 7:19207317-19207339 TTATTTACTTATTTTAGAGAAGG + Intergenic
1021582017 7:22166096-22166118 TCATATATATATTTTAGAGATGG + Intronic
1021674749 7:23068921-23068943 TTATTTATTTATTTTAGATATGG + Intergenic
1023110717 7:36808130-36808152 TCCTATTCTTAGTTTTTATAGGG + Intergenic
1023279459 7:38554822-38554844 TCAGATATAAAGTTTAGATACGG + Intronic
1025723244 7:64035337-64035359 TTATATATTTAGTTGAGACAGGG - Intronic
1028318829 7:89436162-89436184 CCATTTACTTAGTTTGGAGAAGG - Intergenic
1028844575 7:95465342-95465364 TGATATGCTCAGTTTAGTTAGGG + Intergenic
1031310068 7:120185214-120185236 TAAGATACTTAGTTTTGGTATGG + Intergenic
1031453812 7:121955176-121955198 CCACATACTTATTATAGATATGG - Intronic
1031686887 7:124741420-124741442 TCATAGACTGAGTTGAGAAATGG - Intergenic
1032734944 7:134683629-134683651 TCATATACTTAGTAGAGACAGGG - Intergenic
1032823995 7:135551556-135551578 TCATATTTTTAGTTGAGATGGGG + Intergenic
1032946020 7:136853699-136853721 TAATATCCTTAGTTAAGAAAAGG - Intergenic
1033379976 7:140806384-140806406 TCATATCCCTAGGTAAGATATGG + Intronic
1033813089 7:145040487-145040509 TCATTTACTGACTTTAGATTTGG + Intergenic
1038934519 8:32233735-32233757 TCATATTTTTAGTAGAGATAGGG + Intronic
1039050377 8:33487291-33487313 TTATATACTTAATTTATGTAAGG - Intronic
1041057638 8:54003549-54003571 TCATCAACTGATTTTAGATAAGG + Intronic
1041307709 8:56479741-56479763 TCATTTACTTTGCTTAGAGACGG - Intergenic
1041844863 8:62316583-62316605 TCATATCCTTTGTAGAGATAGGG - Intronic
1042592431 8:70409697-70409719 TTATTTACTTATTTTAGAGATGG - Intergenic
1046168286 8:110469781-110469803 TCATATAATTATTTCAAATATGG - Intergenic
1048094997 8:131282730-131282752 TCCTATACTGAGTTGAGTTATGG + Intergenic
1048208386 8:132433883-132433905 TTATTTACTTAGTTTTGAGATGG - Intronic
1051033419 9:12712465-12712487 TCCTCTTCTTAGTTTAGCTAAGG - Intergenic
1051343052 9:16128984-16129006 TGATATAATTAGTTTAGGTGAGG - Intergenic
1051630670 9:19137669-19137691 TCAAAGACTTGGTTTAGATGGGG - Intronic
1055659646 9:78490231-78490253 GCATATGCTTAGGTTGGATAGGG + Intergenic
1056260920 9:84847630-84847652 TCATAGACTTCGTTTTGATCAGG + Intronic
1057166595 9:92932188-92932210 TCATATACTGGACTTAGATACGG - Intergenic
1057322743 9:94030083-94030105 TCACATCCTTATTTTAGAAAGGG - Intergenic
1058181916 9:101808985-101809007 TTATATTTTTAGTTGAGATAGGG - Intergenic
1058671747 9:107366206-107366228 TTATATTTTTAGTATAGATAGGG - Intergenic
1187288908 X:17933047-17933069 AGATATAATTAGTTAAGATAAGG - Intergenic
1188246438 X:27840848-27840870 CCCTGTACTTAGTTTAGTTAAGG - Intergenic
1189061527 X:37758623-37758645 AGATATATTTAGTTAAGATAAGG - Intronic
1189110411 X:38284176-38284198 TCTTATACTTAGTTTTATTAAGG - Intronic
1193199585 X:78672875-78672897 AGATATAATTAGTTAAGATAAGG + Intergenic
1194306053 X:92250046-92250068 TCAAATACATATTTTAAATAAGG - Intronic
1194986162 X:100491918-100491940 TCATATACTTACTCTAGGAAAGG - Intergenic
1195380781 X:104268824-104268846 TTATATACTTATTAGAGATAGGG - Intergenic
1196104836 X:111884599-111884621 TCATAACCTAAGTTTAGATAAGG + Intronic
1196215338 X:113044432-113044454 TCTTATACTAATTTTAGATTTGG + Intergenic
1197309872 X:124891484-124891506 TCGTATTTTTAGTTTAGACAAGG - Intronic
1198399576 X:136256101-136256123 TCATATACACAGTTGAGACAAGG + Intronic
1198913982 X:141646290-141646312 TAATATACTTATTTTATACAAGG - Intronic
1199038590 X:143082741-143082763 TCATAAACATAGTTCAGATTGGG + Intergenic
1199246518 X:145611508-145611530 CCATATACTTTGTTTATATTTGG + Intergenic
1201325413 Y:12751417-12751439 TCATATATTTAGTTTCTATGTGG + Intronic
1202097077 Y:21263135-21263157 TCATTTATTTATTTTAGAAAGGG + Intergenic