ID: 962299274

View in Genome Browser
Species Human (GRCh38)
Location 3:134223557-134223579
Sequence TTGTTTATAAAAAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 558}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962299267_962299274 12 Left 962299267 3:134223522-134223544 CCTACCAAGAAGGCAGTGAACTT 0: 1
1: 0
2: 3
3: 10
4: 134
Right 962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 60
4: 558
962299268_962299274 8 Left 962299268 3:134223526-134223548 CCAAGAAGGCAGTGAACTTGAGC 0: 1
1: 0
2: 0
3: 17
4: 184
Right 962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 60
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962299274 Original CRISPR TTGTTTATAAAAAGGGAGGA GGG Intronic
900969762 1:5984949-5984971 TCGTCTATAAAACGGGAGTAAGG + Intronic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
902725658 1:18334441-18334463 TTGTTTATGAAATGGGAATATGG + Intronic
903433670 1:23329474-23329496 TTGGTTCTGAAAAGGGAGGAGGG - Intronic
903513537 1:23894435-23894457 TTTTTTAATAAAAGGAAGGAAGG + Intronic
903980290 1:27181695-27181717 TTGTTTAAAAAGAGGGATGTCGG + Intergenic
904134905 1:28304589-28304611 CTGTTTCAAAAAAGGAAGGAAGG + Intergenic
904143958 1:28375378-28375400 TTATTTATAAAGAGAGAGGCTGG + Intronic
904663329 1:32101426-32101448 TTTTTTAAAAAAGGGGGGGAGGG - Intronic
905889190 1:41509209-41509231 TTTTTTAAAAAGAGAGAGGATGG - Exonic
906897910 1:49799541-49799563 TTGTTTATAGGAAGTGAGGGAGG + Intronic
907225492 1:52942549-52942571 TTTTTTAAAAAAAGAGAGGTGGG - Intronic
907790366 1:57657961-57657983 TTGTTGAAGAAAAGGAAGGATGG - Intronic
908279243 1:62513139-62513161 GTCTATTTAAAAAGGGAGGATGG + Intronic
908595188 1:65681067-65681089 TTTTGTATAAAAAGGAAGCATGG + Intergenic
908756076 1:67470089-67470111 GTGTATATAAAAAGGAATGAAGG + Intergenic
908907488 1:69033070-69033092 TGGTTTATAAAAAAGTAGAAGGG - Intergenic
909556241 1:76957364-76957386 TTCCTTATAAGAAGAGAGGAGGG - Intronic
910091591 1:83470946-83470968 TTGTTTATAAAATGGGTGGGTGG + Intergenic
910163725 1:84300466-84300488 TTATTTTTAAAAAGGGAAGCAGG + Intronic
911280494 1:95921240-95921262 TTATTTATAAAAAGAAAGGTGGG - Intergenic
911315064 1:96345876-96345898 TTGTTTCTTAAAAGGGTGAAAGG + Intergenic
911368255 1:96966466-96966488 TTGTTTAAAAGAAGGCAGGAAGG + Intergenic
912321976 1:108721766-108721788 TTCATTATCAAAAGGAAGGAAGG - Intronic
912374693 1:109200716-109200738 TAGTCTATAAAACAGGAGGATGG - Exonic
912961355 1:114198283-114198305 TAGTTTAAAAAAAGGGAGGGGGG + Intergenic
914836759 1:151213183-151213205 TTTTTTAAAAAAAGGCAGGCCGG - Intronic
915529543 1:156495462-156495484 TGGGTTCTCAAAAGGGAGGAAGG - Intronic
915864561 1:159485284-159485306 GTGATTATAAAAAGGGACCATGG + Intergenic
915988194 1:160487483-160487505 TTTTTCTTAAAAATGGAGGAAGG - Intronic
916023687 1:160815686-160815708 TAGTTTATAAAAATGCAGGTTGG - Intronic
916160426 1:161906488-161906510 GTGTTAATAAAAGGGGAGGCAGG + Intronic
918384596 1:183993060-183993082 TTTCTTGTAAAAAGTGAGGATGG - Intronic
918607690 1:186448595-186448617 TCATTTATAAAAAGGAAGGAAGG - Intronic
918670630 1:187211083-187211105 TTGCTTACAACAAGGGAGCAGGG + Intergenic
918961780 1:191288009-191288031 AAGTTTATAAAAAGGGAGTCAGG + Intergenic
919261112 1:195195205-195195227 TTATGTATAAAAAGGGGGAAGGG - Intergenic
919472777 1:197999484-197999506 TTGTATGAAAAAAGGCAGGATGG + Intergenic
919489629 1:198189915-198189937 ATATTTTTAAAAAGAGAGGAGGG + Intronic
919776668 1:201198726-201198748 TCCTCTATAAAAAGGGTGGATGG - Intronic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920744289 1:208611641-208611663 TAGATTATAAATAGGTAGGAAGG + Intergenic
921162421 1:212482748-212482770 TGATTTAAAAAAAGGGAGGGGGG - Intergenic
921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG + Intronic
921641678 1:217562191-217562213 GTGTTTTAAAAAAGGGAGGGGGG - Intronic
921972259 1:221162818-221162840 GTATTTATAAAAATGGAGGGTGG + Intergenic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922985399 1:229862406-229862428 TTGGTTAAAAAAAAAGAGGAGGG - Intergenic
923590998 1:235319704-235319726 TTTTTTAAAAAAAGGGAGGACGG + Intronic
924123615 1:240827559-240827581 CTCTTTATAAAAAGTGAGGCTGG + Intronic
924498871 1:244617063-244617085 GTGTTTTTAAAAAGGCAGGCAGG + Intronic
924523390 1:244824806-244824828 ATGTATATGAAAAGGGAGGCGGG + Intergenic
924901327 1:248404206-248404228 GTGTGTATAAAATGGGAGTAAGG + Intergenic
1063937222 10:11090424-11090446 TTTTTTATTAATTGGGAGGAGGG - Intronic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064859355 10:19810387-19810409 TTTTGTATAAAATGTGAGGAAGG - Intergenic
1065251902 10:23823837-23823859 TTGTTTTAAAAAGGGGTGGAAGG + Intronic
1065312244 10:24427673-24427695 TTCTTCATAAAAAGGGAGTTTGG + Intronic
1065391085 10:25182377-25182399 TTGTTTTTAAAAAGTAAGTAGGG - Intronic
1065484556 10:26225254-26225276 CTGGTGATAAAAAGGCAGGATGG - Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1065896509 10:30167425-30167447 TTTTTTTAAAAAAGGGAGGCCGG - Intergenic
1066414085 10:35203376-35203398 TTTTTTAAAAAAAGGGTGGGTGG - Intronic
1066627826 10:37427345-37427367 TTCTTTAGAAAATAGGAGGAGGG + Intergenic
1067513582 10:46916104-46916126 ATATTTATTAAAAGTGAGGAAGG - Intronic
1067648670 10:48135730-48135752 ATATTTATTAAAAGTGAGGAAGG + Intergenic
1068080128 10:52309613-52309635 TTCTTTATAAAATGGGATGCAGG - Intergenic
1068496085 10:57786832-57786854 ATGCTTATAAAAAGGGCGAAAGG - Intergenic
1068645245 10:59458805-59458827 TTGTTCATAAAAAGAAATGAAGG - Intergenic
1070374797 10:75819161-75819183 TTGTTTAGTAGATGGGAGGAGGG - Intronic
1070686551 10:78488867-78488889 TAGCTTAAAAAAAGTGAGGAGGG + Intergenic
1071593007 10:86894141-86894163 ATGTTTAGAAAAAGGGAACAGGG - Intronic
1072356301 10:94615142-94615164 TTGTTTAAAAAAAGAGGGAAAGG - Intergenic
1072369324 10:94747773-94747795 TAGTTCATCAAAAGGGAGGAGGG + Intronic
1072479088 10:95793333-95793355 TTGTTTATAAAAAATAATGAAGG + Intronic
1072513993 10:96159221-96159243 TTGTTTACAAAAAGAGAAGCAGG - Exonic
1073206451 10:101771855-101771877 TGGTTTAAAAAGAGGGTGGAAGG - Intronic
1073369415 10:102973818-102973840 TTGTTTTAAAAAAGGGGGGGGGG - Intronic
1074349762 10:112724769-112724791 TTTTTCAAAAAAAGGGGGGATGG - Intronic
1074592429 10:114825573-114825595 TCATTTCTAAAAAGGGAGGCAGG - Intronic
1074730336 10:116366063-116366085 ATATTTATAATAAGGGTGGATGG - Intronic
1074741684 10:116490977-116490999 TTGTTTTTAAAAAGTGACAAAGG + Intergenic
1075752839 10:124787572-124787594 TTACTTTTAAAAAGGAAGGAGGG + Intronic
1075770391 10:124929649-124929671 TTATTCATAAAAATGGAGGCTGG + Intergenic
1075900197 10:126036865-126036887 CTGTTTTTAGAAAGAGAGGAAGG - Intronic
1077345238 11:2045380-2045402 TGGATTATAAAAATGGAGAATGG - Intergenic
1077629260 11:3799671-3799693 TTGTTTAAAAAATGGGAGACTGG + Intronic
1078203301 11:9204229-9204251 TTTATTATCACAAGGGAGGATGG - Exonic
1078221697 11:9356675-9356697 CTGTTTTTAAAAAAGGAGGGAGG + Intergenic
1078939917 11:15991050-15991072 TTTTTTCTAAACAGGAAGGAGGG + Intronic
1079231799 11:18655542-18655564 TTCTTTTAAAAAAGGGAGGGGGG - Intergenic
1079362168 11:19778079-19778101 TTATTTTTGAAAACGGAGGAGGG - Intronic
1080278381 11:30528115-30528137 TTGTGTATAAAAAGGCAGTGTGG - Intronic
1081171125 11:39871338-39871360 TTCTTTGGAAAAAGGGAGGGTGG - Intergenic
1081174938 11:39915472-39915494 TTGTTTAAAAAAATGGCGGCTGG - Intergenic
1081201978 11:40227526-40227548 TTGTTTCTGAGAGGGGAGGAGGG + Intronic
1082763610 11:57149319-57149341 TTGGTTACACAAAGGGAGTAAGG + Intergenic
1082829448 11:57604636-57604658 TTTTTTTTAAAAAGGGAGGTGGG - Intronic
1082874513 11:57974249-57974271 TTGTTTATAAAAATAGGGGCAGG + Intergenic
1086393603 11:86391215-86391237 TTTTTTTTAAAAATGGAGGGTGG + Intronic
1086794795 11:91086218-91086240 TTGTTTAGAAATACAGAGGAAGG + Intergenic
1086820945 11:91435319-91435341 TTGTTTATTAAAATGGCTGAAGG + Intergenic
1087642360 11:100768857-100768879 TTATATATAAAATGGGAAGATGG - Intronic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088281939 11:108143960-108143982 CTGTTTAAAAAAAGGGGGGGGGG - Intronic
1088350766 11:108885033-108885055 TTGGACATAAAAAGGGAGGGAGG - Intronic
1088406784 11:109490143-109490165 TTGTTTGTGGAAAGGAAGGATGG + Intergenic
1088542913 11:110931705-110931727 TTACTTTTAAAATGGGAGGAGGG - Intergenic
1090236691 11:125153467-125153489 TTGATTATACAAAGTAAGGAAGG - Intergenic
1090569596 11:128031792-128031814 TACTTTATAAAATAGGAGGACGG + Intergenic
1091424709 12:377010-377032 TTGTTTTAGAAAAGGGAGGAAGG - Intronic
1091853462 12:3719815-3719837 TTTTTTATAAAAATGGAAGGTGG + Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1092330489 12:7582706-7582728 ATGTTTTTAAAAAGGGTGGGGGG + Intergenic
1092373686 12:7937789-7937811 TACTTTATAAAAAGGGAAGAAGG - Intergenic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092518802 12:9244648-9244670 TTTTTAATAAAAAATGAGGATGG - Intergenic
1094719243 12:33046057-33046079 TTCATTGTAAATAGGGAGGAAGG + Intergenic
1095181963 12:39156677-39156699 TTATTTTTAAAAAGGGTTGAGGG + Intergenic
1095288994 12:40453661-40453683 TCATTTATATAAAGTGAGGATGG + Intronic
1095574662 12:43722684-43722706 TCTTTTCTAAAAAGGGAAGATGG - Intergenic
1095575356 12:43731604-43731626 TTGTTTAATAAAAAAGAGGAGGG + Intronic
1095887160 12:47201128-47201150 TCGTTTAGAAAAGGGGAGGGGGG + Intronic
1095993790 12:48060567-48060589 TTTTTTAGAAAAAGGGAGAGAGG - Intronic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096739443 12:53681653-53681675 TGGTTTTTTAAAAAGGAGGAGGG - Intergenic
1098187403 12:67912217-67912239 TTATTACCAAAAAGGGAGGAGGG - Intergenic
1098775586 12:74610361-74610383 TAGTTTATAAAAGGAGAGGGAGG - Intergenic
1099014626 12:77329390-77329412 TTGCTTACAAAATGGGAGAAGGG - Intergenic
1099643763 12:85324362-85324384 TGGTTAATAAAAATGGAAGATGG - Intergenic
1100131387 12:91498600-91498622 TTATTTATGAAAATGGAGGCCGG + Intergenic
1101279720 12:103239831-103239853 TTTATTATCAGAAGGGAGGAAGG + Intronic
1102106940 12:110333361-110333383 TTGACTTTCAAAAGGGAGGAAGG - Intronic
1102237124 12:111300415-111300437 TTGTTTTTAAAAGGGGTGGCTGG - Intronic
1102317612 12:111902430-111902452 TTTTAGGTAAAAAGGGAGGATGG - Intergenic
1102427729 12:112857508-112857530 CTGGTTTTGAAAAGGGAGGAAGG + Intronic
1103332030 12:120160899-120160921 ATGTTTAGTAAAAGGGAGGAAGG + Intronic
1103519326 12:121527358-121527380 TTGTTTAAAAAAAGGTGGGGAGG + Intronic
1104111658 12:125710298-125710320 GTTTTTATAGAAAGGGAGGAAGG + Intergenic
1104157725 12:126149619-126149641 ATCTTTATAAAAAGGAAGGATGG - Intergenic
1104661633 12:130615679-130615701 TTGATTATAGACAGGGAGAAAGG + Intronic
1105250231 13:18692590-18692612 ATGTTTATTAAAAGGGAGCATGG - Intergenic
1105652845 13:22399449-22399471 TTTTTTTTAAAGAGGGAGAAAGG + Intergenic
1107509417 13:41067929-41067951 TATTTAATAAAAAGGGGGGAAGG + Intronic
1108438082 13:50420975-50420997 CTATTTTTAAAAAGTGAGGATGG + Intronic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1108942832 13:55978400-55978422 ATGTTTATAATAAGGGAAAATGG + Intergenic
1109313422 13:60721833-60721855 TTTTTTAAAAAAACGGAGAAAGG - Intergenic
1109513195 13:63405802-63405824 TTGTTTATAAAAAAGGTGGCAGG + Intergenic
1109672793 13:65632171-65632193 TTTTCTATGAAAAGGGTGGAGGG - Intergenic
1110125538 13:71938201-71938223 TTTTTTGTAAAAAGGAAGAAAGG - Intergenic
1110224738 13:73107813-73107835 TTGTTTATAAATAGTAATGAGGG - Intergenic
1110417690 13:75270078-75270100 TTGTTTAGCACAAGGGATGACGG - Intergenic
1110963368 13:81658982-81659004 TCCTCCATAAAAAGGGAGGAAGG + Intergenic
1111341142 13:86888002-86888024 ATCTTTTTAAAAAGGGTGGATGG + Intergenic
1111638268 13:90933050-90933072 TTATTTATAAAATTGGAAGAAGG - Intergenic
1111836409 13:93393885-93393907 TGCTATATAAAAAGTGAGGAAGG - Intronic
1111994648 13:95152720-95152742 ATGTTTATAATAAAGGGGGAAGG + Intronic
1112580287 13:100672493-100672515 CTGTTCAAAAAAAGGGGGGAAGG - Intronic
1112864007 13:103871538-103871560 TTGTTTATAGCAAGGCAAGAAGG - Intergenic
1113662317 13:112116176-112116198 TTGTTTAAAAAAAAATAGGAAGG - Intergenic
1115852131 14:37597018-37597040 TTTTTTACAAAAAGGGTGGGGGG + Intronic
1116424066 14:44767943-44767965 TTTTCTTTAAAAAGGGAGGAGGG + Intergenic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1117946935 14:61037166-61037188 TTGTTTAGAAAAAGGAAAGAAGG + Intronic
1118202155 14:63686072-63686094 TTGTTTATGATAAGAAAGGAGGG - Exonic
1119378900 14:74216344-74216366 TTATTTTTAAAAAAGGAAGATGG - Intergenic
1119575090 14:75712894-75712916 TTGTGGTTAAAAAGGGGGGAGGG + Intronic
1119607939 14:76036830-76036852 CTGTTTCTAAAAAAGAAGGAGGG - Intronic
1119785136 14:77307448-77307470 TTGTTTTTAAAAAGGAAGGCAGG + Intronic
1120427241 14:84364027-84364049 TTGATTAAAAAAAGAAAGGAAGG + Intergenic
1120497998 14:85260177-85260199 TTCTTTATAACAAGGCAAGAAGG + Intergenic
1120522840 14:85544877-85544899 TTGCTGAAAAAAGGGGAGGAAGG - Intronic
1120582915 14:86276340-86276362 TTATTTATACAAAAGGAGGCAGG + Intergenic
1120686119 14:87539914-87539936 TTGTTTATAAATAGATGGGATGG - Intergenic
1120817688 14:88880772-88880794 CTATTTTTAAAAAGGGAGGCAGG - Intronic
1120913078 14:89685487-89685509 TTCTTTTATAAAAGGGAGGAGGG + Intergenic
1121326559 14:93023572-93023594 TTGTTGAAACAAAGGAAGGATGG + Intronic
1121412425 14:93757189-93757211 GGGTTTAAAAAAAGGAAGGAAGG + Intronic
1121461199 14:94080055-94080077 TCATCTATAAAAAGGGGGGAGGG + Intronic
1121920257 14:97874057-97874079 TACTTCATAAAAAGGGAGAAAGG + Intergenic
1122287826 14:100662705-100662727 TTATTTTTAAAAAAGGAGGGGGG - Intergenic
1124406595 15:29398412-29398434 TTCTTTTTTAAAAGAGAGGATGG - Intronic
1124439585 15:29676279-29676301 TTAATTATAAAAAGAGAGTAAGG - Intergenic
1124611307 15:31211130-31211152 ATGTTTTTAAAAAGGGTGTATGG + Intergenic
1124639713 15:31390045-31390067 CTGTTAATAAAAAGGAAGCAAGG - Intronic
1124655126 15:31501308-31501330 TTATTTATAAAATGGGTGGTGGG + Intronic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125132136 15:36295077-36295099 TTGTTTATAAAAATGTTTGAAGG + Intergenic
1125561489 15:40637229-40637251 TTCTTCATTAAAAGGAAGGAAGG - Intronic
1126114327 15:45195225-45195247 GTGTTTAGAAAAAGGGAGATTGG - Intronic
1126689006 15:51273250-51273272 TCCTGTATAAAAAGTGAGGAAGG - Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1127849635 15:62901466-62901488 TGGTTTAAAAAAAGAAAGGAAGG + Intergenic
1129370307 15:75089353-75089375 TTATTTTTAAAATGTGAGGAGGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129555800 15:76507516-76507538 TTTTTTTTGAAAAGGGAGTAGGG + Intronic
1129624971 15:77187617-77187639 CTGTTAATAATAAAGGAGGATGG + Intronic
1130732766 15:86516300-86516322 TTGGTAATAAAATGGGAGGAAGG + Intronic
1131653635 15:94430345-94430367 TTTTTTTTAAAAAGGCAGCATGG - Intronic
1131941545 15:97572017-97572039 TTGTTTTTGGAAAGGGAGGCAGG + Intergenic
1131966863 15:97853415-97853437 TTCTTCATTAAAAGGGAAGAAGG - Intergenic
1132438226 15:101830686-101830708 TTGTTTATCAAGAGGGACAAAGG - Intergenic
1133537521 16:6716275-6716297 TTGTTTATGAAAAGCAACGATGG - Intronic
1134215731 16:12315784-12315806 TTATTTACAAAAATGGATGATGG + Intronic
1135557697 16:23450878-23450900 TTGTTTAAGAAAAGGTAGGGAGG - Intronic
1135634901 16:24067204-24067226 ATGTTTAAAAGAAGGGAGAAAGG - Intronic
1135763315 16:25155272-25155294 GTGTTTTTAAAAAGGAAGGCCGG + Intronic
1135936381 16:26783916-26783938 TTGTTTACAAAAAGCAAGGCAGG + Intergenic
1138628175 16:58269368-58269390 TTATTTATAAGAAGAAAGGAAGG + Intronic
1139108912 16:63864604-63864626 CTGTTCACAAAAAGGGAGGAAGG + Intergenic
1140082812 16:71765654-71765676 TGGTTTAGAAAAAGGGTGTAAGG + Intronic
1140624832 16:76780412-76780434 TTGGTCATAAAATGGAAGGATGG + Intergenic
1141155545 16:81594120-81594142 TTGTCTCAAAAAAGGGAGGAGGG - Intronic
1141262588 16:82467438-82467460 TTGTTTTTAAAAAAGAGGGATGG - Intergenic
1144342492 17:14321479-14321501 TCGTTTATTTAAAGGGAAGAAGG + Intronic
1145177126 17:20710674-20710696 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146082500 17:29793639-29793661 TTTTTTTAAAAAACGGAGGAAGG + Intronic
1146853254 17:36241538-36241560 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1146869162 17:36365428-36365450 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147049545 17:37781760-37781782 TTTTTTAGAAGCAGGGAGGAGGG - Intergenic
1147058623 17:37855370-37855392 TTTTGTGTCAAAAGGGAGGAAGG - Intergenic
1147072036 17:37966059-37966081 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147083562 17:38045591-38045613 TTTTGTGTCAAAAGGGAGGAAGG + Intronic
1147099508 17:38169558-38169580 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1147250128 17:39148206-39148228 TTTTTTAAAAAAAGGAGGGAAGG - Intronic
1148026320 17:44591463-44591485 TTTTTTTTAAAAAGGAAGGAAGG + Intergenic
1149289545 17:55203445-55203467 TTGTTTGTAGAATGGGTGGATGG + Intergenic
1149416860 17:56468875-56468897 TTGCTTATAAAAGGTGAAGAGGG - Intronic
1150082521 17:62252848-62252870 TTTTGTGTCAAAAGGGAGGAAGG + Intergenic
1150830608 17:68515253-68515275 TTGTTTTTAAACAGGGAAGTGGG - Intronic
1150979045 17:70121122-70121144 TGGTTGATAAAACTGGAGGATGG + Intronic
1153098416 18:1436256-1436278 TTGATTTTAAAAAGGGGGGCGGG + Intergenic
1153385492 18:4490320-4490342 TTGAGTTTAAAAAGTGAGGAGGG - Intergenic
1154020274 18:10658514-10658536 TGGTTGACAAAAAGGGAAGATGG + Intergenic
1154304496 18:13220278-13220300 TCATTTAAAACAAGGGAGGAAGG - Intronic
1154438614 18:14366333-14366355 ATGTTTATTAAAAGGGAGCATGG + Intergenic
1155172376 18:23276441-23276463 TTTTTTAGAAAAAGGAAGAAAGG + Intronic
1155455566 18:26008474-26008496 TTTTATATAAAAAGGGGGCATGG + Intergenic
1155614354 18:27703582-27703604 TTGCCTAGAACAAGGGAGGAAGG + Intergenic
1155657511 18:28209239-28209261 TTGGTCATAAAAAGGGAAAAGGG + Intergenic
1155705061 18:28799889-28799911 TTGTCTCTAAAAGGGTAGGAAGG - Intergenic
1156037018 18:32775804-32775826 TTGTTTTTAAAATGGCAGGAAGG + Intergenic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1157181225 18:45500104-45500126 TTGTTTTTTAAAAGGGGGCATGG + Intronic
1157417604 18:47518888-47518910 TTGTCAATAAAAAGGGAATATGG + Intergenic
1157628096 18:49068419-49068441 TTGTTTAAAGAAAGGTATGAAGG - Intronic
1158919924 18:62180153-62180175 TTTTTTAAAAAAAGGAAAGAAGG - Intronic
1158999312 18:62957005-62957027 TCCTTTAAAAAAAGGGAGGAGGG - Intronic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159212406 18:65342461-65342483 TTTTTTATAAATAGGTAGGTAGG + Intergenic
1159475762 18:68918960-68918982 TTGTATATAAAAGGGAAAGAAGG + Intronic
1159567528 18:70069777-70069799 TTGTTTTTAAAAAGGTACAAAGG + Intronic
1159570791 18:70110222-70110244 TTTTTTTTAAAAAGGGATGGGGG - Intronic
1159605731 18:70472827-70472849 ATGTTTATCAAAAGGGAACATGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1160301895 18:77689452-77689474 TTTTTTTTAACCAGGGAGGAAGG + Intergenic
1160352569 18:78196598-78196620 TTATTTTTAAAAAGTGTGGAAGG + Intergenic
1160599025 18:79998478-79998500 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1160602927 18:80028097-80028119 TTGTGTGTGAAAAGGGAGAAAGG - Intronic
1161620809 19:5296059-5296081 TTGTTTAGAAAAGGGTAGGCTGG - Intronic
1162642039 19:12018563-12018585 TTGTTTGTAAAGTGGGAGTACGG + Intronic
1165251561 19:34540671-34540693 TGGTTTGTAAGTAGGGAGGATGG - Intergenic
1167574485 19:50311543-50311565 TTTTTTAAAAAAGGGGAGGATGG - Intergenic
1167943180 19:52963584-52963606 TTGTTTATTGAGACGGAGGAGGG - Intergenic
925150690 2:1612700-1612722 TTGTTTAAAAATAGGAAGGCAGG - Intergenic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
927545060 2:23945074-23945096 TTATTAAAAAAAAGGGGGGAGGG + Intronic
927825667 2:26308210-26308232 TTTTTTATAAAATGGGACGGGGG - Intronic
928147081 2:28788545-28788567 TTGTTTAGTAAAAGGTAAGAGGG + Intronic
928369324 2:30729367-30729389 TTGTTTAAAAATAGGAAGGGTGG + Intronic
928868201 2:35943975-35943997 TTGTTGAAAAAAAGTGGGGATGG + Intergenic
928967299 2:36989672-36989694 TTTTTTAAAAAAATGAAGGAAGG + Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929085419 2:38163018-38163040 TTGATTATATAAAGAGAGGATGG - Intergenic
929105666 2:38363354-38363376 TTGTTTATTAAAAAGGTGGGGGG + Intronic
929126415 2:38526594-38526616 TTTTTGTTAGAAAGGGAGGAGGG + Intergenic
929305522 2:40356952-40356974 TTGTTTATAATAGGGCAAGATGG - Intronic
930524949 2:52516753-52516775 TTGTTTATAATAAAGGGGGTGGG + Intergenic
931372528 2:61677049-61677071 TGGTTTAAAAAAAGTGAGGTAGG - Intergenic
932177904 2:69619459-69619481 TTGTTGATTAAATGGGTGGATGG - Intronic
932310455 2:70735580-70735602 TTGTTAGGAAAGAGGGAGGAGGG - Intronic
932900600 2:75695166-75695188 TTATTTATAAAAACAAAGGATGG - Intronic
933593580 2:84260462-84260484 TGGGTTATAAAAAGGGAGAATGG + Intergenic
933832719 2:86223810-86223832 TTGATTTTAAAAGGGGGGGAGGG + Intronic
933859750 2:86454126-86454148 TTTTTTACAAAAAGGGAGGTGGG - Intronic
934889366 2:98053405-98053427 GGGTTTATAAAAAGGGTGGGGGG + Intergenic
935358787 2:102229892-102229914 TTGTTTAGAAACAGGGAACAGGG + Intronic
935694027 2:105755272-105755294 TCTTTTTTAAAAAAGGAGGAGGG + Intronic
936545402 2:113388121-113388143 TTGCTTAGAAAAAGGCATGACGG - Intergenic
936751339 2:115645620-115645642 TTTTTTATAATAAGGAAGAAGGG - Intronic
936752218 2:115658858-115658880 TTTATTATAAAATGGGAGGCTGG - Intronic
936785581 2:116090249-116090271 TTGTTTATGAAAAGAGATGGGGG + Intergenic
937707512 2:124938044-124938066 TTATTTAGAAAAATAGAGGATGG - Intergenic
938576826 2:132612189-132612211 TTGATTCTACAAAGGAAGGAAGG - Intronic
939367447 2:141251402-141251424 TTGTGGATAATAAAGGAGGAGGG + Intronic
939528850 2:143331308-143331330 TTTTTTATAAAAAGTTGGGATGG - Intronic
940018500 2:149132063-149132085 TTCTTTTAAAAAAGGGAGCATGG - Intronic
940375894 2:152958085-152958107 TTATTTATAAAAATGGGTGATGG - Intergenic
941042555 2:160639127-160639149 TTTCTTATAAAAAGGAAGGTGGG - Intergenic
941059905 2:160835189-160835211 TTGTTTATATATCGGGAGAAAGG - Intergenic
941139673 2:161763768-161763790 TAGTTTATAAAGAGAGAGCATGG + Intronic
941178341 2:162228023-162228045 TTGATTATACAGAGGGAGGTGGG - Intronic
942027594 2:171925843-171925865 TTTTATATAAAAAGGAAAGACGG + Intronic
942538062 2:176986340-176986362 ATGTTTTTAAAAAGGGAGGCGGG + Intergenic
943175726 2:184471487-184471509 TTTTTTAAAAAAAGGTAAGAAGG + Intergenic
943960420 2:194256000-194256022 TTATTTAAAAAAAAGGTGGAGGG + Intergenic
944560465 2:200931447-200931469 TGCTTTAAAAAAAAGGAGGAGGG + Exonic
944617217 2:201473840-201473862 TTTTTTATATAAAGGGGGAAAGG + Intronic
945799199 2:214404677-214404699 TTGTTTAAAAAAAGAAAGAATGG + Intronic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
948623456 2:239251224-239251246 TTATTTCTAAAAAGTGAAGATGG + Intronic
1169014560 20:2280992-2281014 TTACATATAAAAAGGGAGGCAGG - Intergenic
1169189516 20:3649032-3649054 TTATTTTTAAAAAGGAAGGAAGG + Exonic
1169510271 20:6256309-6256331 GTGTTTAGGAAAATGGAGGAAGG + Intergenic
1169951806 20:11052732-11052754 TTGTCCATAGAAAGGGATGAAGG + Intergenic
1170332222 20:15225797-15225819 TTGTATATAATAAGGCAAGATGG - Intronic
1171222205 20:23408909-23408931 ATTTTTTTAAAAAGGTAGGAGGG + Intronic
1171287685 20:23955405-23955427 TTGTGTATAAATAGGGCAGAAGG - Intergenic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1173985237 20:47256321-47256343 TTTTTTAAAAAAAGAGAGGCCGG + Intronic
1175189484 20:57201665-57201687 TTGTTCATAAAACTGGTGGAAGG + Intronic
1175376546 20:58529927-58529949 TTGTGAAAAAAAAGGAAGGAAGG - Intergenic
1175610697 20:60348907-60348929 TTGTTTTTAAAAACAGAAGAAGG + Intergenic
1176457068 21:6923146-6923168 ATGTTTATTAAAAGGGAGCATGG - Intergenic
1176835241 21:13788228-13788250 ATGTTTATTAAAAGGGAGCATGG - Intergenic
1177626453 21:23667307-23667329 TTATTTATACAAAGGGTGCAAGG + Intergenic
1178532436 21:33386652-33386674 TTGTTTTTAAGATGGGAGGGGGG + Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1178836986 21:36106777-36106799 TTGTTTAAAGAAAGGGATGTTGG + Intergenic
1179417692 21:41211413-41211435 TTGTTTTTATAAAGGGAGGGGGG - Intronic
1179503911 21:41827291-41827313 TTTTTTTAAAAAAGGGACGAAGG + Intronic
1181382000 22:22512865-22512887 CAGTTTTTAAAAAGGTAGGAGGG + Intergenic
1182085414 22:27557832-27557854 GTATTAATGAAAAGGGAGGAGGG - Intergenic
1182228431 22:28818152-28818174 TTGTTTTAAAAATGGGAGGCAGG + Intergenic
1182406494 22:30137481-30137503 CTGTTTCAAAAAAGGAAGGAAGG + Intronic
1182471638 22:30552327-30552349 TTGATTAATAAAAGTGAGGAAGG + Intergenic
1182503501 22:30765507-30765529 TTTATTATAAAAATGGGGGAAGG - Intronic
1182958702 22:34452038-34452060 TTGTATATAATAAGGAAGAAGGG + Intergenic
1183887738 22:40898962-40898984 TAGTTTATTAAAATGGATGAAGG - Intronic
1183991157 22:41597837-41597859 TGGTTTATAAAGATGGGGGAAGG - Intergenic
1184995264 22:48200918-48200940 ATGTTTATACAAAGGAAAGAAGG + Intergenic
1185209260 22:49559453-49559475 TTGTTTAAAAAAAGTGTGGCAGG + Intronic
949108921 3:235144-235166 ATGTTTAGAAAGAGGGGGGAGGG - Intronic
949141783 3:642508-642530 CTGTTTATACAAAGACAGGATGG + Intergenic
949192390 3:1266196-1266218 TGGTTTAGATAAAGGGAGGGAGG - Intronic
949529668 3:4942372-4942394 TTCTTAATAAAATAGGAGGATGG + Intergenic
949576968 3:5347819-5347841 TTGTTTTTAAAAAAAAAGGATGG - Intergenic
949664479 3:6321347-6321369 GGGTTTATAAAAAGGGAAGGAGG + Intergenic
949844478 3:8356037-8356059 TTATTTATAAAAACAGAGGAGGG - Intergenic
950720539 3:14879443-14879465 ATGTCTATAAACAGGAAGGATGG - Intronic
950736963 3:15017121-15017143 TTGTTTTTTAAAAAGGAGGTTGG + Intronic
950915658 3:16642580-16642602 TTATTTATAAAAAGCAGGGAAGG + Intronic
951531629 3:23703702-23703724 TTTGTTATGAGAAGGGAGGAAGG - Intergenic
951550153 3:23869319-23869341 AAGTTTATAAAAAGGTTGGAGGG - Intronic
951621850 3:24610510-24610532 TTACTTCTAAAAGGGGAGGAAGG - Intergenic
951742663 3:25941535-25941557 TCATTTAGAAAAAGGAAGGATGG - Intergenic
951979118 3:28546331-28546353 ATTTTTATAAAAAAGGTGGAGGG + Intergenic
952404762 3:32995662-32995684 TTGTTTTTAAGGAGGGAGAAAGG - Intergenic
952496995 3:33924697-33924719 TGGTTTCTAGAAAAGGAGGAAGG - Intergenic
953576388 3:44116195-44116217 GATCTTATAAAAAGGGAGGAGGG - Intergenic
954987661 3:54809791-54809813 TTGTTGAAAAGAAGGAAGGAGGG - Intronic
955592028 3:60547411-60547433 TTGTTTATAAAGAGAGAGTAGGG - Intronic
955873832 3:63468895-63468917 TTTTTTTAAAAAAAGGAGGAAGG + Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956199300 3:66689775-66689797 TTGTTTATAAAAATGTGGGTTGG - Intergenic
956881560 3:73516108-73516130 TTGTTTCTAATTTGGGAGGAAGG + Intronic
957932226 3:86895466-86895488 TTGTATATAAAAAGTGATCAAGG - Intergenic
958041863 3:88235518-88235540 TTGGTTTTAAGAAGAGAGGAGGG + Intergenic
958072653 3:88634367-88634389 GTGTACATAAAAAGGGAGTATGG - Intergenic
958263054 3:91404572-91404594 TTGTGTATAAAGAGGGATCATGG - Intergenic
959010865 3:101074450-101074472 TTTCTTATAAAAGGGGTGGATGG - Intergenic
959488565 3:106958145-106958167 TTGTTTACAACAAGGAAGGAAGG + Intergenic
959988927 3:112608945-112608967 TTGTTTTTTAAAAGGGAGGAGGG - Intronic
960115425 3:113887402-113887424 TTCTTTATAAAAAATGAGGCCGG + Intronic
960208604 3:114932864-114932886 TTGTTCAAAAAAAGGGTGCAAGG - Intronic
960851324 3:122058021-122058043 TTGTCTGTAAAATGGGAGTATGG + Intronic
962049599 3:131798895-131798917 TTTTTTTTAAAAAGTGAAGATGG - Intronic
962068684 3:132010773-132010795 TTGGCTATAAAGTGGGAGGAGGG - Intronic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
964217135 3:154298315-154298337 ATGTTTATAATAATGGGGGAAGG + Intronic
964974795 3:162605810-162605832 TTGTATTTAAAAAGGAAGCAGGG + Intergenic
965040177 3:163498099-163498121 GTGTCTATAAAAAGGGAAAAAGG + Intergenic
965126005 3:164630058-164630080 AAGTTTAAAAAAAGGGAGGGAGG + Intergenic
965148238 3:164934889-164934911 TTGTTTATTAAAAGGAAAGCAGG - Intergenic
967016613 3:185488103-185488125 CTGTTTATAAAAGGTGAGGGAGG - Exonic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
969144880 4:5113923-5113945 TGGTTTTTAAAAAGGGGGGCGGG - Intronic
969341088 4:6541846-6541868 AACTTTAAAAAAAGGGAGGAGGG + Intronic
970072233 4:12173812-12173834 CTGATTATAAAATGGAAGGAAGG - Intergenic
970124598 4:12794869-12794891 TTGTTGATAAAATGAGATGATGG - Intergenic
970289013 4:14551513-14551535 TTGTTTGTAGCAAGGGAAGAAGG - Intergenic
970653490 4:18203682-18203704 TTTTTTCTTAAAAGGGATGAAGG - Intergenic
970778936 4:19712160-19712182 ATTTTGATACAAAGGGAGGAAGG - Intergenic
970833376 4:20369735-20369757 CTGTATATAAAAAGGTAGCAGGG + Intronic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
972181326 4:36470353-36470375 TTGTTTGTATAAAGAGAGGAAGG - Intergenic
973084646 4:46042107-46042129 TTGATTATTAAATGGGATGATGG + Intronic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
973988320 4:56377565-56377587 TTATTAATAAAAAGGGAGAAAGG - Intronic
974216023 4:58848723-58848745 TTAGTTATAAAAAGTGAGTATGG + Intergenic
974326617 4:60422735-60422757 TTGCTGAAAAAAAGGAAGGAAGG + Intergenic
974890412 4:67875403-67875425 TTCTTGTTAAGAAGGGAGGATGG - Intronic
975780191 4:77831173-77831195 TTGTTTATGAAAATGGAGCCAGG + Intergenic
976351566 4:84065952-84065974 TTGTTTTTCAAATGAGAGGATGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
976588952 4:86830028-86830050 TTGTTTACAAAACAAGAGGAGGG - Intronic
976709029 4:88049530-88049552 TTGTTTATAAAGAACAAGGAAGG + Intronic
977018356 4:91724566-91724588 TGGTTTATAATAAGGGATGGGGG - Intergenic
977603756 4:98961421-98961443 TGCTTTATAAAAAGGCTGGAGGG + Intergenic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
978770401 4:112450440-112450462 TTGGTTATGAGAGGGGAGGAGGG + Intergenic
978872022 4:113590434-113590456 TTTCTTGTTAAAAGGGAGGATGG - Intronic
980379801 4:131997984-131998006 TTTTTTTAAAAAAAGGAGGAAGG + Intergenic
980693551 4:136327958-136327980 TTGTCAAAAAGAAGGGAGGATGG + Intergenic
980775967 4:137436976-137436998 TCGTTTGTATAATGGGAGGAGGG + Intergenic
981574767 4:146193055-146193077 TTTTTTAAAAAAAGGATGGAGGG - Intronic
981652003 4:147070662-147070684 TTCTTTATACAAACAGAGGATGG + Intergenic
981793424 4:148566533-148566555 TTGTTTATCAAAAGTGAATACGG + Intergenic
982607249 4:157530202-157530224 TTGTTTAGAAAAAGTTAGGTGGG - Intergenic
982750837 4:159159235-159159257 TTGTTTGTAAAATGGAAGGAGGG - Intronic
983429136 4:167625570-167625592 TTGTTTATATAGAATGAGGAGGG - Intergenic
984780482 4:183521527-183521549 ATGGTTATGAAAAGGGAGAAGGG - Intergenic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
986404323 5:7410737-7410759 TTTTTTCCACAAAGGGAGGAGGG + Intronic
986767012 5:10937454-10937476 TGGCTTAAAAAAGGGGAGGAGGG + Intergenic
986867441 5:12006522-12006544 TATTTTTTAAAAAGGGAGGGAGG - Intergenic
987309645 5:16669960-16669982 TTGTTTAGAAAAAAGGAGGCAGG + Intronic
987877396 5:23696119-23696141 TTTTCTATAATAAGGGAGCAGGG + Intergenic
988136601 5:27179791-27179813 TTGTTTATCAAAAGAAAGAAGGG - Intergenic
989823067 5:45818891-45818913 TGGTTTAAAAAAAGTGGGGAGGG + Intergenic
990193897 5:53291052-53291074 TTGTTTGTAAAAAGAAAAGAAGG + Intergenic
990761017 5:59129408-59129430 GTGTTTTTAAAAAGTGATGATGG + Intronic
991905753 5:71508958-71508980 TTGGTTTTAAAAGGTGAGGAGGG + Intronic
991929176 5:71735184-71735206 TTGACTTTAAAAATGGAGGAAGG - Intergenic
992847289 5:80763749-80763771 AAGTTTACAAAAAGGCAGGAAGG - Intronic
993574781 5:89587396-89587418 TTGTAAATCAAAAGGGAAGAAGG - Intergenic
993617671 5:90133533-90133555 TGATTTAGAAAAAGGGAGTAAGG - Intergenic
993775922 5:91995165-91995187 TTGTCTATAGAAGGGGAGAATGG + Intergenic
994227308 5:97267815-97267837 TTTTTCTTACAAAGGGAGGAAGG + Intergenic
994265530 5:97711492-97711514 GTGATTATTAGAAGGGAGGAGGG - Intergenic
994622042 5:102175481-102175503 TTGTTTAATAGAAGGGAGGCTGG - Intergenic
995296172 5:110525183-110525205 TTGATTAAAAATAGTGAGGATGG - Intronic
996118492 5:119645372-119645394 TTTTCTATAAAAGGGGAGGGGGG - Intergenic
996311826 5:122114961-122114983 TGCTTTATAAATTGGGAGGAAGG - Intergenic
996608580 5:125352488-125352510 TTATTTTTAAAAAGGAAGAAAGG - Intergenic
997154191 5:131534923-131534945 TGATTTATAAAAAGGGGGAAAGG - Intronic
998356062 5:141537685-141537707 TTATATTTAAAAAGTGAGGAGGG + Intronic
999042589 5:148431265-148431287 TTGTCTCTAAACAGGGAGGGAGG + Intronic
999173069 5:149611793-149611815 TTTGTTATAACAAGGGAGCATGG - Intronic
999682596 5:154074074-154074096 TTTTTTAAAAAAAGGGAGCCAGG + Intronic
999900526 5:156081692-156081714 ATATTTATAAAAAGGGAACATGG - Intronic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1001112701 5:168910939-168910961 TTCTTTACAAAAAGGCATGAGGG - Intronic
1003537468 6:6988118-6988140 TTTTTTTTAAAAAGGTAGGCAGG + Intergenic
1004668360 6:17770880-17770902 TTGCTTAGAAAAAGGGAGAAAGG - Intronic
1005032276 6:21521926-21521948 GTGTTTACTAAAAGGGAGGGAGG - Intergenic
1005270929 6:24162670-24162692 ATGTATCTAAAAAGAGAGGAAGG + Intergenic
1005949580 6:30621641-30621663 TTGGTTATAAAAAGAGATTATGG + Intronic
1006720953 6:36150623-36150645 TGGTTTAAAAAAAGAAAGGAGGG - Intergenic
1006808070 6:36801548-36801570 TTGTTTCAAAAAAGGGGTGAGGG + Intronic
1007952038 6:45881158-45881180 TTGTTGAAAAAAAGGGGGCATGG - Intergenic
1007979918 6:46142009-46142031 CTGTTTACAAAAAGGATGGAGGG + Intronic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008478139 6:51955201-51955223 TTTTTTTAAAAAAGGGAGGGAGG + Intronic
1008557215 6:52685073-52685095 TTGTGTATAAAAAAACAGGAAGG + Intronic
1008850728 6:56017929-56017951 TTATTTACAAATATGGAGGAAGG + Intergenic
1008954495 6:57200029-57200051 TTTTTTTAAAAAAGGGTGGAGGG - Intronic
1008992353 6:57618316-57618338 TTGTGTATAAAGAGGGATCATGG + Intronic
1009180976 6:60517428-60517450 TTGTGTATAAAGAGGGATCATGG + Intergenic
1009553954 6:65137739-65137761 TTGTGTATTGAAAGAGAGGAAGG + Intronic
1010225218 6:73482641-73482663 TTTTCTATAAAAAGTGAGAAAGG - Intronic
1010410232 6:75552865-75552887 TGGTTTATTAAAAGGTAGAAAGG + Intergenic
1010517672 6:76792483-76792505 TGGTTTCTGAAATGGGAGGATGG + Intergenic
1011747088 6:90416874-90416896 TAGTTTATAAAAAGGGAGTTAGG - Intergenic
1011757558 6:90517985-90518007 GTTTCTTTAAAAAGGGAGGAAGG + Intronic
1011972796 6:93248656-93248678 TTGTTTTTAAAAAGAGAGAGAGG - Intronic
1013016246 6:106163239-106163261 TTGGTTATAAAAAGGGAGTTTGG - Intergenic
1014067381 6:117143532-117143554 ACGTTTATAAGAAGTGAGGAGGG + Intergenic
1014178448 6:118355829-118355851 TTATTTATATATAGGGGGGAGGG - Intergenic
1014539793 6:122661523-122661545 TTGTCAATAAAAAGGAATGAAGG - Intronic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1014916969 6:127162442-127162464 CTGTTTTTACAAAGGAAGGAAGG - Intronic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015203834 6:130612968-130612990 TGGTTTTTAAAAAGGTGGGAGGG + Intergenic
1016087514 6:139932585-139932607 TTGTTAAAAAAAAATGAGGAAGG - Intergenic
1016506891 6:144792242-144792264 TTCCTTATAAAAAGAGAGAATGG + Intronic
1016646977 6:146421865-146421887 TTGTTTATAGGAATGGAGAATGG - Intronic
1016763927 6:147771420-147771442 CTGGTTATAAAAAGGAATGAAGG + Intergenic
1016993132 6:149943051-149943073 CTCTTTCTAGAAAGGGAGGAAGG + Intronic
1017040485 6:150304571-150304593 TTGTTTAAAAAAATTGATGATGG - Intergenic
1017402130 6:154076702-154076724 TAGTTTATAAAAAAGGAGTTAGG - Intronic
1017410627 6:154163942-154163964 TTGTTTATAGAAAGTTAGGCAGG + Intronic
1017615482 6:156242658-156242680 GTGTTTAAAAAAAGGGTGGGGGG + Intergenic
1018683573 6:166284466-166284488 TTGCTGATACAAAGGGAGGCAGG + Intergenic
1019067937 6:169318191-169318213 GAGTTTATAAAAATGGGGGAAGG - Intergenic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019808433 7:3146283-3146305 TTGTTTATCAAAAGGTCTGAGGG - Intronic
1019809184 7:3152126-3152148 ATGATAATAAAAAGGAAGGAGGG - Intronic
1021002729 7:15353080-15353102 TTATTTTTAAAAAGGTGGGAAGG + Intronic
1021217007 7:17928539-17928561 AGGTTTTTTAAAAGGGAGGATGG + Intronic
1022504340 7:30901081-30901103 TTGTTTGTATAAAGGAAGGGAGG - Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1025280630 7:57624439-57624461 TTGTCTATTACAAGAGAGGATGG + Intergenic
1025304100 7:57841068-57841090 TTGTCTATTACAAGAGAGGATGG - Intergenic
1026118052 7:67512911-67512933 TTGTTTATTTAAGGGGAGAAAGG - Intergenic
1026400691 7:70009875-70009897 TTCTTTAAAAAAAGAAAGGATGG - Intronic
1026587890 7:71671643-71671665 TCATCTATAAAATGGGAGGAAGG + Intronic
1027153326 7:75748695-75748717 TTGGTTATAAGATGGAAGGAGGG + Intergenic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027308440 7:76927391-76927413 TTGTTTATAAAATGGGTGGGTGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1028268381 7:88757460-88757482 ATTTTTATAAAATGGAAGGATGG - Intergenic
1029204088 7:98858535-98858557 TTGTCTCTAAAAATGGAGGGCGG + Intronic
1029643044 7:101833052-101833074 TTCCTGAGAAAAAGGGAGGAGGG + Intronic
1030092428 7:105869255-105869277 TTGTTAGCAAAAGGGGAGGAAGG + Intronic
1030270586 7:107664627-107664649 ATTTTTTTAAAAAGGGATGAGGG - Intronic
1031080923 7:117256226-117256248 TTGTTTAGAAAGAGTGAGCAAGG + Intergenic
1031163147 7:118193254-118193276 TCATTTATAAAAATGGAGGTGGG + Intergenic
1031759874 7:125699314-125699336 TTTATTTTAAAAAGGAAGGAAGG + Intergenic
1032548583 7:132763469-132763491 TTTTGTATATAAAGGGAGGGAGG - Intergenic
1032671530 7:134087197-134087219 TTGTCTTTTAAAAGGGAGGGGGG - Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033516457 7:142111575-142111597 TTGTTAATAAAAGGGGAAGGTGG - Intergenic
1033851636 7:145503497-145503519 TTGATTAAAAAAAGGGATAAAGG + Intergenic
1034611431 7:152373877-152373899 TTTTTTTTAAAAAGGGACAAAGG + Intronic
1035634071 8:1130487-1130509 TTGTGTCTAAAAAGGGATGGAGG + Intergenic
1036462736 8:8967953-8967975 TTGCTTATAAAAAGTGAGCATGG - Intergenic
1038023575 8:23570212-23570234 TTGTAAATAAAAAGGGGGAAAGG - Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1039860832 8:41455827-41455849 TTTTTTAGAAAAAGAGAGAATGG - Intergenic
1040817586 8:51525509-51525531 TTGTTTACCAAAACGGAGGAGGG - Intronic
1042430216 8:68697991-68698013 TTGTTTCTAACTAGGAAGGATGG - Intronic
1042662584 8:71171772-71171794 CTGTCTATAAAATGGGAGAAGGG + Intergenic
1042746772 8:72116937-72116959 TGGTTTAAATAAAGGGATGATGG - Intronic
1042882270 8:73506809-73506831 TTGTTTATAAAACAGCAGCAGGG - Intronic
1043087704 8:75855923-75855945 TTGTTTACATAAAGAGAGGATGG + Intergenic
1044429116 8:92087965-92087987 TTGTTTAAATAAAGGTAGGTAGG - Intronic
1044974224 8:97647522-97647544 CTGTCTAAAAAAAGGGGGGAAGG + Intronic
1045156815 8:99485274-99485296 TTTGTTATAACAAGAGAGGAAGG + Intronic
1045221071 8:100201118-100201140 TTGTCTAAAAAAAGGAAGGAAGG - Intronic
1045901804 8:107290763-107290785 TTATTTTAAAAAAGGGAGGAGGG + Intronic
1045926353 8:107581815-107581837 TGGCTCATAAAAAGGAAGGAGGG - Intergenic
1046015596 8:108601113-108601135 TTTTTTATAAAAAAAGAAGAAGG + Intergenic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1047298535 8:123592344-123592366 TTGTTTGTCAAACTGGAGGAGGG + Intergenic
1047433667 8:124816244-124816266 ATGTTTCTCAAAAGGGAGCATGG + Intergenic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1047506992 8:125487913-125487935 TAGGTGAGAAAAAGGGAGGAAGG + Intergenic
1047646550 8:126876297-126876319 TGTTTTATAAAAAGAGAGGGAGG - Intergenic
1047824375 8:128557578-128557600 CTGATCATAAAACGGGAGGAGGG + Intergenic
1048148282 8:131867376-131867398 TTGTTTTTAACTAGGAAGGAAGG + Intergenic
1048350262 8:133610155-133610177 TCATTTATAAAAACGGATGAAGG - Intergenic
1050565730 9:6880786-6880808 ATCTTTAAAAAAAAGGAGGAAGG - Intronic
1050996926 9:12232243-12232265 TTGTATTTAAAAAGGAAGCATGG - Intergenic
1051261107 9:15265632-15265654 TACTGTATAAAAAGGGAGGAGGG + Intronic
1053408352 9:37897895-37897917 TAGATGATAAATAGGGAGGAGGG - Intronic
1053451816 9:38199922-38199944 TTCTCTATAAAAAGGAAAGAAGG + Intergenic
1054716426 9:68561623-68561645 TTGTTAAGAGGAAGGGAGGAAGG - Intergenic
1056170940 9:83983593-83983615 TTTTTAATAAAAAGCGAGGCAGG - Intronic
1056446507 9:86671693-86671715 TGTTTTATACAAAGGCAGGAAGG + Intergenic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1056571411 9:87819592-87819614 CTGTTTGTAAGAAGGAAGGAAGG - Intergenic
1056712979 9:89006291-89006313 GGATTTATCAAAAGGGAGGAGGG + Intergenic
1056912109 9:90711065-90711087 GTGCCTATAAAAAGGAAGGAGGG + Intergenic
1057214885 9:93222341-93222363 TTTTATTTAAAAAGGGAGGGAGG - Intronic
1057568708 9:96187052-96187074 TTTTTTAAAAAAAGAGAGGATGG - Intergenic
1057898425 9:98928183-98928205 TTTTTTTTAAAAAGGGAGCTAGG - Intergenic
1058353001 9:104048795-104048817 TTCTTTAAATGAAGGGAGGAAGG + Intergenic
1058498538 9:105587293-105587315 TTGGTTAGAAGGAGGGAGGAGGG + Intronic
1058790194 9:108436630-108436652 TTTTTCATAAAAAAGGAGAAAGG + Intergenic
1059116620 9:111605491-111605513 TTGTTTATTAAAGGGGAAAAAGG + Intergenic
1059280388 9:113128177-113128199 TTGTTTATAACAGGGAAAGATGG + Intergenic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1060357938 9:122928134-122928156 TTGTTTTTAAAATGCCAGGAGGG - Intronic
1061597183 9:131638906-131638928 TTGCTTATTAAAAGGCAGTATGG - Intronic
1203655304 Un_KI270752v1:18249-18271 TTCTTTTTAGAAAGGGAGTATGG + Intergenic
1186529366 X:10279685-10279707 ATGTTTATGAAAAGGAAGGAGGG - Intergenic
1186613929 X:11166679-11166701 TGCTTTATAAAAAGGAAGGAAGG + Intronic
1187160767 X:16763275-16763297 CTGTTTCAAAAAAGGGAGGGGGG + Exonic
1187623411 X:21084470-21084492 GTGTTTATAAGAAGGGGAGAAGG - Intergenic
1187830290 X:23374250-23374272 TTCTTGTTGAAAAGGGAGGAGGG - Intronic
1188334239 X:28909495-28909517 ATGTTTATAAAAAGGAAATAAGG - Intronic
1188669115 X:32861514-32861536 CTGTTTATAAAAATGAGGGAAGG + Intronic
1189064000 X:37786647-37786669 TTGTTGAGAAAAATGGAGAATGG + Intronic
1189845763 X:45135289-45135311 GTATTCATAGAAAGGGAGGAGGG - Intergenic
1190409863 X:50125797-50125819 TTGTTTTTCAAGGGGGAGGATGG + Intergenic
1190920324 X:54845368-54845390 TCTTTTATAAAAAGAGAGGGGGG - Intergenic
1191718186 X:64206896-64206918 GTGTGTCTAAAAAGGGAGGTGGG + Intergenic
1191786327 X:64920599-64920621 TTTTCTATAAAATGGGAGTAAGG - Intronic
1192357166 X:70415148-70415170 TTGTTTATAAGAATGGAAAATGG + Intronic
1193021014 X:76793390-76793412 TTTTTTTTTTAAAGGGAGGATGG - Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193843248 X:86435816-86435838 TTATTTGTAAAAAGGGGAGACGG - Intronic
1194111367 X:89838549-89838571 ATGTTTATGTAATGGGAGGATGG - Intergenic
1194369247 X:93050442-93050464 TTATTTATGAAAAGGCATGAAGG - Intergenic
1194425115 X:93727488-93727510 TTATTTCCAAAAAGGGAAGATGG + Intergenic
1194618682 X:96140045-96140067 TTGCTTTTAAAAAAGGAGGGGGG - Intergenic
1194967347 X:100303728-100303750 TTGCTGAAAAAAAGGGAAGAAGG - Intronic
1195017611 X:100794686-100794708 TCGTGTATGAAAAGGGAGAAAGG - Intergenic
1195433847 X:104819486-104819508 TTTTTTATATCATGGGAGGATGG + Intronic
1195485155 X:105396315-105396337 TTTATTAAAAAAAGGAAGGAGGG - Intronic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196265893 X:113646328-113646350 TTATTTATAAAAACAGAGGGAGG - Intergenic
1196320947 X:114339735-114339757 TTGATTCTAAAAAGTGAGGAGGG - Intergenic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197625897 X:128802132-128802154 TTCTTTCTAAAGAGGTAGGAAGG + Intergenic
1197693765 X:129529336-129529358 TTGTTTAAAAAGAGGCCGGAGGG + Intergenic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1197895471 X:131309009-131309031 TAGTTTGTAAAGAGGGAGTAAGG + Intronic
1199315135 X:146367968-146367990 TGGTTTTTCAAAAGGGAGGAAGG + Intergenic
1199609605 X:149601256-149601278 TAATTAATAAAAAGGGAGAACGG - Intronic
1199629511 X:149768098-149768120 TAATTAATAAAAAGGGAGAACGG + Intergenic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic
1200464033 Y:3493345-3493367 ATGTTTATGTAATGGGAGGATGG - Intergenic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic
1201926303 Y:19291719-19291741 TCTTGTATAAAAAGGGAGAAAGG + Intergenic