ID: 962301883

View in Genome Browser
Species Human (GRCh38)
Location 3:134250631-134250653
Sequence TGCGTGGGGCGGCGCGGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962301883_962301893 4 Left 962301883 3:134250631-134250653 CCCCAGCCGCGCCGCCCCACGCA 0: 1
1: 0
2: 1
3: 20
4: 281
Right 962301893 3:134250658-134250680 CGCCGCCGCCGCCGCCGAAGAGG 0: 1
1: 6
2: 117
3: 278
4: 588
962301883_962301897 12 Left 962301883 3:134250631-134250653 CCCCAGCCGCGCCGCCCCACGCA 0: 1
1: 0
2: 1
3: 20
4: 281
Right 962301897 3:134250666-134250688 CCGCCGCCGAAGAGGAGCGTCGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962301883 Original CRISPR TGCGTGGGGCGGCGCGGCTG GGG (reversed) Exonic
900217778 1:1490819-1490841 TGCGTGGAGTGGCCCGACTGAGG - Intronic
900233332 1:1574179-1574201 GGCGAGGGGCTGCGCGGCGGCGG - Intronic
900314649 1:2050717-2050739 GGCGGGGAGCGGCGCGGGTGAGG + Intronic
900349498 1:2227987-2228009 GGGGCGGGGCGGCGCGGCGGCGG + Intergenic
900422589 1:2562040-2562062 TGCGTGGGCAGGGGTGGCTGAGG - Intronic
900599861 1:3498347-3498369 TGAGTGGGGCGGGGCAGCAGGGG - Intronic
900786784 1:4654715-4654737 GGCGTGGGGACGCGCGGCGGCGG - Intronic
901250054 1:7771283-7771305 TGGGTGGGACGGCGCGGCGCGGG - Exonic
901511678 1:9720911-9720933 TGGGTGGGGAGGCGCACCTGGGG + Intronic
902336775 1:15758715-15758737 GGCGCGGGGCGGCGGGGCGGAGG + Intronic
902482647 1:16719708-16719730 TGCGTGCGGCCGGGCAGCTGAGG + Intergenic
902771278 1:18646875-18646897 GGCGCGGGGCGGCGCGGCGCGGG + Intronic
903032351 1:20472914-20472936 TCCTTGGGGAGGCGCTGCTGTGG - Intergenic
903595383 1:24490132-24490154 TGGGTGGGTCGGCACTGCTGGGG - Intergenic
903951785 1:26999785-26999807 TGGGTGGGGCTGGGTGGCTGTGG + Intronic
904211853 1:28891074-28891096 TGCGTGGGGCTGCCCCTCTGGGG - Intronic
904236714 1:29121688-29121710 TGCGGGTGCGGGCGCGGCTGCGG - Exonic
904284145 1:29443307-29443329 TGCGCAGGGCGGGGTGGCTGGGG + Intergenic
905626834 1:39495010-39495032 TGGGTGGGGCGGGGTGGGTGGGG + Intronic
905803725 1:40861750-40861772 CGCGGGCGGCGGCGGGGCTGCGG + Exonic
906182045 1:43830113-43830135 TGCTTGGGCCGGGGAGGCTGAGG - Intronic
906702677 1:47871445-47871467 TACGTGTGGCGGGGTGGCTGTGG - Intronic
907080439 1:51617028-51617050 TGCGGGGGGCGGGGCCGCAGGGG - Intronic
907455299 1:54571848-54571870 TGAGTGGGGAGGTGCTGCTGGGG + Intronic
907767355 1:57424142-57424164 CGCGGGGGGCGGCGGGGCGGGGG - Intronic
910771223 1:90834672-90834694 TGCGGTGGGCGGCGTGTCTGTGG + Intergenic
912568865 1:110607402-110607424 TGCGTGGCGCGGTGCGGCTGCGG - Exonic
914428560 1:147600065-147600087 TTCGTGGCGCGGTGCGGCGGGGG + Intronic
915367428 1:155323847-155323869 TGGGCGGGGCGGCCCGCCTGAGG - Intronic
915513656 1:156400676-156400698 TGCGGGGGGCGCGGGGGCTGGGG + Intergenic
916694559 1:167221774-167221796 GGCCTGGGGCGGCGGGGGTGGGG + Intronic
920135988 1:203769771-203769793 TGCGGGGGGGGGGGCGGCGGGGG + Intronic
921072702 1:211675493-211675515 TGCGTGAGGCAGCGCGACTCTGG - Exonic
922416490 1:225427639-225427661 TTGGCGGCGCGGCGCGGCTGTGG - Intronic
922757158 1:228102848-228102870 TGCCTGGGACGGCGCTGCCGGGG - Intronic
922873753 1:228923736-228923758 TGCCTGGGGCTGCTGGGCTGAGG + Intergenic
923744288 1:236686376-236686398 TGCTCGGGGCGGGGCGGCTGGGG + Intergenic
924436780 1:244049175-244049197 GGCGGGGGGCGGCGCAGCTGCGG + Intronic
1063455226 10:6178288-6178310 TGTGTGGGGCGCCCCTGCTGTGG + Intronic
1063995087 10:11611515-11611537 GGCGCGGCGCGGCGCGGCGGCGG + Intronic
1064015736 10:11770794-11770816 TGCCTGGGGCTGGGCGGCTTGGG - Intergenic
1064354286 10:14603992-14604014 TGCGGGGGGCGCCGCGGAGGCGG - Intronic
1065188924 10:23193227-23193249 TGCGGGGGGCCGGGCGGCGGCGG + Exonic
1066406994 10:35127412-35127434 GGCGTGGGGCGGCGAGCCGGCGG - Intronic
1066502477 10:36007568-36007590 TGGGTGGGGAGGAGTGGCTGAGG + Intergenic
1067118640 10:43455621-43455643 TCCGTGGCGCGGCGCGCTTGTGG + Intronic
1073087386 10:100901775-100901797 TGCCTGGGACGGAGGGGCTGGGG + Intergenic
1073345089 10:102776904-102776926 TGCCTGGGGCTGTGCAGCTGAGG + Intronic
1075031971 10:119029837-119029859 TGGGCGGGGGGGCGCGGCCGCGG - Exonic
1076372523 10:129964498-129964520 TGCGTGGCGGGGGGCGGCGGCGG - Intergenic
1076408540 10:130230177-130230199 TGTGTGGGGCGGCTGTGCTGAGG + Intergenic
1076696324 10:132249108-132249130 TGCGTGCCGGGGCGGGGCTGTGG + Intronic
1076746480 10:132517274-132517296 GGGGTGGGGCGGGGTGGCTGAGG + Intergenic
1077080347 11:722167-722189 TGCCTGGGGCCGGGCGGCAGGGG + Intronic
1077317267 11:1925154-1925176 TGGGTGGGGCGGGAAGGCTGGGG - Intronic
1077334252 11:1996465-1996487 TGTGTGGGGAGGGGCGGGTGGGG + Intergenic
1077435302 11:2536080-2536102 TGCATGGGGCTGGGTGGCTGGGG - Intronic
1081287118 11:41284585-41284607 TGCCTGGAGCGGAGAGGCTGGGG - Intronic
1083264924 11:61542269-61542291 TGCCTGGGTTGGAGCGGCTGCGG + Intronic
1084666695 11:70580241-70580263 GGCGTGGGGTGGCTGGGCTGAGG + Intronic
1085664557 11:78402543-78402565 GGGGTGGGGGGGTGCGGCTGAGG - Intronic
1089525796 11:119095577-119095599 TGGGTGTCGCGGCTCGGCTGAGG + Intergenic
1089588537 11:119525119-119525141 TGAGTGGGTCAGCGTGGCTGTGG - Intergenic
1202817235 11_KI270721v1_random:51647-51669 TGTGTGGGGAGGGGCGGGTGGGG + Intergenic
1094041110 12:26122617-26122639 CCCGGGGGGCGGCGCGGCGGCGG - Exonic
1097190419 12:57216870-57216892 GGCGGGCGGCGGGGCGGCTGCGG - Exonic
1100315496 12:93441558-93441580 AGGGTGGGGCGGCAAGGCTGGGG - Intronic
1100838453 12:98589180-98589202 GGCGTGGTGGCGCGCGGCTGTGG - Intergenic
1101106840 12:101448848-101448870 TGCATGTGGCGGGGCGGGTGGGG + Intergenic
1101441764 12:104709241-104709263 TGGGTGTGGGGGCGAGGCTGTGG - Intronic
1102008952 12:109606413-109606435 TGCGGGTGGCGGGGCGGCAGGGG + Intergenic
1104714391 12:131006670-131006692 TGAGGGGGGCGGCGAGGCTGGGG + Intronic
1104843356 12:131834899-131834921 TGTGGGTGGAGGCGCGGCTGTGG - Intronic
1104849966 12:131868173-131868195 TGCATGGGGCTGAGTGGCTGCGG - Intergenic
1106840655 13:33682319-33682341 TGCCTGGGGGGAGGCGGCTGAGG - Intergenic
1107307397 13:39037790-39037812 GGAGTCGGGCGGAGCGGCTGGGG - Exonic
1110573066 13:77026938-77026960 AGCGCGGGGGGCCGCGGCTGCGG - Exonic
1113841580 13:113364208-113364230 GGCGGGGGGAGGGGCGGCTGGGG + Intergenic
1113928257 13:113952876-113952898 TGGGCGGGGCGGCGGGGCAGAGG + Intergenic
1114190423 14:20436149-20436171 TGCTTGGGGCTGCGTGGCAGAGG + Intergenic
1115398238 14:32933294-32933316 GGGCTGGGGCGGCGCGGCCGCGG + Intergenic
1115646008 14:35368884-35368906 AGCGAGGGGCAGGGCGGCTGGGG + Intergenic
1116828245 14:49693001-49693023 AGCCAGGGGCGGCGCGGCTGTGG - Intergenic
1117157035 14:52951263-52951285 GGCGTGGGGCGGGGCGGCGCGGG + Intronic
1118312813 14:64705618-64705640 TGCGTGCAGAGGCACGGCTGGGG - Intronic
1118849319 14:69572372-69572394 AGCGCGAGGCGGCGCGGCGGCGG - Exonic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1122066034 14:99175080-99175102 CGCGGGGGGCGGCGCGGCCAAGG - Exonic
1122371249 14:101230061-101230083 TGCGGGGGGGGGCGAGGCTGCGG - Intergenic
1122371258 14:101230079-101230101 TGCGGGGGGGGGCGAGGCTGCGG - Intergenic
1122950843 14:105043678-105043700 TCCGTGGGGCTGGGGGGCTGGGG + Intergenic
1122978631 14:105181329-105181351 CGCGCGGGGCGGGGCGGCCGAGG + Intergenic
1123117820 14:105902582-105902604 TGCCTGGGGCTGCGCAGCAGGGG + Intergenic
1123697463 15:22889592-22889614 TGCGTGGGGCCGTGCACCTGCGG - Intronic
1124626810 15:31312424-31312446 TGCGAGGGGCAGCCCTGCTGCGG + Intergenic
1127373780 15:58363447-58363469 TGCGGGAAGGGGCGCGGCTGTGG + Intronic
1127932815 15:63608330-63608352 TGAGAGGGGCGGAGCAGCTGAGG + Intergenic
1128454847 15:67826778-67826800 TTTGTGGGGCGGCGGGCCTGGGG - Intronic
1128651171 15:69414672-69414694 GGCGGGGGGCGACGCGGCAGGGG - Intronic
1130352996 15:83107774-83107796 TGAGTGAGCCGGCGCGGCGGGGG + Intronic
1131144323 15:90001651-90001673 AGCGCGGGGCTGCGGGGCTGGGG - Intronic
1131827374 15:96332044-96332066 TGCGGGCGGCGGCGGGGCGGCGG - Exonic
1132365362 15:101252436-101252458 TGCGTGCGGCCGCGGGACTGCGG - Intergenic
1132581153 16:685212-685234 TGCCAGGGGCGGCGCTGCAGGGG + Intronic
1132717750 16:1300725-1300747 GGCGTGGGGAGGCGGGGCAGCGG - Intergenic
1132831326 16:1929810-1929832 TGCGTGCGCAGGCGCGGCGGGGG - Intergenic
1133136634 16:3717143-3717165 GGGGTCGGGCGGAGCGGCTGCGG - Intronic
1134419388 16:14071536-14071558 CGCGCGGGGCGGGGCGGCCGGGG + Intronic
1134530088 16:14975804-14975826 TGCGTGGGGCGGAGTGGGAGCGG - Intronic
1134538674 16:15046954-15046976 TGGGTGGTGAGGCGGGGCTGTGG - Intronic
1136220118 16:28823296-28823318 TGCGTGGGGGGCGGCTGCTGGGG - Exonic
1136261766 16:29082215-29082237 TCCGCGGGGCGCGGCGGCTGCGG - Intergenic
1136544875 16:30949213-30949235 GGCTTGGGCCGGCCCGGCTGGGG + Exonic
1137786522 16:51141771-51141793 TGCTTGGGGCGGTACTGCTGTGG + Exonic
1137926673 16:52547207-52547229 TGGGAGGGGCGGAGCGGCGGCGG - Intronic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1139866260 16:70065150-70065172 TGCGTGGGGCGGAGTGGGAGGGG + Intergenic
1141703158 16:85651538-85651560 TCCTTGTGGCGGGGCGGCTGGGG + Intronic
1142102434 16:88282399-88282421 TGGGTGTGGCGGGGAGGCTGAGG + Intergenic
1142278124 16:89133567-89133589 TGCGTGGGGCCCGGCGTCTGTGG - Intronic
1142765632 17:2062738-2062760 TGCGTGGGCTGGCGGGGGTGGGG + Intronic
1143503838 17:7353196-7353218 TGCGTGGAGCAGGGCAGCTGTGG - Exonic
1143522335 17:7451899-7451921 TGTGGGTGGCGGCGGGGCTGTGG - Intronic
1144608330 17:16687347-16687369 TGCGGGGGGCGGCGGGGGAGGGG - Intergenic
1145214656 17:21042679-21042701 CGTGTGGAGCGGCACGGCTGAGG - Exonic
1145265110 17:21376305-21376327 TGCGCGGCGCGGCGCGGCGCGGG + Exonic
1147617016 17:41835822-41835844 TGCGGGGGCCGGCCGGGCTGGGG - Intronic
1148615784 17:48998495-48998517 TGAGCGGGGTGGCGCGGCGGCGG + Intronic
1148751328 17:49947374-49947396 AGCCTGGGGCGGCCCAGCTGAGG - Intergenic
1150134728 17:62689540-62689562 GGCGGGGGGCAGCGCTGCTGGGG - Exonic
1152624070 17:81380194-81380216 TGCCTGGGGCAGGGCGGGTGGGG - Intergenic
1152789761 17:82272927-82272949 GGCGTGGGGAGGCGGGCCTGGGG - Intronic
1152829907 17:82490838-82490860 CGCGTGGGGAGGCCAGGCTGAGG + Intergenic
1152924218 17:83080055-83080077 AGCGTGCGGGGGCGCGGCCGGGG + Intronic
1153238899 18:3013276-3013298 TGAATGGGACGCCGCGGCTGCGG + Intronic
1154214747 18:12407912-12407934 TGCTTCGGGCCGCGCGGCTCCGG - Exonic
1154411032 18:14142465-14142487 TGCATTGGGCGGCGAGGCTGGGG + Intergenic
1157279099 18:46334180-46334202 CGCGGGCGGCGGCGGGGCTGCGG - Intronic
1158435931 18:57435632-57435654 CGCGTGGCGGGGCTCGGCTGCGG - Intergenic
1158457622 18:57621946-57621968 CGCGTGGGGCGGGGCGTCTCTGG - Exonic
1160177873 18:76610995-76611017 TGCCTGGGGTGGCGGGGCCGGGG + Intergenic
1160765713 19:806632-806654 AGCGAGGGGCGGCGCTGCTCCGG - Intronic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1161592855 19:5136594-5136616 TGGCTGGGGCGGCCCGGCTGTGG - Intronic
1162057314 19:8072252-8072274 GGGGTGGAGCGGCGTGGCTGGGG - Intronic
1162725702 19:12688848-12688870 TGCTTGGGGCTGTGGGGCTGCGG - Intronic
1162754180 19:12847417-12847439 TGAGCGGGGCCGCACGGCTGGGG - Exonic
1163478306 19:17539742-17539764 CGCGTGTGGCGGGGCGGCTGAGG + Exonic
1164539831 19:29114224-29114246 TGTAGGGGGCGGCGGGGCTGGGG + Intergenic
1164539859 19:29114308-29114330 TGTAGGGGGCGGCGGGGCTGGGG + Intergenic
1165847976 19:38831257-38831279 TGCGGGGGGAGGCGGGGCTGCGG - Intronic
1166100892 19:40570782-40570804 TGCGTGGAGCGGTGGGACTGAGG + Intronic
1166106932 19:40602176-40602198 TGTGTGTGGCGGCGGGGGTGGGG + Intronic
1166292703 19:41873305-41873327 TGGCTGGAGCGGCGCGGCTGCGG - Intergenic
1166367247 19:42284016-42284038 GGCGGGGGGAGGCGCGGCGGGGG + Intronic
1166984042 19:46649240-46649262 TGCGGCGGGCGGCGCGGCCAGGG + Exonic
1167606000 19:50481472-50481494 GGCGTGGGGTGGGGAGGCTGGGG + Intronic
1168076336 19:53982573-53982595 GGCGTTCGGCGGCGCGGCCGGGG + Exonic
925609757 2:5693017-5693039 TCCGGGAGGCGGAGCGGCTGCGG + Exonic
925845251 2:8028309-8028331 AGAGTGGGGTGGCGCGGCCGGGG - Intergenic
925989000 2:9238610-9238632 TGCATGGGGAGGAGAGGCTGAGG + Intronic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
936396958 2:112138540-112138562 TGCGGGGCGCCGCGCGGCCGGGG - Exonic
936556603 2:113502734-113502756 TGCGGGGGGCTGCGGGGCTGGGG - Intergenic
939173910 2:138727654-138727676 TGCGGGGGGCGGTGAGGCGGGGG + Intronic
940300985 2:152176042-152176064 TGCCAGCGGCGGCGCGGCAGGGG + Intergenic
945585233 2:211653469-211653491 GGCGTGGGGGGGGGCGGGTGCGG - Intronic
946185756 2:217979625-217979647 GGGGTGGGGCGGCAGGGCTGGGG - Intronic
946239596 2:218345505-218345527 TGGGTGGGGCAGGGAGGCTGTGG - Exonic
946340035 2:219060768-219060790 GGCGGCGGGCGGCGGGGCTGCGG + Intergenic
946386643 2:219387912-219387934 GGGGCGGGGCGGCGCGGCCGGGG - Exonic
947992338 2:234497256-234497278 TGCGCGGCGCGGCGCGGGAGGGG - Intergenic
948098859 2:235358081-235358103 TGCGTGGGGCGCTGCAGCCGTGG - Intergenic
948183478 2:236001151-236001173 TGGCTGGGGCAGCGCGGCTGTGG + Intronic
948402091 2:237691971-237691993 TGGGTGGGGCGGAGCCGGTGGGG + Intronic
1168757295 20:326193-326215 TGCGGGAGGCGGAGCGGCTGCGG + Exonic
1172320680 20:33993556-33993578 GGCTTGGGGAGGCGGGGCTGGGG - Intergenic
1172619773 20:36311247-36311269 TGAGAGGGGCGCCTCGGCTGAGG - Intronic
1174586791 20:51615084-51615106 TGCCTGGGGGGGCGGGGCGGGGG + Intronic
1175278169 20:57786022-57786044 TGTGTGGGGCGGCGGTGGTGGGG + Intergenic
1175975944 20:62710585-62710607 TGCGTGTGGCGGCGGTGTTGTGG + Intronic
1176081055 20:63273148-63273170 GGCGGGGGGCGGCACGGCGGAGG - Intronic
1176289257 21:5035550-5035572 TGAGTGGGGTGGGGCTGCTGAGG - Intronic
1176548482 21:8211936-8211958 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176556376 21:8256144-8256166 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176567413 21:8394971-8394993 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1176575315 21:8439186-8439208 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1179012099 21:37563973-37563995 TTCGGGGGGCGGTGCTGCTGCGG + Intergenic
1179643213 21:42760542-42760564 TAGGAGGGGCGGAGCGGCTGGGG - Intronic
1179867978 21:44228054-44228076 TGAGTGGGGTGGGGCTGCTGAGG + Intronic
1180102132 21:45593296-45593318 ACCGTGGGGCGACGGGGCTGTGG - Intergenic
1180102513 21:45595437-45595459 TGCTTGGGGCGGCGTGGATCCGG - Intergenic
1180222874 21:46370393-46370415 TGCGGGGGTCGGGGAGGCTGGGG + Intronic
1182319749 22:29470833-29470855 TGGGTGTGGTGGCGCGCCTGTGG - Intergenic
1184229592 22:43151520-43151542 TGGGAGGGGCGGGGCGGATGCGG + Intronic
1185255125 22:49827539-49827561 CGCGGGGGCCGGCGCGGCCGAGG + Intergenic
1185367198 22:50442124-50442146 TGCATTGGGCGGTGAGGCTGGGG - Intronic
1203253366 22_KI270733v1_random:128241-128263 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203261420 22_KI270733v1_random:173319-173341 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
950583547 3:13878374-13878396 TGCGCGGGGCGGCGGGGCGCGGG + Intronic
950805772 3:15601905-15601927 GGCGTGGTGCGGCGCGGAGGGGG + Intronic
952430450 3:33218656-33218678 TGCGGGAGGCGGCGGGGCGGGGG - Intronic
954912866 3:54122979-54123001 CGCGTCGGGCGGCGAGGCCGGGG + Intronic
955911567 3:63863933-63863955 GGCGCGGCGCGGCGCGGCTCAGG - Intergenic
956813597 3:72888216-72888238 TTCATGGTGCGGCGCGGCGGCGG - Exonic
957350615 3:79018839-79018861 TGCGAGGGCAGGCGCGGCGGCGG + Intronic
958785563 3:98593440-98593462 CTCGTGGCGCGGGGCGGCTGCGG - Exonic
961081717 3:124033581-124033603 GGCGTTGGGCGGCGGGGCTGGGG - Intergenic
961674193 3:128555109-128555131 TGCGTGTGGAGGGGAGGCTGTGG + Intergenic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
964451289 3:156816102-156816124 TGCGAAGCGCGGAGCGGCTGCGG + Intergenic
966911460 3:184562389-184562411 TGCCTGGGGTCGCGGGGCTGCGG + Intronic
968659649 4:1793724-1793746 GGCGGCGGGCGGGGCGGCTGGGG + Intronic
968700853 4:2057789-2057811 TGAGTGGGGAGGCGGGACTGAGG - Intergenic
968965284 4:3766342-3766364 AGCGAGCGGCGACGCGGCTGCGG - Intronic
972418847 4:38868011-38868033 GGTCTGGGGCGGCGCGGCCGAGG + Intronic
978777050 4:112515268-112515290 GGCGCGGGGCGGCGTGGCTGCGG - Exonic
978795755 4:112706021-112706043 TCCGCGGGGCGCGGCGGCTGCGG + Intergenic
980930174 4:139177143-139177165 TCGGTGGGGCGGCGCGGGCGGGG - Exonic
985576035 5:673888-673910 TGGGTGGGGCTGGGTGGCTGTGG - Intronic
987360709 5:17103968-17103990 TGCGGGGGGCGGTGGGGGTGTGG + Intronic
989214344 5:38888411-38888433 TGGGTGGGGTGGCGGGGGTGGGG + Intronic
990919218 5:60944732-60944754 GGCGGGGGGCGGCGGGGGTGGGG - Intronic
992715895 5:79510957-79510979 TGCATGGGGCTGTGGGGCTGGGG + Intronic
996443095 5:123512861-123512883 GGAGTGGTGCGGCGCGACTGGGG + Intronic
998157727 5:139795977-139795999 TGAGTGGGGCCGCGGGGCTCCGG + Intronic
1001746627 5:174097324-174097346 TGTGTGGGGTGGCGGGGTTGAGG + Intronic
1002532822 5:179858848-179858870 TGCGTGGGGCGGGGCCGCGGCGG - Exonic
1003881617 6:10484171-10484193 TGGGTGGGGGGGCGGCGCTGAGG + Intergenic
1005385306 6:25279492-25279514 CGCGGGGCGCGGGGCGGCTGTGG - Exonic
1006052286 6:31354434-31354456 TGGGTGGGGTGGCGGGTCTGGGG - Intronic
1006180484 6:32150818-32150840 TGCCTGTGGCGGTGGGGCTGGGG + Exonic
1006785091 6:36660986-36661008 TGAGGGCGGAGGCGCGGCTGGGG - Intergenic
1006860783 6:37170443-37170465 TGCGGGTGGCGTTGCGGCTGTGG - Exonic
1007902062 6:45422091-45422113 CGCGCGGCGCGGCGCGGCGGTGG + Intronic
1010032912 6:71288898-71288920 GGCGCGGGGCTGCGGGGCTGCGG - Exonic
1011099829 6:83708851-83708873 TGCGGCGGGCGGCGCCGCTCAGG - Intronic
1013366240 6:109440559-109440581 TGCGGGGGCCCGCACGGCTGCGG + Exonic
1014143087 6:117966141-117966163 TGCTTGGGGCGGGGCGGGAGTGG - Intronic
1015149548 6:130020983-130021005 GGGGTGGGGGGGCGCGGCCGGGG + Intronic
1017672095 6:156778153-156778175 CTGGTGGGGCGGCGCGGCGGGGG - Exonic
1019112061 6:169724419-169724441 TGAGGGGAGCGGCGGGGCTGAGG - Intronic
1019202849 6:170333157-170333179 TGCGGGGGGCGGGGGGGCGGTGG - Intronic
1019292328 7:256844-256866 TCCGTGGCACGGCCCGGCTGCGG + Intronic
1019413970 7:919077-919099 TTCGTGGGCTGGCGGGGCTGTGG - Intronic
1019719418 7:2559282-2559304 TGCGCGGGGCCCCGAGGCTGCGG - Intronic
1020016270 7:4833924-4833946 TGTGTGTGGCGGGGCGGCAGAGG + Intronic
1023607144 7:41941467-41941489 AGGGTGGGGAGCCGCGGCTGGGG - Intergenic
1023902249 7:44490688-44490710 TCCGCCGGACGGCGCGGCTGCGG + Exonic
1026806808 7:73434024-73434046 TGCGGGGGGCGCTGCTGCTGTGG + Exonic
1027318463 7:76998318-76998340 TGCGTGGGGGGGTGTGGGTGTGG + Intergenic
1029101301 7:98132388-98132410 GGCGTGGTGCCGCGCGCCTGTGG - Intronic
1029903985 7:104072027-104072049 TGGGTGGGGCGGGGAGGCTTAGG - Intergenic
1030348336 7:108456711-108456733 CGCGTGTGGCGGCGGGGGTGGGG + Intronic
1034335918 7:150323439-150323461 GGCGGCGGGCGGCGGGGCTGCGG + Exonic
1034347745 7:150397606-150397628 CGCGCAGCGCGGCGCGGCTGCGG - Exonic
1034433242 7:151051257-151051279 AGCGCGCGGCGGCGCGGCTCGGG - Exonic
1034441158 7:151086692-151086714 GGCCCGGGGCGGCGCGGCGGAGG - Intronic
1034859612 7:154584086-154584108 AGTGTGGGGCGGGGAGGCTGAGG - Intronic
1034951076 7:155297606-155297628 TGCGGGGCGCGTGGCGGCTGCGG - Intergenic
1035273994 7:157736543-157736565 TGTGGGGGGCGGCGGGGGTGGGG - Intronic
1035386924 7:158479222-158479244 TGAGTGGGGCGGCGTGGCACAGG + Intronic
1037828878 8:22176865-22176887 TGCCGGGGGCGGGGCGGCAGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039890617 8:41683155-41683177 TGCGTGGGGAGACAGGGCTGGGG + Intronic
1048980919 8:139703156-139703178 GGCGGGGGGCGGGGAGGCTGGGG + Intergenic
1049166412 8:141128647-141128669 TGCGGGCGACTGCGCGGCTGAGG + Exonic
1049298061 8:141854494-141854516 TGTGTGGGGGGGGGGGGCTGTGG - Intergenic
1049396185 8:142402292-142402314 TGTGTGGGGCAGCGCGGGTAGGG - Intronic
1049396387 8:142403041-142403063 GGCGTGGGGCGGCGAGGGCGAGG - Intronic
1049796666 8:144500201-144500223 TAGGTGCGGCGGTGCGGCTGTGG + Intronic
1049879434 8:145052229-145052251 GGCGGGGCGGGGCGCGGCTGGGG - Intergenic
1049896418 9:114604-114626 TGCGGGGGGCTGGGGGGCTGGGG + Intergenic
1050094248 9:2047313-2047335 CGCGGGCGGCTGCGCGGCTGCGG - Exonic
1051849761 9:21492702-21492724 TCCGTGGAGCGGGGCTGCTGTGG + Intergenic
1052048546 9:23821751-23821773 GGCGCGGCGCGGCGCGGGTGGGG - Intronic
1054160942 9:61671769-61671791 TGTGTGGGGCGGCGTGGGAGAGG + Intergenic
1056414471 9:86362877-86362899 TGGGTGGGGGGGCGGGGGTGCGG + Intergenic
1056643328 9:88388787-88388809 GGCGGGGGGCGGCGGGGATGGGG - Intronic
1056992582 9:91424508-91424530 TGCGCAGGGCTGCGCGGCGGAGG + Intergenic
1057245595 9:93451863-93451885 GGCGGGGGGCGGCGGGGCCGGGG - Exonic
1057466385 9:95317774-95317796 TCCGTGGGGCGGGGCGGGCGCGG + Intergenic
1057490654 9:95517062-95517084 TGCGGGGGGCCGCCGGGCTGGGG + Intergenic
1060822966 9:126672012-126672034 TGCCTGGGGCAGGGCTGCTGGGG + Intronic
1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG + Exonic
1061196984 9:129111793-129111815 TGGGTGGTGGGGCGCCGCTGGGG + Intronic
1061825629 9:133256647-133256669 TGCGTGGGGAGGCGTGGCTCAGG - Intronic
1062389204 9:136327408-136327430 TGCGGGGGGCGGGGCGGACGCGG - Intergenic
1062651246 9:137578842-137578864 TGCGCGGGGCGGCGAGGCCGGGG + Exonic
1062659093 9:137619065-137619087 GGCGGGGGGCGGCGCGGGGGCGG + Intronic
1203469766 Un_GL000220v1:111388-111410 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1203477587 Un_GL000220v1:155360-155382 GGCGCGGAGCGGCGCGGCGGAGG - Intergenic
1185467023 X:361285-361307 TGAGTGAGGCGGCACGGCCGAGG - Intronic
1185471621 X:387051-387073 TTGGTGGGGCCGAGCGGCTGCGG + Intergenic
1187332647 X:18354717-18354739 CGCGGGGGGCGGGGCGGCAGTGG - Exonic
1190333500 X:49249584-49249606 TGCCTGGGGTGGGGCTGCTGGGG + Intronic
1192274463 X:69615895-69615917 TGGGTGGGGCGGCCAGGCAGAGG + Intergenic
1194268453 X:91781679-91781701 TGTGTGTCGCGGCGGGGCTGGGG + Intronic
1195743548 X:108091280-108091302 TGCTTGGGGCGGCGGGGGCGGGG + Intronic
1196464420 X:115958248-115958270 TGCCTGGGGAGGAGCGGCTTGGG - Intergenic
1199445102 X:147912037-147912059 GGCGTGCGGCAGCGCGGCGGCGG + Exonic
1200092257 X:153641538-153641560 TGCGTGGGGAGGGGAGGCAGAGG - Intergenic
1200585652 Y:5002592-5002614 TGTGTGTCGCGGCGGGGCTGGGG + Intronic