ID: 962302590

View in Genome Browser
Species Human (GRCh38)
Location 3:134255921-134255943
Sequence CACTGCCCAATAGAAATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962302590_962302591 0 Left 962302590 3:134255921-134255943 CCTGACATTTCTATTGGGCAGTG No data
Right 962302591 3:134255944-134255966 CTGATCTAGATATTAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962302590 Original CRISPR CACTGCCCAATAGAAATGTC AGG (reversed) Intergenic
No off target data available for this crispr