ID: 962305033

View in Genome Browser
Species Human (GRCh38)
Location 3:134278451-134278473
Sequence TTATCTTCCAGGGGCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962305023_962305033 29 Left 962305023 3:134278399-134278421 CCCAAATTTTGCTGAGAAGTCAA No data
Right 962305033 3:134278451-134278473 TTATCTTCCAGGGGCCACGCTGG No data
962305024_962305033 28 Left 962305024 3:134278400-134278422 CCAAATTTTGCTGAGAAGTCAAG No data
Right 962305033 3:134278451-134278473 TTATCTTCCAGGGGCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962305033 Original CRISPR TTATCTTCCAGGGGCCACGC TGG Intergenic
No off target data available for this crispr