ID: 962305802

View in Genome Browser
Species Human (GRCh38)
Location 3:134284688-134284710
Sequence TGTCCACTCAATTAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962305798_962305802 -8 Left 962305798 3:134284673-134284695 CCCGCTTCAAGGGCTTGTCCACT No data
Right 962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG No data
962305794_962305802 17 Left 962305794 3:134284648-134284670 CCGAGGCTGCTCCATCTCAGGGC No data
Right 962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG No data
962305795_962305802 6 Left 962305795 3:134284659-134284681 CCATCTCAGGGCAGCCCGCTTCA No data
Right 962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG No data
962305799_962305802 -9 Left 962305799 3:134284674-134284696 CCGCTTCAAGGGCTTGTCCACTC No data
Right 962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG No data
962305792_962305802 18 Left 962305792 3:134284647-134284669 CCCGAGGCTGCTCCATCTCAGGG No data
Right 962305802 3:134284688-134284710 TGTCCACTCAATTAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962305802 Original CRISPR TGTCCACTCAATTAGGTGGT AGG Intergenic
No off target data available for this crispr