ID: 962308244

View in Genome Browser
Species Human (GRCh38)
Location 3:134307644-134307666
Sequence GCATGTTCCAGAGAGCTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962308239_962308244 7 Left 962308239 3:134307614-134307636 CCTGGCTTCAAATGGACTGAGTG No data
Right 962308244 3:134307644-134307666 GCATGTTCCAGAGAGCTTAGTGG No data
962308238_962308244 13 Left 962308238 3:134307608-134307630 CCTTGTCCTGGCTTCAAATGGAC No data
Right 962308244 3:134307644-134307666 GCATGTTCCAGAGAGCTTAGTGG No data
962308236_962308244 20 Left 962308236 3:134307601-134307623 CCTCACACCTTGTCCTGGCTTCA No data
Right 962308244 3:134307644-134307666 GCATGTTCCAGAGAGCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962308244 Original CRISPR GCATGTTCCAGAGAGCTTAG TGG Intergenic
No off target data available for this crispr