ID: 962312217

View in Genome Browser
Species Human (GRCh38)
Location 3:134334647-134334669
Sequence CACCCTTCCCGCAGCCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962312217_962312227 29 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG No data
962312217_962312226 15 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312226 3:134334685-134334707 GGCATGGGCTGTGTCAGAGCTGG No data
962312217_962312223 -1 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312223 3:134334669-134334691 GGCCAAGGCAGGAGGTGGCATGG No data
962312217_962312222 -6 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312222 3:134334664-134334686 AGGGTGGCCAAGGCAGGAGGTGG No data
962312217_962312224 0 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312224 3:134334670-134334692 GCCAAGGCAGGAGGTGGCATGGG No data
962312217_962312221 -9 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312221 3:134334661-134334683 GGAAGGGTGGCCAAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962312217 Original CRISPR CACCCTTCCCGCAGCCTCCT TGG (reversed) Intergenic
No off target data available for this crispr