ID: 962312225

View in Genome Browser
Species Human (GRCh38)
Location 3:134334671-134334693
Sequence GCCCATGCCACCTCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962312225_962312230 28 Left 962312225 3:134334671-134334693 CCAAGGCAGGAGGTGGCATGGGC No data
Right 962312230 3:134334722-134334744 AGTGAATTGAGCTCACAGGGAGG No data
962312225_962312229 25 Left 962312225 3:134334671-134334693 CCAAGGCAGGAGGTGGCATGGGC No data
Right 962312229 3:134334719-134334741 AGGAGTGAATTGAGCTCACAGGG No data
962312225_962312227 5 Left 962312225 3:134334671-134334693 CCAAGGCAGGAGGTGGCATGGGC No data
Right 962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG No data
962312225_962312228 24 Left 962312225 3:134334671-134334693 CCAAGGCAGGAGGTGGCATGGGC No data
Right 962312228 3:134334718-134334740 CAGGAGTGAATTGAGCTCACAGG No data
962312225_962312226 -9 Left 962312225 3:134334671-134334693 CCAAGGCAGGAGGTGGCATGGGC No data
Right 962312226 3:134334685-134334707 GGCATGGGCTGTGTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962312225 Original CRISPR GCCCATGCCACCTCCTGCCT TGG (reversed) Intergenic
No off target data available for this crispr