ID: 962312227

View in Genome Browser
Species Human (GRCh38)
Location 3:134334699-134334721
Sequence CAGAGCTGGCACATTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962312217_962312227 29 Left 962312217 3:134334647-134334669 CCAAGGAGGCTGCGGGAAGGGTG No data
Right 962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG No data
962312225_962312227 5 Left 962312225 3:134334671-134334693 CCAAGGCAGGAGGTGGCATGGGC No data
Right 962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962312227 Original CRISPR CAGAGCTGGCACATTGCAGC AGG Intergenic
No off target data available for this crispr