ID: 962313419

View in Genome Browser
Species Human (GRCh38)
Location 3:134342092-134342114
Sequence CAGAGGAGACACAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962313413_962313419 24 Left 962313413 3:134342045-134342067 CCTAAATCCAATGACTGATGTCT 0: 5
1: 45
2: 197
3: 450
4: 1004
Right 962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG No data
962313414_962313419 17 Left 962313414 3:134342052-134342074 CCAATGACTGATGTCTTTATAAG 0: 7
1: 36
2: 220
3: 440
4: 796
Right 962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG No data
962313412_962313419 25 Left 962313412 3:134342044-134342066 CCCTAAATCCAATGACTGATGTC 0: 8
1: 110
2: 277
3: 515
4: 784
Right 962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962313419 Original CRISPR CAGAGGAGACACAGGGAAGA AGG Intergenic
No off target data available for this crispr