ID: 962313713

View in Genome Browser
Species Human (GRCh38)
Location 3:134344744-134344766
Sequence GATGAGGAAGTCCCTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962313713_962313718 24 Left 962313713 3:134344744-134344766 CCACCTGGAGGGACTTCCTCATC No data
Right 962313718 3:134344791-134344813 CCAGCCAGAGTCATGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962313713 Original CRISPR GATGAGGAAGTCCCTCCAGG TGG (reversed) Intergenic
No off target data available for this crispr