ID: 962317040

View in Genome Browser
Species Human (GRCh38)
Location 3:134365398-134365420
Sequence GTGTGCAATGGGAATGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962317040_962317043 -1 Left 962317040 3:134365398-134365420 CCTCTCACATTCCCATTGCACAC 0: 1
1: 0
2: 0
3: 23
4: 237
Right 962317043 3:134365420-134365442 CTCCCGACCTTTCTGTTGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 106
962317040_962317047 9 Left 962317040 3:134365398-134365420 CCTCTCACATTCCCATTGCACAC 0: 1
1: 0
2: 0
3: 23
4: 237
Right 962317047 3:134365430-134365452 TTCTGTTGCCAGGAACTCCCTGG 0: 1
1: 0
2: 1
3: 37
4: 244
962317040_962317048 10 Left 962317040 3:134365398-134365420 CCTCTCACATTCCCATTGCACAC 0: 1
1: 0
2: 0
3: 23
4: 237
Right 962317048 3:134365431-134365453 TCTGTTGCCAGGAACTCCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962317040 Original CRISPR GTGTGCAATGGGAATGTGAG AGG (reversed) Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900844014 1:5081735-5081757 GTGTGCATAGGAGATGTGAGGGG - Intergenic
903375281 1:22861987-22862009 TTGTGCAATGGGTAAGTGGGTGG - Intronic
903931582 1:26865204-26865226 CTGGCCAATGGGAAAGTGAGCGG + Intergenic
905756030 1:40509573-40509595 CTGTGCAGTGTCAATGTGAGAGG + Exonic
906201689 1:43964580-43964602 GTGGGGAATGGGAAAGGGAGGGG + Intronic
907430364 1:54407431-54407453 GTGTACAATGGGAAATTGAGGGG + Intronic
908982597 1:69976816-69976838 CTCTCCAAGGGGAATGTGAGGGG - Intronic
910040641 1:82847782-82847804 GTGTGCATTGTGATTGTGTGTGG - Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911587273 1:99705215-99705237 GTGTGGAATGGGGATGTGGCTGG - Intergenic
915270035 1:154747289-154747311 GTGTGGAAGGGGGATTTGAGGGG - Intronic
916478515 1:165193414-165193436 GAGAGCAATGGGAATGGGAATGG - Intergenic
922398915 1:225230586-225230608 GTGGGTAATGGGAGTGAGAGGGG + Intronic
922706368 1:227792836-227792858 CTGTGCAGTGGGGATGTCAGCGG + Intergenic
923502685 1:234578989-234579011 GTGGGCAGGGGGACTGTGAGGGG + Intergenic
923532405 1:234821889-234821911 GAGAGCAAGGAGAATGTGAGTGG - Intergenic
1064290642 10:14031132-14031154 GTGTGCAACTGGAATGTGCCAGG + Intronic
1064291277 10:14036175-14036197 GTGTGCAATTGGAATGTGCCAGG - Intronic
1065021738 10:21507449-21507471 GTCCGCAAGGCGAATGTGAGAGG + Intergenic
1067429591 10:46234309-46234331 GTGTGCATTGGGACTGTGCAAGG + Intergenic
1067527420 10:47046949-47046971 ATGTGCAATGGGAATGGACGAGG + Intergenic
1069784552 10:70979352-70979374 GAGAGCTATCGGAATGTGAGAGG - Intergenic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070748864 10:78952052-78952074 GTGTGGCATGGGAATTTGAGGGG - Intergenic
1071438583 10:85669370-85669392 GAGTGAACTGGGAATCTGAGAGG + Intronic
1071711756 10:88056671-88056693 GTGTGCAATGGGCCTTTGAAAGG - Intergenic
1073499763 10:103925768-103925790 GTCAGCAAGGGGAATGAGAGAGG + Intergenic
1076521787 10:131085762-131085784 GTGTGCAGGGGGACTGTGGGAGG - Intergenic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1080020249 11:27552595-27552617 GTGTTGAATGGGAATGTGATGGG + Intergenic
1080186976 11:29501657-29501679 GTGTTGAATGGGAGTGTGAGTGG + Intergenic
1081407181 11:42711224-42711246 ATGTGCAGTGGGTACGTGAGTGG - Intergenic
1081997783 11:47376319-47376341 GTGTGCAGGTGGAATGTGAGTGG - Intronic
1082944969 11:58748944-58748966 GTGTGGAATGTGCATGCGAGTGG - Intergenic
1083110199 11:60398906-60398928 TTGTGAAATGAGAAAGTGAGGGG - Intronic
1087586033 11:100122596-100122618 GTGAGCAATGTGAATGTCTGGGG + Intronic
1087772006 11:102221023-102221045 CTGTGCAATGGGTGTTTGAGTGG + Intronic
1088087209 11:105995912-105995934 GTGGCAAATGGGAATGGGAGAGG - Intronic
1088813868 11:113408761-113408783 GTGTGCAATGGGGATGGGTTGGG + Intergenic
1090520855 11:127477464-127477486 TTGTGGAATGGGGATGTGGGTGG - Intergenic
1090582470 11:128175196-128175218 GTGTGCAATTCAAATGTGACTGG + Intergenic
1090867428 11:130714015-130714037 GTGAGGAAATGGAATGTGAGAGG - Intronic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1091933515 12:4416450-4416472 GTGTGGAAGGGGAACCTGAGCGG + Intergenic
1092500422 12:9040874-9040896 TTGTTCAATGGGAATGTCAATGG + Intergenic
1097456220 12:59801938-59801960 GTGGGTAGTGGGAAGGTGAGCGG + Intergenic
1097829973 12:64214045-64214067 GTGTGCAATGGGATGGTGAAGGG - Intronic
1097940363 12:65297784-65297806 GTGTGGAGGGTGAATGTGAGGGG + Intronic
1101063979 12:101000194-101000216 GTGTGTAATGGGAAAGTTTGAGG + Intronic
1101237735 12:102806353-102806375 GTGTGCTCTGGCTATGTGAGAGG - Intergenic
1101618613 12:106361883-106361905 CTGTGGAAAGGGAATGTGAGGGG + Intronic
1102548109 12:113671200-113671222 GTGTGAAAAGGGAAAGTGACTGG - Intergenic
1106131507 13:26943444-26943466 ATGTGAAATGGGAAAGAGAGAGG + Intergenic
1107160733 13:37224420-37224442 ATGTGTAATGGGAATATCAGAGG - Intergenic
1108185230 13:47882082-47882104 GAGTGCTCTGGGAATGTGATGGG - Intergenic
1109498318 13:63204623-63204645 TTTTGAAATTGGAATGTGAGTGG - Intergenic
1109981085 13:69908235-69908257 GTGTGGAATGGGTGAGTGAGAGG + Intronic
1111268426 13:85850135-85850157 GTGTGGAAGGGAAATGTGGGTGG - Intergenic
1113810815 13:113141384-113141406 GTCTGCATTGGGACTGTGGGGGG + Intronic
1115530010 14:34318445-34318467 GAGTTAAATGGGAATGTGATAGG + Intronic
1117990159 14:61425131-61425153 CAGTGCAAAGGGAAAGTGAGGGG + Intronic
1118425004 14:65650976-65650998 GTGTTCAGTGGGAGTGGGAGGGG - Intronic
1118441701 14:65817943-65817965 GTGTGCAGTGCGTATGTGTGTGG - Intergenic
1121722939 14:96124166-96124188 GTGTGCAAGGGAAATGTTTGGGG + Intergenic
1121871820 14:97415027-97415049 GTGTGCAGAGGGTCTGTGAGTGG - Intergenic
1122031651 14:98916601-98916623 GTGTGCAATGGCAATGACAGAGG - Intergenic
1123133673 14:106008121-106008143 GTGTGCAATGAGAGGGTGTGGGG + Intergenic
1124132818 15:27004863-27004885 GTGTGGACTGGCATTGTGAGCGG + Intronic
1126202475 15:46002825-46002847 GTGTAGGATGGGAATGTGAGGGG - Intergenic
1127237145 15:57066722-57066744 GTTTGGCATGGGAATGGGAGAGG - Intronic
1128666636 15:69542983-69543005 GGGTGGAATAGGAATGGGAGAGG - Intergenic
1129609744 15:77043740-77043762 GCGGCCAATGGGAATATGAGTGG + Exonic
1131343750 15:91627245-91627267 GTGGGCAAGGGCAATGTGAAAGG - Intergenic
1131981873 15:98002539-98002561 GTGTACATTGGGTATGTGTGTGG + Intergenic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1139480833 16:67229762-67229784 GTGGGCAGTGGGATTGTGGGGGG + Intronic
1140672562 16:77293402-77293424 GTGGGTAATGGGAATGGGGGTGG - Intronic
1141787373 16:86210757-86210779 GGGTGCAAGGGGGCTGTGAGTGG + Intergenic
1143002479 17:3803477-3803499 CTGTACCATGGGCATGTGAGAGG + Intergenic
1144625027 17:16840139-16840161 CTCTGCCCTGGGAATGTGAGCGG - Intergenic
1144881403 17:18432582-18432604 CTCTGCCCTGGGAATGTGAGCGG + Intergenic
1145150830 17:20511804-20511826 CTCTGCCCTGGGAATGTGAGCGG - Intergenic
1145911573 17:28546382-28546404 GGGTGCAAGGGGAAGGTGTGGGG - Intronic
1146538637 17:33675304-33675326 GTGTGTTGTAGGAATGTGAGAGG + Intronic
1147189199 17:38729200-38729222 GTGTGCAATGGGCCAGTTAGGGG + Exonic
1147960502 17:44164598-44164620 TTGTGAAATGGGATTCTGAGGGG - Intergenic
1148663153 17:49352976-49352998 GAGTGCAATGGGACAGTGGGAGG + Intronic
1148980858 17:51573498-51573520 GTGTTCAATGGGAGTGGGGGAGG + Intergenic
1151281010 17:73073972-73073994 TTATGGAATTGGAATGTGAGGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152045312 17:77931275-77931297 GTGTGCAGTGTGGATGTGTGTGG - Intergenic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1153403859 18:4712915-4712937 GTTTGCAATGGGAATCAGGGTGG - Intergenic
1155994088 18:32311813-32311835 GAGTGGAATGGGGATTTGAGCGG + Intronic
1158560909 18:58512887-58512909 GTGTGTAATGCGTATGTGTGTGG + Intronic
1163059131 19:14745558-14745580 GTCTGGAAAGGGTATGTGAGTGG - Intronic
1163077634 19:14909191-14909213 ATGTCCTATGGGGATGTGAGTGG + Intergenic
1167116153 19:47490188-47490210 GTGTGCAATGTGTGTGTGTGGGG + Intronic
925281909 2:2690848-2690870 GTGTGAGATGTGAATGTGTGTGG - Intergenic
926152638 2:10433363-10433385 GTGTGCGATGTGTATGTGTGTGG + Intergenic
926778068 2:16441608-16441630 GCGTACAATTGGAATGTTAGTGG - Intergenic
926788681 2:16547153-16547175 GGGTTCCATGTGAATGTGAGTGG - Intergenic
927178939 2:20430184-20430206 GTGTGCAGAGGAAATGTAAGTGG - Intergenic
927215140 2:20664218-20664240 CTGGGGGATGGGAATGTGAGGGG - Intergenic
929335770 2:40743415-40743437 GTAGGCAATGGGAAAGTGATTGG - Intergenic
929596241 2:43178124-43178146 GTGTGCAGTGGGACGCTGAGGGG - Intergenic
932143287 2:69297907-69297929 CTGTGCAAGGGGATTGGGAGAGG + Intergenic
932331155 2:70899174-70899196 GTGTCCAATGTGCATGTGAATGG - Intergenic
932592308 2:73074814-73074836 GTGTCACATGGGAATGTGTGGGG - Exonic
932877615 2:75470264-75470286 GTATACAATGAGAATGTGACTGG + Intronic
933119650 2:78521002-78521024 GTATGCAAAGGGAATATGCGGGG + Intergenic
933629834 2:84643483-84643505 GTGTGCAGTGGGAATACCAGAGG - Intronic
934791557 2:97066717-97066739 ATGTGCTTTGGGAATGTGAAAGG - Intergenic
934814881 2:97315826-97315848 ATGTGCTTTGGGAATGTGAAAGG + Intergenic
934822814 2:97392657-97392679 ATGTGCTTTGGGAATGTGAAAGG - Intergenic
936817567 2:116477307-116477329 GTCTGCCATGGGAAGCTGAGTGG + Intergenic
937238790 2:120447018-120447040 GTGCGCAGAGGGAAAGTGAGGGG + Intergenic
937318364 2:120946399-120946421 TTGTGCCATGGGAGTGTGTGAGG + Intronic
937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG + Intergenic
939533489 2:143394554-143394576 GTGGCCATTTGGAATGTGAGAGG - Intronic
940030724 2:149258787-149258809 GTGTGGAGTGGGAGTGTTAGAGG + Intergenic
941867693 2:170351621-170351643 GTGGGCAAAGGGGAAGTGAGAGG + Intronic
945489615 2:210439846-210439868 GTGTGCCTTGGGAAGGTGACAGG + Intronic
946717002 2:222563312-222563334 GTTTGCACAGGGAATGTGACGGG + Intergenic
947090852 2:226509953-226509975 TTGGGCATTTGGAATGTGAGTGG - Intergenic
948132449 2:235610678-235610700 GTCTGCAATGTGGATGTGTGCGG - Intronic
948682180 2:239642571-239642593 GTGTGCGATGTGTATGTGTGTGG + Intergenic
1171858867 20:30376747-30376769 GAGTGCTGTGGGAATGTGGGCGG - Intergenic
1172773051 20:37392696-37392718 CTGTACAGTGGGAATGAGAGGGG + Intronic
1172889332 20:38252930-38252952 GGGTGGATTGGGAATGAGAGTGG - Intronic
1172952390 20:38730403-38730425 GCTTGCAAGGGGCATGTGAGAGG + Intergenic
1173059977 20:39651582-39651604 GGGTGCAATGGGAAGATGAGTGG + Intergenic
1173500238 20:43548011-43548033 GTGTGCATGGGGAATGGGGGAGG - Intronic
1173961748 20:47078526-47078548 GGGTGCATGGGGGATGTGAGTGG - Intronic
1174580043 20:51564837-51564859 CTTTGCAGTGGGATTGTGAGTGG - Intergenic
1176389836 21:6157759-6157781 GTGTGCTATGTGCATGTGTGTGG - Intergenic
1177422745 21:20882647-20882669 GGGTGCAATGGGAATGGGAACGG - Intergenic
1177656210 21:24020403-24020425 GTGTGGAAGAGGAATGTGGGGGG + Intergenic
1178833459 21:36075804-36075826 TTATGCAATGGTAATCTGAGAGG - Intronic
1179247229 21:39644509-39644531 TTTTGCAATGGAACTGTGAGAGG - Intronic
1179344115 21:40540169-40540191 GTGTGCGAAGGGGAGGTGAGCGG - Intronic
1179733631 21:43380479-43380501 GTGTGCTATGTGCATGTGTGTGG + Intergenic
1180084175 21:45500306-45500328 GTGTGTAGTGGGGGTGTGAGGGG + Intronic
1183712770 22:39515427-39515449 GTCTGCCATAGGAATGTGAGAGG + Exonic
1183826927 22:40395754-40395776 GTGGGGAATGAGAATGGGAGTGG - Intronic
1184259159 22:43304845-43304867 GTGTGCAAAGGGATGGTGTGGGG - Intronic
950502649 3:13374094-13374116 GTGTGCACTGTGGATGTGAGTGG - Intronic
950502654 3:13374171-13374193 GTGTGCACTGTGGGTGTGAGTGG - Intronic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
953341237 3:42135649-42135671 GTGTGGAATTGGACTGTGTGTGG + Intronic
954995518 3:54877786-54877808 GTTTGCCTGGGGAATGTGAGAGG + Intronic
956181540 3:66522315-66522337 ATGTGGAATGGGAGTGGGAGTGG + Intergenic
956772650 3:72539479-72539501 GTGTGCAAAGGTAGGGTGAGGGG - Intergenic
957397608 3:79662688-79662710 GGGTCCACTGGGAATTTGAGAGG - Intronic
959610828 3:108292967-108292989 GTGAGCCAAGGGGATGTGAGAGG + Intergenic
960176283 3:114521541-114521563 TGGTGCAATGGGGATGAGAGAGG - Intronic
962317040 3:134365398-134365420 GTGTGCAATGGGAATGTGAGAGG - Intronic
962484732 3:135831266-135831288 GTGGGCAGTGGGCATGTGACAGG - Intergenic
964763900 3:160159936-160159958 GTGTGCTATGGGGATGTGGCGGG - Intergenic
965467676 3:169052647-169052669 GTGTGTAATGGTATTGTTAGTGG + Intergenic
968868598 4:3229092-3229114 GTGTGCAAGTGGCATGTGTGTGG - Intronic
968897808 4:3414927-3414949 GTGTGTGAGGGGCATGTGAGGGG + Intronic
969291322 4:6241786-6241808 GTGTGCAAAGGGAAGGAGATTGG + Intergenic
970779806 4:19723125-19723147 GAGTGCTATGAGGATGTGAGTGG + Intergenic
971109698 4:23571794-23571816 TTGTGCAATGGCAAAGTGAGAGG + Intergenic
972665395 4:41160310-41160332 GAGTGAAATGGGAATGTGCATGG - Intronic
973002087 4:44963540-44963562 GTGGGCAGTGGGAATGAAAGAGG - Intergenic
975025181 4:69540021-69540043 GAGGGAAATGGGAATGTTAGAGG + Intergenic
975608326 4:76178935-76178957 GTGTGCTCTGGGATTGTGATGGG - Intronic
976031084 4:80754522-80754544 GTTTTCAAGGGGAAAGTGAGAGG + Intronic
977087652 4:92623538-92623560 GTGTGCAATAAGAATTTGAGTGG + Intronic
981182246 4:141759595-141759617 GGGTGAAGTGGAAATGTGAGAGG - Intergenic
981736055 4:147951427-147951449 TTGTGAAATGGGAATGTAGGGGG + Intronic
983693632 4:170502354-170502376 GTGTGCATTTGGAAGGTGGGAGG + Intergenic
985070228 4:186160242-186160264 GTGTGCAGTGTGTGTGTGAGTGG - Intronic
985070241 4:186160384-186160406 GTGTGCAGTGTGTGTGTGAGTGG - Intronic
986299319 5:6465997-6466019 GGGTGCAAGGGGAGTGTGAGGGG - Intronic
986749755 5:10776423-10776445 GAGTGAAATGGGAATATGAGGGG + Intergenic
989619259 5:43368524-43368546 GAGTGCTATGGGAATGGGAAAGG - Intergenic
990566823 5:57037974-57037996 GAGTGCACTGGGATTGTGAATGG + Intergenic
993204195 5:84859564-84859586 GTGGGAAATGGGGATGTGTGAGG + Intergenic
997613539 5:135231355-135231377 GAGTGCACAGGGCATGTGAGTGG + Intronic
998225697 5:140324715-140324737 GTCTTCAATGGGAGTGTGAAAGG - Intergenic
998642480 5:144026940-144026962 GTAAGGAATGGGAATGGGAGAGG + Intergenic
998711396 5:144829276-144829298 GGGTGCATTGAGAAGGTGAGAGG + Intergenic
998995210 5:147864135-147864157 GTGTGGAATATGAATGAGAGGGG - Intergenic
999284178 5:150384201-150384223 CTGTGCCATTGGAAAGTGAGAGG - Intronic
1000797428 5:165682415-165682437 TTGTGGAAAGGGAATGTGGGAGG + Intergenic
1000981441 5:167820846-167820868 GTGTGCATTGGGAGAGGGAGAGG + Intronic
1001188510 5:169602392-169602414 GCATGCAATGGGATTGTTAGAGG + Intronic
1002810788 6:626458-626480 GTGCACACTGGGAACGTGAGGGG - Intronic
1003042366 6:2700177-2700199 GTGAGCAATGCGAGTTTGAGAGG - Intronic
1007218128 6:40257037-40257059 AAGTGCAATGGGAATTAGAGAGG + Intergenic
1008356354 6:50558591-50558613 GTGTGTAATAGGAATCTTAGAGG + Intergenic
1009533306 6:64848589-64848611 GTTTCCAATGAGAATGGGAGGGG + Intronic
1010057262 6:71581277-71581299 CTGGCCAATGGGATTGTGAGTGG + Intergenic
1010656102 6:78513831-78513853 GTGGTCAATGGAAATCTGAGGGG - Intergenic
1012037393 6:94160166-94160188 GTGTGCAATGCAAATGTGTTGGG - Intergenic
1014170921 6:118278290-118278312 GTGTGCAGAGTGAATGTAAGTGG + Intronic
1014460386 6:121687745-121687767 ATGTGCCATGGTAATGTAAGAGG + Intergenic
1014488295 6:122028959-122028981 GTGTGCCATGGGAAGGAGAGAGG + Intergenic
1014566539 6:122956227-122956249 GTGTACAATGGGAGTGAGACTGG + Intergenic
1017992145 6:159500141-159500163 GGGAGCAAAGGGAACGTGAGGGG - Intergenic
1018905768 6:168074991-168075013 GTGTGCACTGTGCATGTGTGTGG + Intronic
1019601333 7:1885276-1885298 GTGGGCAGAGGGCATGTGAGAGG - Intronic
1022168475 7:27797491-27797513 GTGTGCATTGGGGAGGGGAGGGG + Intronic
1022717341 7:32910530-32910552 GAGGGCAAAGGGAATGTGATTGG + Intergenic
1022903696 7:34835223-34835245 GTGTGCACAAGGAATGGGAGGGG - Intronic
1023079651 7:36515087-36515109 GTGTGGTGTGGGATTGTGAGGGG - Intronic
1023683334 7:42711275-42711297 GTGTGCAAAAAGAATGTTAGAGG + Intergenic
1023896008 7:44433521-44433543 GTGTGCTATGTGCATGTGTGTGG + Intronic
1024551280 7:50564442-50564464 TTGTGAAATGGGGATGTGACTGG + Intronic
1024686736 7:51754031-51754053 GTGTGCATTGGGCAAGGGAGTGG + Intergenic
1028614355 7:92748817-92748839 GTGTGGATGGGGAATGGGAGTGG - Intronic
1032118425 7:129137499-129137521 ATGTGAAATGGGACTGTGATTGG - Intergenic
1033418078 7:141182039-141182061 GTGTGCACTGGGAATGAGCAGGG - Intronic
1035405775 7:158596255-158596277 GTGTGGAATGTGAATGAGAATGG - Intergenic
1035407614 7:158609832-158609854 GTGTGTGAGGGGAGTGTGAGGGG + Intergenic
1035879952 8:3235510-3235532 ATGTGCAATGGGAATGTCTAAGG - Intronic
1037708590 8:21336742-21336764 GTGTGCAATAAAAATGTGAGAGG + Intergenic
1040387638 8:46924264-46924286 GGCTGCCATGGGAATGTGACTGG + Intergenic
1040576217 8:48653852-48653874 GGGTGCAAGGGAAATGTGACTGG - Intergenic
1042511051 8:69611429-69611451 GTGTGAGATGGGAAAGAGAGGGG - Intronic
1043147873 8:76679034-76679056 GTGTGCATGGGGAAGGGGAGTGG - Intergenic
1043780440 8:84327383-84327405 GTCTGCAGAGGGAATGTGGGAGG + Intronic
1045914952 8:107457809-107457831 GTGTGTAGTGGGTATGTGTGGGG - Intronic
1046604584 8:116356822-116356844 GAGTGCAACTGGAATGTGAGAGG - Intergenic
1047443167 8:124897082-124897104 GTGTGCAACGGGAAATGGAGGGG + Intergenic
1050230805 9:3524972-3524994 GTGTGCAAGGGGTGTGTGGGGGG + Intronic
1051743874 9:20276635-20276657 GTGTGGAAGGGAAATGTGAAGGG - Intergenic
1056195941 9:84228617-84228639 GAGGGCAATGGGACGGTGAGGGG + Intergenic
1057955108 9:99401136-99401158 ATGTGGAAGGAGAATGTGAGAGG - Intergenic
1059486155 9:114628468-114628490 CTGTGTTTTGGGAATGTGAGAGG + Intronic
1059715028 9:116905578-116905600 CTGGGCACTGTGAATGTGAGGGG - Intronic
1060224363 9:121782306-121782328 GTGGACAATGGGGATGTGAGCGG - Intronic
1061421321 9:130474343-130474365 GTGTGCATTTGGAAGGAGAGGGG - Intronic
1061636741 9:131915677-131915699 GTGGGCAGTGGGCATGGGAGTGG - Intronic
1062185484 9:135216065-135216087 GTGTGGGAGGGGAGTGTGAGTGG - Intergenic
1062297305 9:135839426-135839448 GTATGCACTGGGAAAGGGAGGGG + Intronic
1185765549 X:2723273-2723295 GTCTGCAATGGGAAGGTTTGGGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1187242874 X:17529588-17529610 GTCTGCACTGGGAATGTGGAAGG - Intronic
1188734594 X:33696748-33696770 GGGTGCAAGGGGAAGGGGAGGGG + Intergenic
1188923246 X:36005683-36005705 GTGTGCAATGGTGAAATGAGGGG + Intergenic
1189064832 X:37796246-37796268 GTCTGCTAAGGGAATGTGAGAGG + Intronic
1189267039 X:39725181-39725203 GTGTACAAAGGGGATGTGGGGGG - Intergenic
1190059020 X:47199135-47199157 GTGTGGAATGGGACATTGAGAGG + Intronic
1190228522 X:48563595-48563617 GTGTCCAAAGGGCAGGTGAGCGG + Intergenic
1191100050 X:56716988-56717010 GTGTTCAATAGGATTGAGAGAGG - Intergenic
1191661598 X:63657314-63657336 GTTAGGATTGGGAATGTGAGTGG - Intronic
1193350374 X:80456863-80456885 ATGTGCAAGGGAAATGTGTGTGG - Intergenic
1193431917 X:81418246-81418268 GTGTTCTCTGGGAATGGGAGAGG - Intergenic
1194104805 X:89755686-89755708 ATGTATAATGGGAATATGAGTGG - Intergenic
1195168196 X:102240535-102240557 TTGTGCACTGGGCATGTGACTGG + Intergenic
1195190661 X:102446552-102446574 TTGTGCACTGGGCATGTGACTGG - Intronic
1197055101 X:122109247-122109269 CTGTGCCATGGCAATGTGAAAGG + Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1198953043 X:142094732-142094754 GTGTGGAGAGGGAATATGAGGGG + Intergenic
1199944434 X:152653927-152653949 GCGTGGAAGGGGAATGTGGGTGG + Exonic
1200017830 X:153179680-153179702 GTGGGGAATGGGAATGCGAATGG - Intronic