ID: 962317109

View in Genome Browser
Species Human (GRCh38)
Location 3:134365807-134365829
Sequence CTGCTTGCTCAGAGTGAGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962317109_962317112 3 Left 962317109 3:134365807-134365829 CCCTACTCACTCTGAGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 147
Right 962317112 3:134365833-134365855 GGCCACCATGTCCTGACTGCCGG 0: 1
1: 1
2: 3
3: 14
4: 211
962317109_962317116 9 Left 962317109 3:134365807-134365829 CCCTACTCACTCTGAGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 147
Right 962317116 3:134365839-134365861 CATGTCCTGACTGCCGGCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 154
962317109_962317115 8 Left 962317109 3:134365807-134365829 CCCTACTCACTCTGAGCAAGCAG 0: 1
1: 0
2: 0
3: 6
4: 147
Right 962317115 3:134365838-134365860 CCATGTCCTGACTGCCGGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962317109 Original CRISPR CTGCTTGCTCAGAGTGAGTA GGG (reversed) Exonic
904331568 1:29761319-29761341 CAGCTTGCTCAGAGTGGGCAGGG + Intergenic
906125123 1:43422895-43422917 CTCCTTGGTCAGAGTCAGTCAGG - Intronic
906520531 1:46464423-46464445 CTCCCTGTTCAGAGTGAGGAGGG - Intergenic
908761336 1:67514560-67514582 CTGCTTTCTCAGCATGAGGAAGG + Intergenic
912175562 1:107151443-107151465 CTGCTCCCTCAGAGTCATTATGG + Intronic
912651136 1:111440701-111440723 CTTCTTCCTCAGAGTGAGCTGGG + Exonic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
916211862 1:162366223-162366245 TTGCATGCTCAGAGTGTGTGTGG + Intronic
916573292 1:166045820-166045842 CTTCTCACTCAGAGTGAGCAGGG - Intergenic
917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG + Exonic
917964340 1:180169047-180169069 CTGTTTGCTCATAGTGACAAGGG - Intronic
918084554 1:181234781-181234803 CAGCTGGCTCAGAGTGAATGAGG - Intergenic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
918453659 1:184685333-184685355 CTGCATTCTCACAGTGAGTTTGG + Intergenic
920734852 1:208524016-208524038 CTGCATCTTCAGAGTGAGTCAGG - Intergenic
1063558360 10:7102403-7102425 CTTTTAGCTCAGTGTGAGTAAGG + Intergenic
1067717281 10:48699226-48699248 CTGCTGTCTCAGAGTGGCTATGG - Intronic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1070331047 10:75417577-75417599 CACCTGGCTCAGAGTGAGGAGGG - Intergenic
1072206860 10:93212417-93212439 CTGCTAGTTCAGAGTGAGAGTGG - Intergenic
1073130371 10:101184886-101184908 CGGCTTGCAGAGAGTGAGTGAGG + Intergenic
1074573790 10:114649595-114649617 CTGCTTTCTGAGATTGAGAAAGG + Intronic
1076329556 10:129654487-129654509 ATGCAGGCTCAGAGTGAGCAGGG - Intronic
1076824913 10:132962026-132962048 CTGCTTCCTCCGCGTGAGGAGGG + Intergenic
1078798387 11:14617080-14617102 CTGCCTGCTGAGAGTGGGTGTGG + Intronic
1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG + Intronic
1083777131 11:64899546-64899568 CCACTTGCTCAGAGTGAGCCAGG - Intronic
1084953087 11:72677383-72677405 CTGCATGCTCCGTGGGAGTAGGG - Intergenic
1086575891 11:88338525-88338547 CGGCTTGCCCAGGGTGAGAAGGG + Intergenic
1087052886 11:93904254-93904276 CTGTTTGCTCAGACTGACTTTGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1093985790 12:25531075-25531097 CTGCATGCTGACAGTTAGTAAGG + Intronic
1097879159 12:64671417-64671439 CAGAAGGCTCAGAGTGAGTAAGG - Intronic
1100848356 12:98683262-98683284 CTGCTTCCTCAAAGTAAGTGTGG + Exonic
1102706840 12:114888576-114888598 CTGCATGCTCTGTGAGAGTAGGG + Intergenic
1102930512 12:116858457-116858479 CTGCTTGCTCTCAGAGAGTGGGG - Exonic
1104010935 12:124929475-124929497 CAGGTGCCTCAGAGTGAGTAAGG + Intergenic
1104065185 12:125299943-125299965 GTTCTTGCTCTGAGTGAGGAAGG - Intronic
1106819385 13:33446340-33446362 CTTCTAGCTAAGAGTCAGTATGG - Intergenic
1108276974 13:48820929-48820951 GTGCCTGCACAGAGTGAGTGAGG + Intergenic
1111885833 13:94019066-94019088 CTGCTCTCTCAGAATGAGTTAGG + Intronic
1111953231 13:94727804-94727826 CTGATTTATCAGATTGAGTAAGG - Intergenic
1115742392 14:36402402-36402424 GTGATCGCTCAGAGTGAGTGTGG - Intergenic
1118832855 14:69451158-69451180 TTGCTGGCGCAGAGTGATTAGGG + Intronic
1119173607 14:72553292-72553314 CTGCTGGCGCAGAGTCAGAATGG + Intronic
1121358618 14:93235006-93235028 GTGCTTGCTCAGTGTGGGAAAGG - Intergenic
1121720605 14:96106022-96106044 CTGCTTGCACAGAGTAAGCGGGG - Intergenic
1122539530 14:102490147-102490169 CTGTTTGCTCACAGTGACCAAGG - Intronic
1128719821 15:69940183-69940205 CTGTTTGTTCTGAGTGAGTCTGG - Intergenic
1137269443 16:46893846-46893868 CTGCCAGCTCAGAGGGACTAAGG - Intronic
1138536797 16:57664433-57664455 GTGCTTGGTCAGGGTGAGCAAGG - Exonic
1141566032 16:84902692-84902714 CTGCTGGCTCAGAGGGACTGGGG + Intronic
1141909890 16:87051611-87051633 CTGCTTTCTGAGAGTCAGTTTGG - Intergenic
1145733235 17:27209566-27209588 CTGGTTGCTGAGAGCGACTAGGG - Intergenic
1148109897 17:45138414-45138436 CTGCTTGCTCAGAGGAAAAAAGG - Intronic
1149148775 17:53533484-53533506 CTGCTTGCTTCAATTGAGTATGG - Intergenic
1149661268 17:58335241-58335263 ATTCTTGCTCAGAGGAAGTAGGG + Intergenic
1151179635 17:72317602-72317624 CTTCTGACTCAGAGTGAGGAGGG + Intergenic
1152256778 17:79244561-79244583 CAGCAAGCCCAGAGTGAGTAGGG - Intronic
1153526371 18:5998477-5998499 CTGCTTGCTCAGGCTGAGGGTGG + Intronic
1153833517 18:8943918-8943940 CAGCTTGCTAAGAATGAGTCTGG - Intergenic
1156227540 18:35124010-35124032 CTACTTGCTCAGAGGAGGTAGGG + Intronic
1157156335 18:45270178-45270200 CTGCTTGCTAAGGGCAAGTAGGG - Intronic
1161048309 19:2148973-2148995 CTGCTTTTTCAAAGTGAGTGGGG + Intronic
1161908187 19:7173243-7173265 CTGAATACTCACAGTGAGTAAGG - Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164686372 19:30169120-30169142 CTTCCTGCTCAGAGGGAGGAGGG + Intergenic
1166525562 19:43507678-43507700 CTCCTGGCTCTGAGGGAGTAGGG - Intronic
1167109804 19:47453376-47453398 CTGCCTGCTCAGACTGAGGCAGG + Intronic
926161943 2:10495505-10495527 CGGCTTCCTCAGAGTGTGCAGGG - Intergenic
926343466 2:11923966-11923988 CTGCTTGCTCTGGGAGAGAATGG - Intergenic
928823157 2:35387570-35387592 TTCCTTGCTCTGAGTGTGTATGG + Intergenic
931083269 2:58800039-58800061 CTTCTTGTTCTGAGTGAGTTGGG + Intergenic
931187721 2:59969727-59969749 CTACTTGCTCAGAGGTAGTTTGG - Intergenic
931779450 2:65566778-65566800 CTGCTTGCTCAGATGGATTTGGG + Intergenic
932661981 2:73662984-73663006 CTGCCTGCCCAGAGTGTATAAGG - Intergenic
934464770 2:94251050-94251072 CTCATTGCTGAGAGTGAGGATGG - Intergenic
934557558 2:95295480-95295502 AGGCTTGCTCAGAGTCAGGAGGG + Intergenic
941540746 2:166781197-166781219 CTGCTTATTCACAGTGAGGAAGG - Intergenic
942514995 2:176742515-176742537 CTGCTGTCTCTCAGTGAGTATGG - Intergenic
944463751 2:199979645-199979667 TTGTTTGCTCAGAGTGACCATGG + Intronic
945989319 2:216380446-216380468 CTGCCTACTCAGAGTGAGGCTGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
1169421796 20:5466425-5466447 CTGCTTCCCCAGGGTGAGTGAGG + Intergenic
1170553626 20:17498270-17498292 CAGCTTTCTTAAAGTGAGTAGGG + Intronic
1172026213 20:31950695-31950717 CTGCTTAATCACAGTGTGTAGGG - Intronic
1173922295 20:46755430-46755452 GTTCTTGCTCTGAGTGAGTGAGG - Intergenic
1180611284 22:17099849-17099871 CTGCTGGCCCAGGGTGAGTGGGG + Intronic
1182196438 22:28523438-28523460 ATGACTGCCCAGAGTGAGTATGG - Intronic
1182365502 22:29776108-29776130 CTGCTTGCTCAGAGTTATGTGGG - Intergenic
1182605157 22:31497050-31497072 CTGCGGGCTCAGTGGGAGTAAGG - Intronic
1184058091 22:42066029-42066051 CGGCTTGCTCAGGATGAGGAGGG + Intronic
1184357949 22:43995275-43995297 CTTCTTGCTCAGAGTCAGGTTGG + Intronic
952506210 3:34008937-34008959 CAGCTTGTTCAGAGTGAGGGTGG + Intergenic
953632044 3:44626341-44626363 CTTCATGCTCAGAGTGAAAAAGG + Intronic
960050606 3:113235513-113235535 CTACTTGCTCAGAGGGAAAAAGG - Intronic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
968058583 3:195711660-195711682 CTGCTGGCTCAGGGTGGGGAAGG - Intergenic
968488848 4:879046-879068 CGGCTTTCTCAGAGTCAGTGCGG + Intronic
969900652 4:10345996-10346018 CTGCTTGGTCAGTTTTAGTAGGG + Intergenic
972719781 4:41684506-41684528 CAGCTTGCTCAGGGTAAGAATGG + Exonic
972810036 4:42573763-42573785 CTTACTGCTCAGAGTGAGTGGGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974247818 4:59343990-59344012 CTGTTTGCACAAAGTGACTAAGG + Intergenic
975383404 4:73727955-73727977 CTGAATGCTCAGAGTCAGTGAGG - Intergenic
977510328 4:97953754-97953776 CTTCTTCCTCAGAGTGTGAAAGG - Intronic
977833535 4:101620280-101620302 CAGCTTGCTCACAGTGGGTGAGG + Intronic
978198041 4:105993249-105993271 CAGCTTGGTCAGAGTCACTAAGG + Intronic
978244469 4:106556404-106556426 GTGCTTGCCCAGAGAGAGTGAGG - Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
987141031 5:14946548-14946570 TAGCTTGCTCGGAGTGATTAAGG + Intergenic
993180784 5:84549243-84549265 GGGCTGGCACAGAGTGAGTAAGG - Intergenic
993356272 5:86912644-86912666 CTGCCTGCCAAGAGTTAGTAGGG + Intergenic
993603647 5:89959739-89959761 GTGGTTGCTAAGAGTTAGTAGGG - Intergenic
996932976 5:128913124-128913146 CTGCTAGCTGGGAATGAGTAAGG + Intronic
1004082057 6:12404457-12404479 CTGCCTGGTCAGAGTGAGTCAGG + Intergenic
1007714460 6:43847690-43847712 CTGCTTGCTCTGAGAGATTAGGG + Intergenic
1007736666 6:43986359-43986381 CAGCATGCTCACAGTCAGTAAGG - Intergenic
1007796504 6:44352861-44352883 CTGCTTACGTAGAGTAAGTAAGG + Exonic
1010824262 6:80453561-80453583 CTCCTTGCTCAGAGTTAGGCAGG - Intergenic
1015510151 6:134030408-134030430 CTCCTTACTCAGAATGAGTAAGG - Intronic
1016219612 6:141651578-141651600 TTGTTTGCTCAGAGTGAACATGG - Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1017478230 6:154821712-154821734 TAGCTTGCGCAGAGTGAGTGAGG + Intronic
1017532180 6:155306194-155306216 ATGCTTGCTCAGACTTGGTATGG - Intronic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017818568 6:158032434-158032456 CTCCTCCCTGAGAGTGAGTATGG + Intronic
1021253868 7:18365161-18365183 CTGTTTGCTGGGAGTAAGTAGGG + Intronic
1021284815 7:18768365-18768387 CTGCTTACCCAGAGGGAGTGGGG - Intronic
1023604951 7:41921551-41921573 CTGCCTGCTCTGAGTCAGAATGG - Intergenic
1024445761 7:49476622-49476644 CTGGTTTCACAGAATGAGTAAGG + Intergenic
1031208810 7:118795613-118795635 GTGCTAGCTCAGGGTGAGCAGGG + Intergenic
1032107938 7:129050511-129050533 CTGGTTGCTCAGAGTCAGAGAGG - Intronic
1032321924 7:130893542-130893564 CAGCTTACTCAGTTTGAGTAAGG - Intergenic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1047808694 8:128384464-128384486 CTGCTTGCTCAGAATCACCAAGG - Intergenic
1048357096 8:133662615-133662637 CTGCTTGTTGAAAGTAAGTATGG + Intergenic
1050023775 9:1311831-1311853 CTGCATGCTCAACTTGAGTAAGG + Intergenic
1058427896 9:104891600-104891622 CTGCATGATCAGAGTGAGACTGG + Intronic
1059322334 9:113479529-113479551 CTGCTGCTTCACAGTGAGTACGG + Exonic
1060869324 9:127027021-127027043 CTCCTGGCTCAGAGTCATTAAGG - Intronic
1185462251 X:338768-338790 CTCCCTGCTCAGGGTGAGTGCGG - Exonic
1186207597 X:7216644-7216666 CTGCTCACTCAGACTGAGGATGG + Intergenic
1186873459 X:13794441-13794463 CTCCTGGCTCAGAGTGAGACTGG - Intronic
1189684776 X:43552461-43552483 CTTCTGGCTCAGTGTCAGTAAGG + Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1194392372 X:93335940-93335962 CTAGATGGTCAGAGTGAGTAGGG - Intergenic
1194598363 X:95888324-95888346 ATTCTTTCTCAGAGTGAGCATGG + Intergenic
1195221496 X:102748445-102748467 AAGCTTGCTGAGAGTGAGAAAGG - Intronic
1195475172 X:105277166-105277188 CTGCCTGCTCATAGTGAACATGG - Intronic
1196753628 X:119139150-119139172 CTGCTTCTTCAGAGGGAGTGGGG + Intronic
1199508118 X:148589254-148589276 CTGCTTTATCAGAGTGTGAAAGG - Intronic
1201579428 Y:15495315-15495337 CTGCTCACTCAGACTGAGGATGG + Intergenic