ID: 962317596

View in Genome Browser
Species Human (GRCh38)
Location 3:134368493-134368515
Sequence AAGGTTAAACAGCTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962317596_962317602 5 Left 962317596 3:134368493-134368515 CCCTGCTCCAGCTGTTTAACCTT 0: 1
1: 0
2: 1
3: 26
4: 298
Right 962317602 3:134368521-134368543 AGTGCCTCAGCCCCACAGACTGG 0: 1
1: 0
2: 0
3: 15
4: 215
962317596_962317608 29 Left 962317596 3:134368493-134368515 CCCTGCTCCAGCTGTTTAACCTT 0: 1
1: 0
2: 1
3: 26
4: 298
Right 962317608 3:134368545-134368567 CATTGCTCTGTTGCATCATGAGG 0: 1
1: 0
2: 1
3: 14
4: 134
962317596_962317609 30 Left 962317596 3:134368493-134368515 CCCTGCTCCAGCTGTTTAACCTT 0: 1
1: 0
2: 1
3: 26
4: 298
Right 962317609 3:134368546-134368568 ATTGCTCTGTTGCATCATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 153
962317596_962317603 6 Left 962317596 3:134368493-134368515 CCCTGCTCCAGCTGTTTAACCTT 0: 1
1: 0
2: 1
3: 26
4: 298
Right 962317603 3:134368522-134368544 GTGCCTCAGCCCCACAGACTGGG 0: 1
1: 0
2: 2
3: 20
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962317596 Original CRISPR AAGGTTAAACAGCTGGAGCA GGG (reversed) Intronic
900390079 1:2430004-2430026 ACAGAGAAACAGCTGGAGCATGG + Intronic
901387744 1:8922146-8922168 AAGGGGACAGAGCTGGAGCAGGG - Intergenic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902741064 1:18438345-18438367 AGGGTTAAACACATGGATCAAGG - Intergenic
902741446 1:18441337-18441359 GAGGTTAAACAACTGGCCCAGGG - Intergenic
902844311 1:19097629-19097651 AAGGTTACACAGCTTGTTCAAGG + Intronic
903222797 1:21878336-21878358 AAGGTTCATGAGCTGGGGCAGGG + Intronic
904282250 1:29428852-29428874 AAGGTCACACAACTGGTGCATGG - Intergenic
904282994 1:29434353-29434375 AAGGTCACACAGCTGGTCCATGG + Intergenic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
905769577 1:40628916-40628938 AAGGTTTACCTGCTGGAGAATGG - Exonic
905843278 1:41204137-41204159 AAGGTTACACAGTTGGTACATGG + Intronic
906463918 1:46059009-46059031 AAGGTGAAACAACTGAATCATGG + Intronic
907211386 1:52825986-52826008 AAGGTTAAAAAGAGGTAGCAGGG + Exonic
907664815 1:56425431-56425453 AAGGTCAAACAGCTGGCACATGG - Intergenic
907999117 1:59663222-59663244 GAGGTCAAACAGCTAGAGTATGG + Intronic
910148946 1:84117965-84117987 AAGCATGAACAGCTGCAGCAAGG - Intronic
911000332 1:93158209-93158231 AAGGTTACACAGCTAGTGAACGG - Intronic
912394315 1:109328947-109328969 CAGGTGAAACACCTGGAGCCCGG - Intronic
912665791 1:111578329-111578351 AAGGTTACACAGCTAGATCAAGG + Intronic
912771054 1:112464713-112464735 CAGGTTTGACGGCTGGAGCAAGG + Intergenic
912887359 1:113488958-113488980 AAGGGAATGCAGCTGGAGCAGGG - Intronic
913969062 1:143400528-143400550 AAGGTATGACAGCTGGATCAGGG - Intergenic
914063439 1:144226127-144226149 AAGGTATGACAGCTGGATCAGGG - Intergenic
914115711 1:144740227-144740249 AAGGTATGACAGCTGGATCAGGG + Intergenic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917428672 1:174942549-174942571 AAGGTTAAATAGCTTGCCCAAGG - Intronic
917637023 1:176947146-176947168 GAGGTTAATCAGCTGGCCCAAGG - Intronic
917759139 1:178136327-178136349 AAGATTAAGCAGCTGGTCCACGG - Intronic
918626465 1:186661122-186661144 AGGGTTAAACAGCAGCAGGAAGG - Intergenic
920931472 1:210393059-210393081 AAGGTTACACAGCTTGAGAGTGG - Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
923231039 1:231986674-231986696 AATGTGAAACAGATGAAGCAGGG - Intronic
923343230 1:233025176-233025198 GAGGTCAAACACCTGCAGCATGG + Exonic
923646468 1:235826375-235826397 AAGATTAAACAGCAGGTGAATGG + Intronic
1066045718 10:31594043-31594065 AACCTTAAATAGCTGGACCAAGG - Intergenic
1067468982 10:46522778-46522800 AAGGTTACACAGCTGGCAAAGGG + Intergenic
1070298588 10:75186253-75186275 AAGACTAAACACCTGGAGAAGGG - Intergenic
1071809569 10:89164726-89164748 AAGGGAAAAGAGTTGGAGCAAGG + Intergenic
1072188042 10:93060798-93060820 AGGGTTAAACGACTGGAGGAGGG + Intergenic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1079168704 11:18071209-18071231 AAGGAAAAACAGCTGGAGAGAGG + Intronic
1079385377 11:19974293-19974315 AAGGATGAATAGGTGGAGCATGG + Intronic
1080230800 11:30016637-30016659 AAGCTGCAACAGCTGGAGGAGGG + Exonic
1080649116 11:34208961-34208983 AAGAGTACAAAGCTGGAGCAAGG - Intronic
1081087454 11:38819427-38819449 AAGGGGAAAGAGCTGTAGCAAGG - Intergenic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1081894650 11:46574802-46574824 AAGGTTATACAGCTGGCAAATGG - Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1084077725 11:66794449-66794471 AAGGTTAAACAGCTTGTCCAAGG - Intronic
1085211917 11:74788989-74789011 AAGGTTACAGAGCTAGTGCATGG - Intronic
1085430241 11:76441832-76441854 GAGGTTAAATAGCTGGCCCAAGG - Intergenic
1085651809 11:78274933-78274955 AAGGTCACACAGCTAGAACACGG - Intronic
1085717248 11:78883355-78883377 ATGGCTAAACAGCTGGAGAGTGG + Intronic
1085997731 11:81941251-81941273 AAGTTTAAAAAGCTATAGCATGG - Intergenic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1087122658 11:94590943-94590965 AGGGTTACACAGCTGGAGCCAGG - Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1090203469 11:124872122-124872144 CAGGTTAAACAGCTTGTTCAGGG + Intronic
1090452234 11:126817129-126817151 AAAATTAAGCAGCTGGACCATGG + Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093234383 12:16588497-16588519 AAGGTAAAACAGGGAGAGCATGG + Intronic
1093657895 12:21718062-21718084 AAAGTTAAGTACCTGGAGCAAGG - Intronic
1094029256 12:25992364-25992386 AAGGTTAAATAACTGGCCCAGGG - Intronic
1094261586 12:28506714-28506736 AAGGTTAGATAGCTTGTGCAAGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095246034 12:39922525-39922547 AAGGATAAACAGCTGAAAAATGG + Intronic
1095490998 12:42733786-42733808 AAGGTTAAGCAACTGGGCCATGG + Intergenic
1095801646 12:46275211-46275233 AAGGTGATACAGCTGGAAAAAGG + Intergenic
1096226799 12:49871237-49871259 AAGGTTACACAGCTGGAAAGTGG + Intronic
1097709583 12:62903269-62903291 AAGATAAAACAGCTGGTGAAGGG + Intronic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1098602635 12:72350478-72350500 TAGGTTAAACAGCTTGTCCAAGG + Intronic
1098613622 12:72494177-72494199 AAGGTTATACAGCTAGTGAATGG + Intronic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101791445 12:107931263-107931285 AAGGTTACACTGCTGGCACAGGG - Intergenic
1101854537 12:108431297-108431319 AAGGTTGAACAGCTGGAAACAGG + Intergenic
1104172569 12:126296415-126296437 AAGGTTACACAGCTGGTGGGTGG + Intergenic
1107281635 13:38743092-38743114 AAGGTGGATGAGCTGGAGCATGG - Intronic
1107500761 13:40972742-40972764 AAAGTTACACAGCTAGAGCCAGG + Intronic
1108638044 13:52355711-52355733 GAGGTTAAATAGCTGGTCCAAGG - Intergenic
1108693624 13:52882935-52882957 AAGGTTAAATAGCATAAGCAAGG - Intergenic
1109000685 13:56799868-56799890 AAGTTTTAACACCTGGATCATGG + Intergenic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111721798 13:91955750-91955772 AATTTTAAGCAGCTGCAGCATGG + Intronic
1111873058 13:93858630-93858652 AAGTTTAAAAACCTGTAGCACGG + Intronic
1111986683 13:95073055-95073077 AACTTTAAACAGATGGAGGAAGG + Intronic
1112568504 13:100571669-100571691 AAGGTCACACAGCTGAAACACGG - Intronic
1113374057 13:109747538-109747560 AAGGTTAAACACCTTGCTCAGGG - Intergenic
1115080082 14:29440062-29440084 AAGTTTAAACAGCTTGCCCAGGG + Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1117160095 14:52980921-52980943 AAGTTTAAACAGATGGGGCTGGG - Intergenic
1117248859 14:53915269-53915291 AAGGTTCCACAGCTGAAACATGG + Intergenic
1117791128 14:59343276-59343298 AGGGGTTAACAGCTGGACCAGGG + Intronic
1118800785 14:69187639-69187661 AAGGCGGAATAGCTGGAGCAAGG - Intergenic
1118975918 14:70676659-70676681 AAAGTTAAACAACTGCACCAGGG - Intergenic
1119327305 14:73768286-73768308 AAGGTTAAACAGCTCTGCCAAGG + Intronic
1119769458 14:77211320-77211342 GAGGTTAAACAACTGGCTCAAGG - Intronic
1120038279 14:79723367-79723389 AAGGTTAAATAGCTGGGCCATGG - Intronic
1120091742 14:80340389-80340411 AAGGGTATACAGCTGTAGGAGGG - Intronic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1120808419 14:88777673-88777695 AAAGTTAAAAAGCAGGAGGATGG + Intronic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121531110 14:94654178-94654200 AAGGTTACACAGCTAGACAACGG - Intergenic
1121740118 14:96245995-96246017 AAGGTTCTACAGCTGTAACATGG + Intronic
1123432799 15:20232723-20232745 AAGGTTACACAGCTTGTGAACGG + Intergenic
1124517138 15:30376282-30376304 AAAGTTAAACAGCTGCAGTGTGG + Intronic
1124725806 15:32154712-32154734 AAAGTTAAACAGCTGCAGTGTGG - Intronic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128546527 15:68572319-68572341 AACGTGAAACAGCTCCAGCAAGG - Intergenic
1128723806 15:69973069-69973091 AAGGTTAAAGAGCTTGTCCAAGG - Intergenic
1129060795 15:72859061-72859083 AAGGCTAAGGAGCTGCAGCAAGG + Intergenic
1129157630 15:73728663-73728685 GAGGTGAAATAGCTGGTGCAAGG + Intergenic
1130885426 15:88088843-88088865 AGGGTCACACAGCTGGAGAACGG - Intronic
1132186196 15:99803989-99804011 AAGGTCACACAGCTGGAGGGTGG + Intergenic
1132429477 15:101748714-101748736 AAGGTCACACAGCTGGAGGGTGG - Intergenic
1133261506 16:4553899-4553921 AAGATTCCACAGCTGGTGCAAGG + Intergenic
1133337904 16:5018041-5018063 AAGGTTACACAGCTAGTGAAAGG - Exonic
1133999580 16:10772264-10772286 AAGGTCACAGAGCTGGAGCGTGG + Intronic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1136137723 16:28267446-28267468 AAGGTTAAGAAGCTTGAGAAGGG - Intergenic
1137011939 16:35330060-35330082 AAGATTAAACAGTTAGAACATGG - Intergenic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1141173616 16:81705539-81705561 CAGGTTCAGCACCTGGAGCATGG - Exonic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141675927 16:85517312-85517334 GAGGTTAAGCAGCAGGACCAAGG - Intergenic
1143758896 17:9087095-9087117 AAGGTTACACAGTTTGACCAAGG + Intronic
1143966974 17:10762420-10762442 AAGGCTAACCTACTGGAGCATGG + Intergenic
1144260248 17:13511661-13511683 TAGATGAAACAGCTGAAGCATGG + Intronic
1146118672 17:30168180-30168202 AAGGACAAACAGCTGGTGAATGG - Intronic
1148358607 17:46993902-46993924 AAGGTCACACAGCTGGTCCATGG + Intronic
1148397211 17:47318669-47318691 AATGTAAAACAGCAGGGGCAGGG + Intronic
1150788004 17:68178232-68178254 AAGGTCACACAGCTGGTCCATGG - Intergenic
1153275202 18:3360979-3361001 AAGGTTCCACAGCTGGCTCATGG - Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1156223090 18:35074254-35074276 AAAGTTATACAGCTTGGGCAGGG + Intronic
1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG + Intergenic
1159592860 18:70353712-70353734 AATGCTAAAAAGCTGGAACAAGG + Intergenic
1160360710 18:78274567-78274589 AGGGATGAACAGCTGAAGCATGG - Intergenic
1162110014 19:8394974-8394996 AAGGCTGTACAGCTGGGGCAAGG + Intronic
1165029046 19:32984096-32984118 AAGGTTACACAGCTTGTGAACGG + Intronic
1165394430 19:35556617-35556639 AAGTTTGAGCTGCTGGAGCAGGG + Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165733257 19:38159688-38159710 GAGGTTAAGCAGCTGGTCCAAGG - Intronic
1168368556 19:55811461-55811483 AATGATGAACAGCTGCAGCAGGG + Intronic
1168513381 19:56991305-56991327 AAGGTCAGACAGCTTGAGAACGG + Intergenic
1168586359 19:57596740-57596762 AGGGATGAACAGGTGGAGCACGG + Intergenic
927054186 2:19354923-19354945 AAGGTTGGAGAGCTTGAGCAAGG + Intronic
927849041 2:26487460-26487482 AGGCTTAAACAGCTGGTCCAGGG - Intronic
928486283 2:31735724-31735746 AAGGTTCCACAGCTGGTGAATGG + Intergenic
928661137 2:33502813-33502835 AAGGTTAAAGAGTTAGAGGAAGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
932859616 2:75276277-75276299 AAGGTCACACAGCTAGTGCATGG + Intergenic
933804405 2:85987683-85987705 AAAGTCACACAGCTGGAGCCAGG - Intergenic
934173763 2:89561448-89561470 AAGGTATGACAGCTGGATCAGGG - Intergenic
934284077 2:91635797-91635819 AAGGTATGACAGCTGGATCAGGG - Intergenic
934573782 2:95388041-95388063 AAGGTCACACAGCTGGTGAATGG - Intergenic
935181426 2:100694145-100694167 AAAGCAAAACAACTGGAGCAAGG + Intergenic
937583748 2:123521374-123521396 ACAGATAAAAAGCTGGAGCACGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939332507 2:140782921-140782943 AAGGTCACACAGCAGGAGTATGG + Intronic
939464343 2:142538534-142538556 AAGGTTAAACACCTGGGTCTGGG + Intergenic
940294061 2:152104283-152104305 CAGGTTGAATAGGTGGAGCATGG + Intergenic
942069933 2:172307052-172307074 AGGGTAAAAGGGCTGGAGCATGG - Intergenic
943879502 2:193122268-193122290 AAGGTTAAACATGGCGAGCATGG + Intergenic
945392040 2:209276235-209276257 AAAGTTTTACAGCGGGAGCAAGG - Intergenic
945858704 2:215096082-215096104 AAGATTAAACAGCTGGTAAACGG - Intronic
946560767 2:220910208-220910230 CATTTTAACCAGCTGGAGCAGGG + Intergenic
948494607 2:238339321-238339343 AAGGTGACTGAGCTGGAGCAGGG + Intronic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169203167 20:3725023-3725045 AAGGATGAATAGGTGGAGCACGG + Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1172416881 20:34776635-34776657 AAGGTTAAATAGCTCGTTCATGG - Intronic
1172590974 20:36117653-36117675 AAGGTTACACAGACAGAGCAGGG + Intronic
1172931628 20:38590801-38590823 AAAGCTCATCAGCTGGAGCAAGG - Intergenic
1172953946 20:38742088-38742110 CAGGTTAAGTAGATGGAGCAGGG - Intergenic
1173430186 20:42980972-42980994 GAGGTTAAAAAGTTGGAGAAAGG - Intronic
1174076433 20:47940776-47940798 GAGGTGAAACACCTGGACCAAGG - Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174126453 20:48310487-48310509 AAGGTCGCACAGCTGGAGAACGG - Intergenic
1174799536 20:53551637-53551659 AAGGTTATAAAGCTGGCGCATGG - Intergenic
1174834220 20:53840701-53840723 ATGGTTAAATAGCTGGAAAATGG + Intergenic
1175159077 20:56994637-56994659 AAGGTCACACAGCTGGAAAAAGG - Intergenic
1177058435 21:16339067-16339089 TAGGATAATTAGCTGGAGCATGG + Intergenic
1178581997 21:33845549-33845571 AAGGTTAGAGGGCTGGAGAAGGG - Intronic
1182111792 22:27728952-27728974 GAGTTTCAACAGCTGGAGAAAGG - Intergenic
1182469134 22:30536607-30536629 AAGGTTAAACCACTTGACCAAGG - Intronic
1183225296 22:36545806-36545828 AAGGTCACACAGCTTGAGTATGG + Intergenic
1183341917 22:37286298-37286320 AAGGTGACACAGCTGGAGGGTGG - Intronic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
949473029 3:4416597-4416619 AAGGTTACACAGCTGGAAAGCGG - Intronic
949842777 3:8338142-8338164 GAGGTTTAACAGCAGGAGCCTGG + Intergenic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
953328390 3:42031870-42031892 AAGATTAAACAGCTGATCCAAGG + Intronic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954766471 3:52922073-52922095 GAGGTTATACAGCTTGAGCAAGG - Intronic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
955795963 3:62637245-62637267 AAGGTTACCCAGCTGGTGAACGG + Intronic
956481360 3:69677004-69677026 AAGATTATACAGCTGGTGCAGGG - Intergenic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
956737053 3:72246019-72246041 GAGGTTAAACAGCCGGCCCAGGG - Intergenic
956856129 3:73276573-73276595 AAGGTCACACAGCTGGAAAACGG + Intergenic
957250901 3:77769813-77769835 AAGGTTAAAGAGCTTGAGAGAGG - Intergenic
960046589 3:113204555-113204577 AATGTCAAACAGCTGGAGTCTGG + Intergenic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
960516192 3:118605099-118605121 AGGGTTACACAGCTGGATAAAGG - Intergenic
961399656 3:126629452-126629474 TAGGTTCAACAGTTGGAGAAAGG - Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962869346 3:139474697-139474719 AAGGTTAAAAAACTGGTTCACGG + Intronic
963254261 3:143129357-143129379 AAGGTCACACAGCTAGTGCATGG + Intergenic
964221664 3:154353790-154353812 AAGATTTAATAGCTCGAGCATGG - Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
969201120 4:5606913-5606935 AAGGTCACACAGCTAGAACATGG + Intronic
969629810 4:8329567-8329589 AAGGTCTCACAGCTGGAGGAGGG - Intergenic
971223160 4:24727434-24727456 AAGGTTAAACACCTGCTGCAGGG + Intergenic
971340151 4:25760939-25760961 AAGGTTACACAGCTGGAAAGTGG + Intronic
973199579 4:47485163-47485185 TCGGTCAAACAGCTGGAGCTGGG + Intergenic
974047775 4:56911664-56911686 GAGGTTAAACAACTTGTGCAAGG - Intronic
974076124 4:57170153-57170175 GAGGTCAAACTGATGGAGCATGG + Intergenic
974660160 4:64877469-64877491 AAGGTGAAAAAGCTGCAGAAGGG - Intergenic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979633330 4:122928267-122928289 AAGGAGAAACAGCTGAAACAAGG - Intronic
981634298 4:146858244-146858266 AAGGTCACACAGCTAGTGCATGG + Intronic
981714367 4:147738208-147738230 AAAGCTAAGCAGCTTGAGCAAGG - Intronic
981968301 4:150633765-150633787 AAGGTTATATAGCTGGAACGTGG - Intronic
983948195 4:173609603-173609625 AAGGTCAAACAGCAGAAACACGG - Intergenic
984182347 4:176499153-176499175 AAGGTTACACAGCTGGTGAGTGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
987018238 5:13843182-13843204 AAGGCTGAACAGCTGTAACAAGG - Intronic
988901153 5:35733859-35733881 GAGGTTAAACAGCTTGTACAAGG - Intronic
991982454 5:72247007-72247029 AAAGTTAAACAGCTAGTTCAGGG - Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
993615645 5:90108614-90108636 AAGGTAACACAGCTGTTGCATGG + Intergenic
994475839 5:100267861-100267883 TTGGTTAAACAGCTTGTGCATGG + Intergenic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
996414185 5:123191881-123191903 CAGGTTAAACATCTGTGGCAAGG - Exonic
996514650 5:124356428-124356450 AAAGTTAAACAGTAGAAGCAAGG + Intergenic
997424417 5:133793521-133793543 AAGGTCTCACAGCTGGAACATGG + Intergenic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG + Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1002315394 5:178340094-178340116 AAGGTCAAACAGCTAGAGACAGG - Intronic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006653965 6:35574442-35574464 ACGGGTAAACAGATTGAGCATGG - Exonic
1007147982 6:39656581-39656603 CAGGTTAAACAGCTAGAGAAAGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007287673 6:40759339-40759361 AAGGTTAATGAGCTGGAGGAGGG + Intergenic
1007605065 6:43112022-43112044 AAGGATAAACAGCTTGTCCAAGG + Intronic
1010739912 6:79489083-79489105 GAGGTTGAAAAGCTGGAGGATGG - Exonic
1012723442 6:102778845-102778867 TAGGTTAACCAACTGGACCATGG - Intergenic
1013959345 6:115880327-115880349 GAGGTTAAGCAACTGGACCAAGG + Intergenic
1013984725 6:116176706-116176728 AGGCTTAAGCAGCTGGAGGAAGG - Intronic
1015757068 6:136618356-136618378 TAGCTTGAACAGCTGGTGCAGGG - Intronic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1020131020 7:5558719-5558741 AAGGTCAAGCAGCTTGACCAAGG + Intronic
1022291703 7:29010933-29010955 AAGGTCATACAGCTGGTACATGG + Intronic
1022594264 7:31697115-31697137 CAGGTAAAAAAGCTGGTGCAGGG + Exonic
1023925480 7:44666246-44666268 AATGTCAAAAAGCTGGAGGAGGG - Intronic
1024291200 7:47805793-47805815 AAGGTTAAGCAACTGGCTCAAGG - Intronic
1024472841 7:49781539-49781561 AAAGTTAAATAGCTTGATCAAGG + Intronic
1026369160 7:69681516-69681538 AAGGTCATACTGCTGGACCAGGG + Intronic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1030687746 7:112504236-112504258 AGTGCTAAACAGCTGCAGCATGG - Intergenic
1030757186 7:113301320-113301342 AGGGTTGAACAGATGAAGCACGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032779463 7:135152192-135152214 AAGGTCACACAGCTGGTGAATGG + Intronic
1034219919 7:149436274-149436296 GAGGTTAAATAGATGGGGCAAGG - Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034352152 7:150423675-150423697 AGGGATAAATAGGTGGAGCACGG - Intergenic
1035959883 8:4125379-4125401 AAGGTGGGACAACTGGAGCAGGG - Intronic
1037330554 8:17739617-17739639 AATGTTAAACAGCTGGAAAGTGG - Intronic
1037463525 8:19136818-19136840 AAGGCCACACAGCTGGAGAAGGG - Intergenic
1038799357 8:30735239-30735261 AAAATTAAACAGCTGGTGAATGG + Intronic
1039525335 8:38209669-38209691 AAGGTTAAAAACCTCAAGCAAGG - Intronic
1040360481 8:46659544-46659566 AAGGTTAAAGATCTTGAGCTGGG - Intergenic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1041584065 8:59495554-59495576 GAGGATAAAAATCTGGAGCAGGG - Intergenic
1041986707 8:63930573-63930595 AAGGTCAAACTGATGGCGCAAGG + Intergenic
1044034688 8:87285914-87285936 AAGATGAAACAGCAGGATCATGG - Intronic
1044519406 8:93180325-93180347 AAGGTAAGACATCTGGAACACGG - Intergenic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047697866 8:127420704-127420726 AAGGTTAAGTAGCTTGTGCAAGG + Intergenic
1048866744 8:138767043-138767065 AAGGTCACACAGCTGGAGCGTGG - Intronic
1048923201 8:139249058-139249080 AAGGTTAAATAGTAGGTGCAAGG + Intergenic
1049808982 8:144554839-144554861 ACGATTGAACAGCTGGAGCTTGG - Intronic
1050668193 9:7965691-7965713 AGGGTTAAAAAGCAAGAGCAAGG - Intergenic
1051804143 9:20972852-20972874 AAGGTAAAATAGCTGCAGAAAGG - Intronic
1051804170 9:20973163-20973185 AAGGTTAAATAGCTGCAGAAAGG - Intronic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1052875071 9:33553210-33553232 AAAATTAAACAGCTGGGGCATGG + Intronic
1053500948 9:38591114-38591136 AAAATTAAACAGCTGGGGCATGG - Intergenic
1054740867 9:68804527-68804549 AAGGTCATACAGTTGGAGCCAGG - Intronic
1054990174 9:71316456-71316478 AAGGTTAAGGACCTGGAGAAAGG + Intronic
1056261179 9:84850454-84850476 AAGGTGATAAAGCTGGAGCCAGG + Intronic
1057686942 9:97243248-97243270 AAGGTTAAACAAGTGGAGAGAGG + Intergenic
1057955091 9:99401051-99401073 AAGTTGAAACAGCTGGGGGAGGG - Intergenic
1058551206 9:106117029-106117051 AAAGTTAAGCAGCTGGCTCAGGG - Intergenic
1059522836 9:114959879-114959901 CAGGTTAAACAGCTTGACCAAGG - Intergenic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1059928711 9:119239634-119239656 AAGGTTTCACAGCTGGAAAAGGG - Intronic
1059984524 9:119809144-119809166 AAGGCTGAACAGCAGGAGAAAGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061530405 9:131207532-131207554 AAGGTTATACAGCTTCAGCATGG - Intronic
1186437311 X:9553535-9553557 AAGTTTAATATGCTGGAGCAAGG + Intronic
1186512809 X:10143189-10143211 AAGTTTCAACAGCTGGGGCCTGG - Exonic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188100302 X:26074196-26074218 GAGGTTAATCAGCTGGTGTAAGG + Intergenic
1188632817 X:32389057-32389079 AAGGACAAACAGCTGGTGAATGG - Intronic
1191671479 X:63752335-63752357 AAGGTCAAACAGCTGCTGAATGG + Intronic
1193614066 X:83666922-83666944 AATGGTAAACAGCTCCAGCAGGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1194431317 X:93810397-93810419 AAGGTTAAGCAACTAGAGCTGGG + Intergenic
1194655075 X:96563145-96563167 AAGGTTATAAAGCTGGTGAATGG - Intergenic
1195705439 X:107734959-107734981 AAGGTCACACAGCTAGAGCTGGG + Intronic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1198587641 X:138140370-138140392 AAGATAATACAGCAGGAGCAAGG + Intergenic
1198596731 X:138244025-138244047 AAGCTGACACAGCTGGAGGAAGG - Intergenic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic