ID: 962318035

View in Genome Browser
Species Human (GRCh38)
Location 3:134370932-134370954
Sequence ACGGCTCCTTCAGTTGTCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962318035_962318037 19 Left 962318035 3:134370932-134370954 CCAGGGACAACTGAAGGAGCCGT 0: 1
1: 0
2: 1
3: 10
4: 73
Right 962318037 3:134370974-134370996 GCCCATGCCTCAGCTCCCGCAGG 0: 1
1: 0
2: 1
3: 18
4: 255
962318035_962318039 20 Left 962318035 3:134370932-134370954 CCAGGGACAACTGAAGGAGCCGT 0: 1
1: 0
2: 1
3: 10
4: 73
Right 962318039 3:134370975-134370997 CCCATGCCTCAGCTCCCGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962318035 Original CRISPR ACGGCTCCTTCAGTTGTCCC TGG (reversed) Exonic
900823069 1:4905002-4905024 TCTGCTCCTTCTGTGGTCCCTGG + Intergenic
901625474 1:10622197-10622219 ACGGCTCCTTCGGGCATCCCTGG + Intronic
906780965 1:48572674-48572696 ACCCCCCCTTCAGTTCTCCCAGG - Intronic
908522216 1:64955370-64955392 AAGGCCCCTTCAAATGTCCCTGG - Intronic
909629848 1:77759832-77759854 GCGGCTCCTTCCGGTGTCTCCGG + Exonic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
922696537 1:227733751-227733773 ACCCCTCCTTCAGTTGGACCAGG - Intronic
1070551025 10:77490936-77490958 AGGGCTCCTACAGTAGGCCCTGG - Intronic
1071948888 10:90680226-90680248 AAGACTATTTCAGTTGTCCCAGG + Intergenic
1074459722 10:113625966-113625988 GCGGCACCTGCTGTTGTCCCTGG + Intronic
1075635432 10:124027245-124027267 ACCGCTCCTCCAGGGGTCCCAGG - Intronic
1077196087 11:1280872-1280894 ACTGTCCCTTCAGCTGTCCCTGG - Intronic
1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG + Intergenic
1084447578 11:69212699-69212721 ACGGTTCCTTCAGGTGGGCCTGG - Intergenic
1084708419 11:70829419-70829441 AAGGCTCCTTCCCTTCTCCCTGG - Intronic
1086073542 11:82825331-82825353 ACGCCTCCTTCAATTATCTCTGG - Intronic
1091779973 12:3207663-3207685 AGGGCTTCTCCAGTTCTCCCGGG - Intronic
1092206563 12:6618152-6618174 ACAGCTCCTTCAGTAATGCCAGG + Intergenic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1102955234 12:117054610-117054632 AGGGGTCCTTCAGCTGCCCCTGG - Intronic
1106356708 13:28990194-28990216 ACAGCTCCTTCCGAAGTCCCAGG - Intronic
1107978320 13:45711601-45711623 CCAGCTCCTTCAGGTGTTCCTGG - Intronic
1108357643 13:49642014-49642036 AGGGCTCATCCAGTTGTCCTAGG - Intergenic
1109208373 13:59506488-59506510 AGGGCTGCTTCAGTTGTGCCAGG - Intergenic
1118440305 14:65806011-65806033 ACTGATCCCTCAGTTGTCACTGG - Intergenic
1121643974 14:95505128-95505150 CCGGCTCCTTCACTTGTGCTTGG - Intergenic
1125487037 15:40118643-40118665 TTGGCTCCTTCAGTGGCCCCTGG - Intergenic
1127871533 15:63078009-63078031 AAGGCTCCTTCAGACCTCCCTGG - Intergenic
1131663678 15:94546326-94546348 AAGGCTCCTTCATTTATGCCTGG - Intergenic
1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG + Intronic
1132858982 16:2060792-2060814 ACGGCTCCTTCAGCAGCTCCAGG + Exonic
1133109140 16:3535248-3535270 ACGACTGCTTCAGTTCCCCCGGG - Intronic
1134453758 16:14379203-14379225 AGGGCTCCTTCCGATGGCCCAGG - Intergenic
1141522824 16:84592822-84592844 ACGGGTCATCCATTTGTCCCCGG + Intronic
1141678254 16:85529098-85529120 GCGGCGCCTGCAGTTGTCCAGGG + Intergenic
1147856605 17:43485130-43485152 AAGGCTTCTTCAGTTGTAACAGG + Intronic
1148834374 17:50458106-50458128 AAGGTTCCTTCTGATGTCCCTGG + Intronic
1151434876 17:74089070-74089092 ACAGCTCCTGCAGTGGTCCAGGG - Intergenic
1158396758 18:57085089-57085111 AAGGCTCTTTCAGTTGTGACAGG - Intergenic
1159038557 18:63300742-63300764 ACGGCTCCTGGAGTTCTCGCTGG - Intronic
1159159543 18:64625405-64625427 GCGCCTCCTTCAGCTGACCCAGG - Intergenic
1163421580 19:17216324-17216346 AGGGCTCCTTCCCTGGTCCCTGG + Intronic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
1167652567 19:50740943-50740965 GCGGCTCCTACTGTTGTCCCAGG - Intergenic
926743240 2:16129374-16129396 AGGACTTCATCAGTTGTCCCTGG + Intergenic
927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG + Intronic
929664082 2:43820331-43820353 ACGGCTCCTTCAGCTCTCATAGG + Intronic
932487358 2:72092291-72092313 ACTGCTCCTTCTGTTCTCCTGGG - Intergenic
934912818 2:98274920-98274942 TCTGCTCCTACAGTTGTCCAAGG - Intronic
935319641 2:101873435-101873457 ACGGCTCCTGCAGTGGTTCCAGG + Intronic
936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG + Intergenic
936184225 2:110290796-110290818 ACTGCCCCCTCATTTGTCCCAGG - Intergenic
941373849 2:164703118-164703140 ATGGCTGCCTCAGGTGTCCCAGG + Exonic
942689498 2:178570497-178570519 ACAGGTCCTTCAGGTGGCCCTGG + Exonic
946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG + Intergenic
946546509 2:220749740-220749762 AGGGCTCCTGCAGTTTTCCAGGG - Intergenic
946735933 2:222754516-222754538 CCAGCTCCTGCAATTGTCCCTGG + Intergenic
960198592 3:114802588-114802610 TCCTCTCATTCAGTTGTCCCTGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
967602443 3:191405656-191405678 ATGGCACCTTGAGTTGTACCTGG + Intergenic
968054869 3:195683787-195683809 AGGGCTTCTTCTGTTGCCCCTGG - Intergenic
968101041 3:195965485-195965507 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
979356207 4:119708741-119708763 CCTGCTCCTTCAGTGATCCCTGG + Intergenic
979467292 4:121055269-121055291 AAGGCTACTGCAGTTGTCCATGG + Intronic
980739171 4:136928766-136928788 ACCTCTCCTTCTGTTGTTCCTGG - Intergenic
984575109 4:181438717-181438739 ACGGCCCCTCCATCTGTCCCAGG - Intergenic
985502041 5:254428-254450 AGGGCTTCTTCTGTTGCCCCTGG - Exonic
985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
987887595 5:23831506-23831528 TCGGCTCCTTCATTAGTCCAAGG - Intergenic
993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG + Intronic
998123462 5:139598952-139598974 AAGTCTCGTTCTGTTGTCCCAGG + Intronic
1002066183 5:176652931-176652953 GCGCCTCCTACAGGTGTCCCAGG - Intronic
1005495390 6:26383528-26383550 CCGGTTTCTTCAGTTGTCCCTGG - Intronic
1005500074 6:26421826-26421848 CCGGTTTCTTCAGTTGTCGCTGG - Intergenic
1006010838 6:31041839-31041861 GCCGCTCCTTCAGTTGTCTTTGG - Intergenic
1008514680 6:52307638-52307660 AGAGATCCTTCAGGTGTCCCGGG - Intergenic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1019631192 7:2050685-2050707 TCTGCCCCTTCAGTTGTCCTTGG - Intronic
1020771812 7:12404445-12404467 AGAGCTCTTACAGTTGTCCCAGG + Intergenic
1041208144 8:55519341-55519363 ACGATTCCTTCAGTGGCCCCAGG - Intronic
1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG + Intergenic
1059941602 9:119365577-119365599 AAGGCCCCTTCAGTTGTGCAAGG - Intronic
1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG + Intergenic
1199012616 X:142775727-142775749 ACAGCTCTTTCAGTTTCCCCAGG + Intergenic