ID: 962318037

View in Genome Browser
Species Human (GRCh38)
Location 3:134370974-134370996
Sequence GCCCATGCCTCAGCTCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962318035_962318037 19 Left 962318035 3:134370932-134370954 CCAGGGACAACTGAAGGAGCCGT 0: 1
1: 0
2: 1
3: 10
4: 73
Right 962318037 3:134370974-134370996 GCCCATGCCTCAGCTCCCGCAGG 0: 1
1: 0
2: 1
3: 18
4: 255
962318032_962318037 29 Left 962318032 3:134370922-134370944 CCGTTCCTCTCCAGGGACAACTG 0: 1
1: 1
2: 3
3: 30
4: 256
Right 962318037 3:134370974-134370996 GCCCATGCCTCAGCTCCCGCAGG 0: 1
1: 0
2: 1
3: 18
4: 255
962318034_962318037 24 Left 962318034 3:134370927-134370949 CCTCTCCAGGGACAACTGAAGGA 0: 1
1: 0
2: 1
3: 16
4: 140
Right 962318037 3:134370974-134370996 GCCCATGCCTCAGCTCCCGCAGG 0: 1
1: 0
2: 1
3: 18
4: 255
962318036_962318037 0 Left 962318036 3:134370951-134370973 CCGTTCACTCAACGAGCGCACGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 962318037 3:134370974-134370996 GCCCATGCCTCAGCTCCCGCAGG 0: 1
1: 0
2: 1
3: 18
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962318037 Original CRISPR GCCCATGCCTCAGCTCCCGC AGG Exonic
900031819 1:378160-378182 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
900052367 1:606351-606373 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
900117430 1:1034552-1034574 GGCCATGCCTCCGCTGCCGCTGG + Intronic
900140025 1:1135952-1135974 GCCACTGCCCCAGCTCCCGTGGG + Intergenic
900694436 1:4001076-4001098 GCACAAGCCCCAGCTGCCGCAGG + Intergenic
900956552 1:5889645-5889667 GCACAGGCCTCAGCCCCAGCAGG - Intronic
901630088 1:10643704-10643726 GCCCAGGCCCCAGCACCCACGGG + Intronic
902332384 1:15736899-15736921 TCCCATGACCCAGCTCCCACAGG + Intronic
902470555 1:16645453-16645475 GGCCAGGCCTCAGGTCCCACAGG - Intergenic
903219217 1:21859773-21859795 GCCCCTGCCTCCCCTCCCACTGG + Intronic
903366455 1:22808269-22808291 CCCCATTTCTCAGCTCCTGCAGG + Intronic
903890273 1:26565257-26565279 TCCCATCCCTCAGCTCCTGTGGG - Intronic
904001700 1:27342442-27342464 GCCCATGGCCCAGCTCAGGCAGG + Intronic
904622403 1:31783204-31783226 GCCCCTGCCTCTGCTTCCCCAGG - Intergenic
905653715 1:39672643-39672665 GCCCTTCACTGAGCTCCCGCTGG - Intergenic
905911975 1:41661693-41661715 ACCCATTCAGCAGCTCCCGCCGG + Intronic
906239467 1:44233592-44233614 GCCCATCCCTCCACTCCAGCTGG + Intronic
906323715 1:44831666-44831688 GGCCCTGCTTCATCTCCCGCTGG - Intronic
908388631 1:63665515-63665537 GCCCATGCTACAGCTCTCGTGGG + Intergenic
916653172 1:166849554-166849576 GCCCGTGCCCCAGCACCTGCCGG + Exonic
920676852 1:208044068-208044090 GCACCTGCCTCATCTCCCCCAGG - Intronic
922648735 1:227318559-227318581 GCCCGAGCCTCAGCCCCAGCCGG + Intergenic
923592011 1:235327877-235327899 GCCTCTGCCTCAGCAGCCGCTGG - Exonic
923790353 1:237106270-237106292 TCCCCTGCACCAGCTCCCGCTGG + Intronic
1064259488 10:13773834-13773856 GCCCATCCATCAGCCCCTGCAGG - Intronic
1069770017 10:70892550-70892572 CCTCCTGCCTCAGCTCCCCCAGG + Intergenic
1070819461 10:79346569-79346591 GTCCAGGCCTCAGCTTCCCCTGG + Intergenic
1071137998 10:82473680-82473702 GCCCAGTCCTCAGCTCCCTTCGG + Intronic
1071514612 10:86289029-86289051 TCCCATGCCTCTTCTCCCACTGG + Intronic
1071552629 10:86578898-86578920 TCCCCTGCCTCAGCTTCCCCAGG + Intergenic
1072650628 10:97292417-97292439 CCCCGCGCCTCAGCCCCCGCAGG + Intronic
1073445092 10:103575687-103575709 GCCCATGCCACAGCCCCAGCAGG + Intronic
1075036632 10:119074807-119074829 TCCCCTGCCTCAGCCTCCGCAGG - Intronic
1075646996 10:124103151-124103173 AGCTATGTCTCAGCTCCCGCTGG + Intergenic
1076497432 10:130906108-130906130 GACCCTGCCACAGCTCCCACCGG + Intergenic
1076861816 10:133141403-133141425 GCCCCTGCCACACCTCCCACAGG - Intergenic
1076948305 10:133665976-133665998 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076949294 10:133669286-133669308 GCCCAGCCCTCAGCCCGCGCCGG - Intronic
1076950278 10:133672585-133672607 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076951263 10:133675884-133675906 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076952253 10:133679194-133679216 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076953241 10:133682504-133682526 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076955209 10:133742155-133742177 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076956199 10:133745465-133745487 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076957187 10:133748774-133748796 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076958176 10:133752084-133752106 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076959160 10:133755383-133755405 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1076960149 10:133758693-133758715 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
1077298381 11:1836412-1836434 GCCGCTGCCTCAGATCCCGCAGG + Exonic
1077365047 11:2158259-2158281 TCACATACCTCAGCTCCAGCAGG + Intronic
1078318029 11:10307902-10307924 GCCCGGGCCTGAGCGCCCGCGGG + Intergenic
1079531092 11:21454719-21454741 CCCCATTCCTCAGCTGCAGCGGG + Intronic
1081743815 11:45459263-45459285 GCCCAGGCCTCAGATGCTGCAGG + Intergenic
1084185453 11:67468768-67468790 GCTCATCCCTCAGCTCCAGCTGG - Intronic
1084564714 11:69922321-69922343 GCCCAGGGCACAGCTCCAGCAGG + Intergenic
1085434990 11:76492650-76492672 GCCCATTCCACAGAGCCCGCAGG + Intronic
1089129823 11:116202903-116202925 GCACAGTGCTCAGCTCCCGCTGG - Intergenic
1089288109 11:117420466-117420488 GCCAATGCCTCACCTCCCCCAGG - Intergenic
1090351564 11:126111510-126111532 GCCCTGGCCACAGCTCCTGCAGG - Intergenic
1095812434 12:46384284-46384306 GCCCATGACTCTGCTCTTGCAGG + Intergenic
1096516724 12:52160216-52160238 GCCCATGCAGCAGCTCTCCCGGG + Intergenic
1097055849 12:56248718-56248740 GCCCCTGCCTCCCCTCCTGCAGG + Intronic
1097240532 12:57572096-57572118 GCAGGTGGCTCAGCTCCCGCTGG - Exonic
1097288518 12:57895665-57895687 GCCTATGCCTCATCCCCAGCAGG + Intergenic
1101311784 12:103587200-103587222 GCCTCTGCCTCAGCCCCTGCAGG + Intergenic
1102950626 12:117028423-117028445 ACCCTGGCCTCAGCTCCCTCAGG + Exonic
1103563428 12:121804160-121804182 GCCCCGGCCTCGGCTCCCTCGGG + Exonic
1103817583 12:123671224-123671246 GCCCATGCCTTAGACCTCGCGGG - Exonic
1105218824 13:18307088-18307110 GCACATCCCTCAGCTCCCTCCGG + Intergenic
1107603805 13:42040148-42040170 GCTCAAGCCTCAGCACCCCCAGG + Intronic
1107744431 13:43489692-43489714 GCCCATGAAGCAGCTCTCGCGGG - Intronic
1107765601 13:43730857-43730879 GCTCAGGCCTCAGCTCCTCCAGG + Intronic
1112323978 13:98431310-98431332 GCCCATGCCACAGTTCAGGCCGG + Intronic
1113877278 13:113602199-113602221 GCTCCTCCCTCAGCTCCTGCGGG - Intronic
1114046424 14:18880470-18880492 GTCGGTGCCTCAGCTCCCGGGGG + Intergenic
1114117788 14:19638980-19639002 GTCGGTGCCTCAGCTCCCGGGGG - Intergenic
1117250165 14:53928732-53928754 TCTCATGCCTCAGCGCCCCCAGG - Intergenic
1120514033 14:85449123-85449145 GCCTATGCCTCAGCTGCAGAGGG - Intergenic
1121965134 14:98296781-98296803 CCCCAACCCTCAGCTCCTGCTGG + Intergenic
1122735004 14:103833532-103833554 TCTCATGCCTCAGCTTCCCCAGG - Intronic
1122921365 14:104881756-104881778 GCCCCTGCCTCAGCAGCCCCTGG + Intronic
1123106558 14:105844549-105844571 GCCCATGCCTCAGCTCAGCGAGG + Intergenic
1123671727 15:22665132-22665154 GGCCCTGCCGAAGCTCCCGCTGG - Intergenic
1124880660 15:33639641-33639663 TCCCATGGCCCAGCTCCCACTGG - Intronic
1125603066 15:40926044-40926066 GCGCGTGCCTCATCTGCCGCAGG - Intergenic
1128548496 15:68583106-68583128 TCTCCTGCCTCAGCTCCAGCAGG + Intronic
1129707244 15:77801791-77801813 ACCCATGCCTACGCTCCCCCAGG + Intronic
1130317774 15:82810507-82810529 GACCCTCCCGCAGCTCCCGCCGG - Intronic
1132602573 16:780189-780211 GCCCCGGCCCCTGCTCCCGCCGG - Intronic
1134060109 16:11194475-11194497 GCTCAAGCCTCAGCTCCCTGGGG + Intergenic
1134767804 16:16776674-16776696 GCCCATGCCCCAGTTTCTGCTGG + Intergenic
1135202472 16:20450430-20450452 GCCCATGCTTCAGCTCTCTCAGG - Intergenic
1135216632 16:20577436-20577458 GCCCATGCTTCAGCTCTCTCAGG + Intergenic
1136476642 16:30517691-30517713 GCCCATACCTCAGCTGCATCCGG - Exonic
1136518846 16:30783904-30783926 GGCCCTGCACCAGCTCCCGCAGG + Exonic
1136684987 16:31988774-31988796 TCCCATGCCCCAGCTGCAGCAGG - Intergenic
1136785601 16:32932309-32932331 TCCCATGCCCCAGCTGCAGCAGG - Intergenic
1136884170 16:33921495-33921517 TCCCATGCCCCAGCTGCAGCAGG + Intergenic
1137666742 16:50254248-50254270 ACCCCTGCCTCCGCTTCCGCAGG + Intronic
1137966173 16:52935906-52935928 GCCCAGGCCAGAGCTCCAGCAGG - Intergenic
1139379431 16:66521308-66521330 GCCCCTGCCACAGCTCCCCTGGG + Intronic
1140127315 16:72128896-72128918 GAGAATGCCTGAGCTCCCGCAGG - Intronic
1140876295 16:79155592-79155614 GCCAATCCCTCATCTCCAGCAGG + Intronic
1142133152 16:88440026-88440048 GCCCCTGTGCCAGCTCCCGCGGG + Exonic
1142157864 16:88540821-88540843 GCCCCTGCCTCAGCTGACGAAGG - Intergenic
1142173498 16:88634674-88634696 GCCCAGTCCGCAGGTCCCGCAGG + Intergenic
1142246075 16:88970647-88970669 GTCCCTGCCTCAGCACCAGCAGG + Intronic
1142467580 17:145077-145099 GCCCTTGCCTCAGCCCCCAGAGG + Intergenic
1142706688 17:1699707-1699729 TCCCCTGCCTCAGCTGCAGCTGG + Intergenic
1142965286 17:3577232-3577254 GCCCTTCCCTCAGCTCCTCCTGG - Intronic
1143093161 17:4462010-4462032 GCCAATTCCTCAGCACCCTCTGG - Intronic
1143972123 17:10803457-10803479 GCCCTGGCCTCAGGTCCTGCTGG - Intergenic
1145209186 17:21000579-21000601 GACCCTGCCTCCCCTCCCGCCGG - Exonic
1146197302 17:30824552-30824574 GCCGGTGACCCAGCTCCCGCCGG + Exonic
1147145928 17:38484455-38484477 TCCCATGCCTCAGCTGCAGCAGG - Intronic
1149595594 17:57862786-57862808 CCCCCTTCCTCAGCTCCCTCCGG - Exonic
1152007584 17:77692068-77692090 GTCCCTGCCTCAGCTCCCACTGG - Intergenic
1152013536 17:77735254-77735276 GGCCCTGCCTCAGCTCCTGCAGG + Intergenic
1152161726 17:78672978-78673000 GCCCATGCCGCAGCTGTCACAGG + Intergenic
1152625213 17:81385016-81385038 GCCCAGGCCCCAGCCTCCGCGGG - Intergenic
1152661257 17:81543294-81543316 GTCCCTGCCTCAGCTCCACCTGG - Intronic
1152947838 17:83207554-83207576 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1155807713 18:30192698-30192720 ACTCATGCCTCAGCTCCAGGGGG + Intergenic
1156395791 18:36698827-36698849 CCCCAAGCCTCAGTTCCCACAGG + Intronic
1157281334 18:46348144-46348166 ACCCAGGCATCAGCTCCCCCAGG - Intronic
1160045373 18:75381701-75381723 ATCCCTGCCTCAGCTCTCGCTGG + Intergenic
1160693454 19:470948-470970 CCCCATGCCTGCCCTCCCGCAGG + Intronic
1160724179 19:610396-610418 GCGCCCGCCTCACCTCCCGCAGG - Exonic
1161161098 19:2762265-2762287 GCCCCTCCCTCAGCCTCCGCGGG + Intronic
1161767362 19:6215020-6215042 GCCCCTGCCTGTGCTCCTGCCGG + Intronic
1161795292 19:6382824-6382846 GGCCATGGCTCAGCTCTCCCGGG + Intronic
1162299396 19:9835592-9835614 CCCCCTGCCTCAGCTTCCTCAGG - Intronic
1162481045 19:10927406-10927428 GCCAATTCCTCACCTCCCCCAGG + Intronic
1163314983 19:16535565-16535587 ACCCCTGCCACAGCCCCCGCTGG - Exonic
1163778536 19:19232509-19232531 GGACAGGCCTCAGCTACCGCAGG + Intronic
1165139106 19:33688522-33688544 GCCAGAGCCTCAGCTCCCTCTGG + Intronic
1167069299 19:47210715-47210737 GCCCCTGTCTCACCTCCGGCGGG - Intergenic
924999914 2:396585-396607 GCCCCTTCCTTAGCTTCCGCAGG - Intergenic
925007408 2:454693-454715 GCCCTTGCCTGGCCTCCCGCAGG - Intergenic
931883721 2:66593099-66593121 GCCCGTGGCTCACCTCCTGCTGG - Intergenic
932396929 2:71454828-71454850 GCCCAGCCCTCAGCTCCTGGAGG - Intronic
932435218 2:71699338-71699360 GGCCATGCCCCAGCCCCAGCTGG - Intergenic
934295492 2:91739547-91739569 GCACATCCCTCAGCTCCCTCCGG - Intergenic
935069441 2:99681087-99681109 GCCCATGAATCAGCTCCCTAGGG - Intronic
936052797 2:109238089-109238111 GCTCCTGCCTCAGCTCCACCTGG - Intronic
936163412 2:110101445-110101467 GGCCAGGTCTCATCTCCCGCTGG + Intronic
937200953 2:120204266-120204288 GCCCCAGCCACAGCTCCCTCTGG + Intergenic
937293487 2:120796173-120796195 GCCCATGCCCCGAATCCCGCTGG + Intronic
938161375 2:128987403-128987425 GCCCATGCTTCAGCAGCCTCTGG - Intergenic
938469498 2:131545380-131545402 GCCCATGGTACAGCACCCGCAGG - Intergenic
941291653 2:163683149-163683171 GCCCATGCCTCAAAGCCCCCAGG + Intronic
942070108 2:172308599-172308621 GCCCAGGCCTGTGCACCCGCTGG - Intergenic
942231777 2:173867001-173867023 GCCCAGACACCAGCTCCCGCAGG + Intergenic
944579666 2:201120986-201121008 CCCCATTCCTCAGCCCCAGCAGG - Intronic
947642127 2:231712728-231712750 CCCACTGCCTCAGCTCCTGCTGG - Intronic
948173400 2:235924671-235924693 TCCCAAGCCTCAGTTCCCACAGG + Intronic
1171327216 20:24305282-24305304 GCCCTTGCCTCAGTTCTCCCTGG + Intergenic
1172618689 20:36306362-36306384 CCCCATGCCTCTCCTCCGGCCGG - Exonic
1174184268 20:48694595-48694617 GCACAGGCCTCTGCTCCAGCAGG + Intronic
1174265457 20:49328577-49328599 CCCCATTCCTCGGCTCCTGCAGG - Intergenic
1174591984 20:51653377-51653399 GCCCACTCCTCTGCTCCCACTGG - Intronic
1175891784 20:62318959-62318981 GCCAATGCCTCGGCTCCATCAGG - Exonic
1175989938 20:62783608-62783630 GGCCATGCCCCGGCTCCCCCTGG + Intergenic
1176263892 20:64198550-64198572 GCCCATGCCTCAGCACTTGTTGG + Intronic
1177372220 21:20218754-20218776 GCCCATGCTGCAGCTCTCACAGG - Intergenic
1177814447 21:25960642-25960664 CCCCAGGCCTCAGCTCCTCCAGG + Intronic
1178914036 21:36697250-36697272 GCCCCTGCCGCAGCTTCCGCAGG - Intergenic
1179449465 21:41458611-41458633 GGCCATGCTGCAGCTCCTGCAGG + Exonic
1180464960 22:15603106-15603128 GTCGGTGCCTCAGCTCCCGGGGG + Intergenic
1181582307 22:23835049-23835071 GCCCAGGCCACAGCACCTGCTGG - Intronic
1183100445 22:35580537-35580559 TCCCATTCCTCCGCTCCAGCTGG + Intergenic
1183738864 22:39659136-39659158 GGCCATACCTCAGCACCTGCTGG + Intronic
1183741740 22:39672686-39672708 GTCCATGCCTCCTCTCCTGCAGG + Intronic
1184382659 22:44155537-44155559 GGCCACGCCGCTGCTCCCGCAGG - Intronic
1185278305 22:49959324-49959346 GCCCATGCCTGTGCTCCTGGGGG - Intergenic
1185337071 22:50275475-50275497 GCCCCAGCCCCAGCTCCCTCCGG - Exonic
949876214 3:8627794-8627816 ACCACTGCCTCAGCCCCCGCTGG + Intronic
950020025 3:9780506-9780528 CCCGCTGCCTCAGCTCCTGCCGG + Exonic
950092709 3:10307669-10307691 TCCCATGACTCAACTCCCACTGG + Intronic
950722899 3:14897574-14897596 GGCCCTGCCTCAGCTCCTCCCGG - Exonic
959517299 3:107283345-107283367 TCACATCCCTCAGCTCCTGCAGG + Intergenic
960346490 3:116539248-116539270 GCCCATGCATCAGCTGGGGCAGG - Intronic
961824301 3:129590840-129590862 GCCCATGCCTCAGCTGCATTTGG + Intronic
962318037 3:134370974-134370996 GCCCATGCCTCAGCTCCCGCAGG + Exonic
962755065 3:138460379-138460401 GCCCAGGCCTCAGCTCAGGATGG - Intronic
962929365 3:140022807-140022829 GCTCATGCCTTAGCTCCCATGGG - Intronic
964890796 3:161532320-161532342 CCCCATGTCTCAGCTCCAGCAGG + Intergenic
966735410 3:183182901-183182923 GGCCCTGACTCAGCTCCCACAGG - Intronic
966759928 3:183408545-183408567 GCCCAGTGCCCAGCTCCCGCAGG + Intronic
966767670 3:183477967-183477989 GGCCCTGACTCAGCTCCCACAGG + Intergenic
968135280 3:196216224-196216246 GCCCAAGCCTGAGTTCCAGCAGG + Intronic
968646296 4:1742391-1742413 GCCTGTGCCTCAGCTCCCACTGG + Intronic
968811276 4:2800663-2800685 GCTCAGGCCTCGGCTCCCACGGG + Intronic
969326590 4:6447803-6447825 TCCCGTGCCTCAGCTACGGCTGG + Intronic
972541506 4:40043225-40043247 GCCCATGCCCCAGCTCGTGCCGG - Intergenic
978140568 4:105313208-105313230 ACCCCTGCTTCAGCTCTCGCTGG + Intergenic
978409863 4:108415432-108415454 GCCCACTCCCCATCTCCCGCTGG + Intergenic
979456143 4:120927914-120927936 GCCCATGACTCAGCTCTCTTGGG - Intergenic
980053697 4:128061180-128061202 GCGAATCCGTCAGCTCCCGCGGG + Intergenic
980544721 4:134244399-134244421 CCCCATGCCTCAGCCCCCTATGG + Intergenic
982525356 4:156470966-156470988 GCCCATGCCCCATCTGCCCCAGG - Intergenic
985451759 4:190066780-190066802 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985452747 4:190070072-190070094 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985453733 4:190073365-190073387 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985454722 4:190076658-190076680 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985455712 4:190079955-190079977 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985456695 4:190083249-190083271 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985457682 4:190086545-190086567 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985458670 4:190089842-190089864 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985459659 4:190093142-190093164 GCCCAGCCCTCAGCCCGCGCCGG - Intergenic
985727340 5:1523344-1523366 GCCCCGACCTCGGCTCCCGCGGG - Intronic
986029466 5:3881453-3881475 GGCCCTGCCTGAGCTCCTGCAGG + Intergenic
986227351 5:5828273-5828295 CCCCATGCCTCAGCTGGCCCTGG - Intergenic
986573296 5:9187843-9187865 GCTCAGGACTCAGCTGCCGCAGG - Intronic
988949327 5:36241648-36241670 GCCCCTGCCCCAGGTGCCGCCGG + Exonic
990401096 5:55438289-55438311 GCCCTGCCCTGAGCTCCCGCAGG + Intronic
992184575 5:74231776-74231798 GTCCCTGCATCAGCTCCCCCAGG - Intergenic
996082710 5:119273100-119273122 GCTCATGTCTCAGCCCCTGCTGG + Intronic
996611255 5:125382829-125382851 GCCCATGCCACAGCTCATACTGG - Intergenic
997512981 5:134465970-134465992 CGCCGTGACTCAGCTCCCGCCGG - Intergenic
998231125 5:140362044-140362066 GTCCCTGCCTCAGCTCCTGGAGG - Exonic
998406636 5:141878144-141878166 GCCCCTCCCTCAGCTCCCGCCGG + Intronic
1001099789 5:168804660-168804682 ACCCATGCCTCCGCACCCTCTGG - Intronic
1001548657 5:172586635-172586657 GCCCACACCTCAGCTTCCTCTGG - Intergenic
1002394381 5:178941675-178941697 GCCCCTGCCACAGCCCCCGAGGG + Intronic
1002408696 5:179056135-179056157 GCCCATCCCTCATCTTCTGCAGG + Intergenic
1002742001 5:181440708-181440730 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1002912057 6:1498034-1498056 GCCCTGGCCTCAGATCCTGCTGG + Intergenic
1002931257 6:1636788-1636810 GCCCATGCCTCACCTGCCCAAGG + Intronic
1006162663 6:32047260-32047282 GCCTATGACTCAGCTCCCTGAGG - Intronic
1007192027 6:40027595-40027617 GCCCATGCCACAGCTTTCGTGGG - Intergenic
1009773714 6:68177931-68177953 GCCCATGGCTTACCTCCTGCCGG - Intergenic
1013792625 6:113854835-113854857 GCCCAGCCCTCAGCGGCCGCCGG + Intergenic
1018180375 6:161217838-161217860 GCTGGTGCCTCTGCTCCCGCGGG + Intronic
1018639829 6:165895974-165895996 GCCCAGGCCTCTGCACCCACTGG + Intronic
1019247138 6:170716446-170716468 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1020007158 7:4789098-4789120 GCACATGCCACAGCCCCGGCAGG + Intronic
1022082894 7:27041548-27041570 GCCCAAGCCCCAGTTCCCACAGG + Intergenic
1024532663 7:50406418-50406440 GGCCATGCCCCAGCTGCCACTGG + Intergenic
1026893346 7:73996046-73996068 GCCCATGACTAAGCTGCCTCAGG + Intergenic
1027052411 7:75028566-75028588 CCCCATCCTTCAGCTCCCACTGG - Intronic
1029421605 7:100474732-100474754 TCCAATGCCCCAGCTCCCACTGG + Intronic
1029558559 7:101287257-101287279 TCCCAGGCCTCAGCTCACACAGG - Intergenic
1029994060 7:104989370-104989392 GCCCATCACTCACCTCCTGCAGG + Intergenic
1031893332 7:127320551-127320573 GAGCATGCCTCAGCTCCTACAGG + Intergenic
1034324670 7:150219997-150220019 GCCCGTGCATCCGCTCCCGCCGG - Intergenic
1034768522 7:153749234-153749256 GCCCGTGCATCCGCTCCCGCCGG + Intergenic
1035500999 8:91488-91510 GCCCCTGACTCAGCCTCCGCAGG + Intergenic
1036638931 8:10569975-10569997 GGCTATGCCTTAGCTCCTGCAGG - Intergenic
1036679125 8:10857850-10857872 GTCCATGCCTCTGCTTCCTCAGG - Intergenic
1037784564 8:21894939-21894961 GCCCAGTCCTCAGCTCCCAGAGG - Intergenic
1039677371 8:39684515-39684537 GCCCATGCCACACCTCTCACAGG + Intronic
1043383776 8:79729471-79729493 ACCCTTGCCTCAGCTCTAGCTGG - Intergenic
1043624893 8:82244231-82244253 GCCCATGCCACAGCTCTCATGGG - Intergenic
1044318684 8:90778018-90778040 TCCCCTGCCACAGCTCCAGCCGG + Intronic
1048072801 8:131039959-131039981 GCCCCCGCCTCCGCTGCCGCTGG + Exonic
1049425847 8:142537563-142537585 GCCCAGTCCTCAGCCCCTGCAGG + Intronic
1049550106 8:143253418-143253440 GCCTGTGCCTCAGCACCCACGGG + Intronic
1049792499 8:144478389-144478411 GCCCAGGGCACAGGTCCCGCCGG + Intronic
1050367930 9:4889716-4889738 TACCATGCCTCATCTCCCACTGG + Intergenic
1053312358 9:37027711-37027733 GCCCGGGGCTCAGCTCCCTCCGG + Intronic
1057277540 9:93683984-93684006 TCCCCTGCCTCAGCTCCAGTGGG - Intergenic
1062161364 9:135082040-135082062 GCCCCTGCCTGGGCTCCAGCTGG + Intronic
1062535469 9:137019306-137019328 GCCCCTGCCTCACCCCCTGCAGG - Exonic
1203607913 Un_KI270748v1:71924-71946 GCCCCTGACTCAGCCTCCGCAGG - Intergenic
1186518927 X:10188382-10188404 GGGCCTGCCTCAGCTCCCGTGGG - Intronic
1189155137 X:38749374-38749396 GCCCAGGCCTCAGCTAGAGCTGG - Intergenic
1189927667 X:45973531-45973553 GCCCATGCCTGCACTCCCTCGGG + Intergenic
1191700148 X:64033466-64033488 CCCTATGCCTCAGGTCCCTCAGG + Intergenic
1195520307 X:105822270-105822292 GCCCCTGCCCCCGCCCCCGCTGG - Intergenic
1195803319 X:108736071-108736093 GCCCATGCTTCTGTTTCCGCAGG + Exonic
1195866520 X:109438686-109438708 ACCCATGCCACAGCTCTCACAGG + Intronic
1198308466 X:135405694-135405716 GCCCATGCCTCAGCTGTTGGGGG - Intergenic
1199534296 X:148884760-148884782 ACCCAACCCTCAGCTCCAGCTGG - Intronic
1200047005 X:153408537-153408559 GGCAATGCCTCAGGTCACGCAGG - Intergenic