ID: 962318039

View in Genome Browser
Species Human (GRCh38)
Location 3:134370975-134370997
Sequence CCCATGCCTCAGCTCCCGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 377}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962318036_962318039 1 Left 962318036 3:134370951-134370973 CCGTTCACTCAACGAGCGCACGT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 962318039 3:134370975-134370997 CCCATGCCTCAGCTCCCGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 377
962318034_962318039 25 Left 962318034 3:134370927-134370949 CCTCTCCAGGGACAACTGAAGGA 0: 1
1: 0
2: 1
3: 16
4: 140
Right 962318039 3:134370975-134370997 CCCATGCCTCAGCTCCCGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 377
962318035_962318039 20 Left 962318035 3:134370932-134370954 CCAGGGACAACTGAAGGAGCCGT 0: 1
1: 0
2: 1
3: 10
4: 73
Right 962318039 3:134370975-134370997 CCCATGCCTCAGCTCCCGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 377
962318032_962318039 30 Left 962318032 3:134370922-134370944 CCGTTCCTCTCCAGGGACAACTG 0: 1
1: 1
2: 3
3: 30
4: 256
Right 962318039 3:134370975-134370997 CCCATGCCTCAGCTCCCGCAGGG 0: 1
1: 0
2: 2
3: 21
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962318039 Original CRISPR CCCATGCCTCAGCTCCCGCA GGG Exonic
901054789 1:6444055-6444077 CCCAGGCCCCAGGTCCAGCAAGG + Intronic
901691494 1:10976255-10976277 CCCTTCCCTCCTCTCCCGCAGGG - Exonic
901970663 1:12905283-12905305 GCCCTGCTTCAGCTCACGCACGG - Intronic
902014502 1:13296487-13296509 GCCCTGCTTCAGCTCACGCACGG + Intergenic
902314087 1:15604602-15604624 CCGAAGCCACACCTCCCGCATGG + Intergenic
902332386 1:15736900-15736922 CCCATGACCCAGCTCCCACAGGG + Intronic
902610231 1:17592825-17592847 GCCATGCCTCACGTCCCGCATGG - Intronic
903672059 1:25042252-25042274 CCCAGGCCTGAGCTCCCTGAAGG + Intergenic
903897682 1:26619563-26619585 CCCATGCCTCAGTTCGTTCAAGG - Intergenic
904358164 1:29954903-29954925 TGCATGCCTCACCCCCCGCATGG + Intergenic
904470691 1:30734213-30734235 CCCATCCCTCAGATCCAGCGAGG + Intronic
905911977 1:41661694-41661716 CCCATTCAGCAGCTCCCGCCGGG + Intronic
906708930 1:47914951-47914973 CCCATGACTGAGCTCCTGCAAGG - Intronic
907838312 1:58132304-58132326 ACCCTGCTTCAGCTCGCGCACGG + Intronic
908918192 1:69157621-69157643 CTCATGCCTCAGTCCCAGCAGGG + Intergenic
909441152 1:75697798-75697820 GCCCTGCTTCAGCTCACGCACGG - Intergenic
909474480 1:76066898-76066920 CCCAAGCCCCAGTTCCCACATGG - Intergenic
910067133 1:83167578-83167600 GCCCTGCTTCAGCTCACGCACGG - Intergenic
911066766 1:93796501-93796523 CCCCTGCTTCGGCTCGCGCACGG + Intronic
912702899 1:111891513-111891535 GCCCTCCCTCAGCTCCCGAAGGG + Intronic
912947376 1:114096285-114096307 CTCATCTCTCAGCTCCCCCAGGG - Intronic
913151819 1:116052074-116052096 GCCATGCTTCGGCTCGCGCATGG - Intronic
913933951 1:125015410-125015432 TCCATGCTTCAGCTCGCGTATGG - Intergenic
913985731 1:143563945-143563967 GCCCTGCTTCAGCTCACGCACGG + Intergenic
914340562 1:146756258-146756280 CCCATGCCTGGGCTCCTCCAGGG + Intergenic
915810890 1:158909669-158909691 TCCATGCCTTGGCTCCCGGATGG + Intergenic
916564356 1:165960332-165960354 CGCAAGCCCCAGCTCCAGCAAGG - Intergenic
917549409 1:176008189-176008211 GCCCTGCATCAGCTCGCGCACGG + Intronic
917575211 1:176314227-176314249 GCCCTGCTTCAGCTCGCGCATGG + Intergenic
918089392 1:181276021-181276043 TCCCTGCTTCAGCTCACGCATGG - Intergenic
918097168 1:181345109-181345131 CCCCTGCCTCAGCTGCAGCCTGG + Intergenic
918146060 1:181756967-181756989 CCCAAGCCGCAGCAACCGCATGG + Exonic
918518077 1:185384557-185384579 GCCGTGCTTCAGCTCGCGCACGG + Intergenic
920559990 1:206932100-206932122 GCCATGCCTCAGTTTCCTCATGG - Intronic
920676851 1:208044067-208044089 CACCTGCCTCATCTCCCCCAGGG - Intronic
923790355 1:237106271-237106293 CCCCTGCACCAGCTCCCGCTGGG + Intronic
924440630 1:244082575-244082597 CCTCTGCCTGAGCTCCTGCAGGG - Intergenic
924738441 1:246780092-246780114 CTCATTCCTCAGGTCCCCCAGGG + Intergenic
1065296175 10:24277411-24277433 CCCATTCCTGGGCTCCCCCAGGG - Intronic
1066664150 10:37765782-37765804 GCCCTGCTTCAGCTCACGCATGG - Intergenic
1067223968 10:44363503-44363525 CCCTTGCCTCAGCTCCTCCCCGG + Intergenic
1069861750 10:71475865-71475887 CCCAGGCCCCGGCTCCTGCAGGG - Intronic
1070696756 10:78569606-78569628 CCCATGTGTCAGCTCCAGGAGGG - Intergenic
1070774874 10:79103663-79103685 CCCATGCAGCTGCTCCCCCAGGG - Intronic
1070779741 10:79130535-79130557 CTCATGCCCCAGCTCCCAGAGGG + Intronic
1071332183 10:84571336-84571358 CCCAGGCCGCAGCTGCCGGAGGG + Intergenic
1071514614 10:86289030-86289052 CCCATGCCTCTTCTCCCACTGGG + Intronic
1071532355 10:86400210-86400232 CGCATGGTGCAGCTCCCGCAGGG - Intergenic
1071552631 10:86578899-86578921 CCCCTGCCTCAGCTTCCCCAGGG + Intergenic
1072000246 10:91188227-91188249 GCCCTGCTTCAGCTCGCGCATGG - Intronic
1072377298 10:94830501-94830523 GCCCTGCTTCGGCTCCCGCAGGG + Intronic
1073892157 10:108114101-108114123 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1075848345 10:125565392-125565414 CCTATGTCACAGCTCCGGCAAGG + Intergenic
1076207495 10:128614846-128614868 CCCATGACTCAGATGCTGCAGGG + Intergenic
1076365642 10:129919797-129919819 CCCATGTCTCTGCTCCCTGAGGG + Intronic
1076861814 10:133141402-133141424 CCCCTGCCACACCTCCCACAGGG - Intergenic
1076938217 10:133580715-133580737 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1077365048 11:2158260-2158282 CACATACCTCAGCTCCAGCAGGG + Intronic
1077540582 11:3144786-3144808 CCCAGGCCTGACCTCCCGCCAGG - Intronic
1077857507 11:6143805-6143827 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1079045213 11:17095806-17095828 CTCATGCCTCAGCTCCTGAATGG - Intronic
1079795892 11:24802650-24802672 CCCATTCCCCATCTCCCCCAGGG + Intronic
1080465805 11:32495964-32495986 CCCGTGCCAGAGCTCCTGCAAGG + Intergenic
1081161453 11:39755200-39755222 ACCCTGCTTCAGCTCACGCACGG - Intergenic
1082033716 11:47626532-47626554 CCCCTGCCTCACATCCTGCATGG - Intronic
1082151987 11:48750534-48750556 GCCCTGCTTCAGCTCACGCATGG + Intergenic
1082227446 11:49725442-49725464 GCCCTGCTTCAGCTCGCGCATGG - Intergenic
1082623861 11:55460074-55460096 GCCCTGCTTCGGCTCCCGCACGG - Intergenic
1083547971 11:63563102-63563124 CCCCAGCCTCAGCTGCCGCATGG - Intronic
1083654015 11:64220355-64220377 CCCCTGCCCCAGCTCCTGCCCGG - Intronic
1083677673 11:64335690-64335712 CTCATGCCTCAGCCTCCCCAGGG - Intergenic
1084185452 11:67468767-67468789 CTCATCCCTCAGCTCCAGCTGGG - Intronic
1084564716 11:69922322-69922344 CCCAGGGCACAGCTCCAGCAGGG + Intergenic
1085434992 11:76492651-76492673 CCCATTCCACAGAGCCCGCAGGG + Intronic
1087311968 11:96555751-96555773 GCCCTGCTTCAGCTCACGCACGG - Intergenic
1087737638 11:101852643-101852665 GCCCTGCTTCAGCTCGCGCACGG - Intronic
1088473227 11:110209134-110209156 GCCCTGCTTCAGCTCGCGCACGG - Intronic
1088743693 11:112786929-112786951 CCCAGGCCTCCCCTCCTGCATGG - Intergenic
1090374385 11:126278667-126278689 CCCATTCCTGAGTTCCTGCAGGG + Intergenic
1090896778 11:130984423-130984445 GCCCTGCTTCAGCTCGCGCATGG - Intergenic
1091843666 12:3638272-3638294 CCCCTGCCCCAGCTCCTGGATGG - Exonic
1096673651 12:53214857-53214879 CCCCTCCCCCAGCTCCTGCAGGG - Intronic
1096931039 12:55210585-55210607 GCCCTGCTTCAGCTCACGCATGG - Intergenic
1096962089 12:55590095-55590117 GCCCTGCTTCAGCTCGCGCATGG - Intergenic
1097578230 12:61420944-61420966 GCCCTGCTTCAGCTCACGCACGG + Intergenic
1098985853 12:77011146-77011168 CCCATCCCTCAGCTCCCGCTAGG - Intergenic
1099235748 12:80080647-80080669 GCCCTGCTTCAGCTCCTGCATGG + Intergenic
1100663910 12:96729658-96729680 ACCCTGCTTCAGCTCGCGCACGG + Intronic
1100685238 12:96980375-96980397 TCTATGCCTCAGCTTCCTCATGG + Intergenic
1102442415 12:112973852-112973874 CAGATGCCTCAGCTCATGCAGGG + Intergenic
1102541980 12:113627483-113627505 ACCAGGCCCCAGCTCCAGCATGG + Intergenic
1103009609 12:117448194-117448216 CACATGGGTCAGCTCCCGGAAGG + Intronic
1103542985 12:121679165-121679187 CCCAAGCCTCAGTCCCAGCATGG + Intergenic
1103724298 12:122990111-122990133 CCCCAGCCTCAGCTCCTGCATGG + Intronic
1103914244 12:124368362-124368384 CCCTTGCCTCAGTTTCCCCATGG + Intronic
1104239210 12:126971190-126971212 GCCAAGCCCCAGCTCCAGCATGG + Intergenic
1104401516 12:128480515-128480537 CAGATGCCTCAGCTCCCGCATGG - Intronic
1105667316 13:22574892-22574914 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1106019219 13:25898996-25899018 GCCCTGCTTCAGCTCACGCATGG + Intronic
1106901617 13:34359872-34359894 CCCAAGTCCCAGTTCCCGCAGGG - Intergenic
1107155021 13:37155803-37155825 CCCCTGCTTCGGCTCACGCACGG + Intergenic
1107162701 13:37250505-37250527 CCCCTGCTTCGGCTCGCGCACGG - Intergenic
1107859278 13:44645641-44645663 CCCACTCTTCAGCTCCCGAAGGG + Intergenic
1110533051 13:76618670-76618692 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1110552252 13:76823033-76823055 TCCAGGGCTCAGCTCCCACAAGG + Intergenic
1110586444 13:77199187-77199209 GCCCTGCTTCAGCTCGCGCATGG - Intronic
1110698468 13:78519213-78519235 GCCCTGCTTCAGCTCGCGCATGG + Intergenic
1111782942 13:92752635-92752657 ACCCTGCTTCAGCTCGCGCACGG - Intronic
1113344791 13:109466818-109466840 CACATACCACAGCTCCCACAAGG + Intergenic
1114003845 14:18289683-18289705 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1115213923 14:30996147-30996169 CTGCTGCCTCAGCTCCCCCAGGG + Intronic
1115542023 14:34429785-34429807 CCCAAGCCCCAGTTCCCACAGGG + Intronic
1116618656 14:47171816-47171838 GCCCTGCTTCAGCTCGCGCATGG - Intronic
1119985454 14:79132024-79132046 GCCCTGCTTCAGCTCACGCACGG + Intronic
1120069638 14:80088687-80088709 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1121129907 14:91436713-91436735 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1122311022 14:100794304-100794326 CTCATGCCTCAGCCTCCGAAGGG - Intergenic
1122859175 14:104574806-104574828 GCCCTGCCTGAACTCCCGCAGGG + Intronic
1122877187 14:104673642-104673664 CCCACCCCTCAGTTCCCCCAAGG - Intergenic
1123025455 14:105421659-105421681 CCCATGCCTCGGTTTCCCCATGG + Intronic
1123931473 15:25173693-25173715 CCCCTGCCTCCTTTCCCGCATGG + Intergenic
1124831494 15:33153777-33153799 CCCCAGCCTCAGCTCCCGGGAGG + Exonic
1124880658 15:33639640-33639662 CCCATGGCCCAGCTCCCACTGGG - Intronic
1125603065 15:40926043-40926065 CGCGTGCCTCATCTGCCGCAGGG - Intergenic
1126888937 15:53183399-53183421 GCCCTGCTTCAGCTCACGCATGG - Intergenic
1128529040 15:68431685-68431707 CCCATGCCGGGGTTCCCGCACGG - Intronic
1128548497 15:68583107-68583129 CTCCTGCCTCAGCTCCAGCAGGG + Intronic
1129622047 15:77156468-77156490 GCCCTGCTTCAGCTCGCGCACGG + Intronic
1129663985 15:77569155-77569177 CCCAGGCTTCAGCCACCGCACGG + Intergenic
1129740780 15:77988626-77988648 CCCAGGCCTCACCTCCCTCCAGG - Intronic
1130256882 15:82329926-82329948 CCCAGGCCTCACCTCCCTCCAGG - Intergenic
1130326905 15:82888740-82888762 GCCCTGCTTCAGCTCGCGCACGG + Intronic
1130362802 15:83207158-83207180 CCCTTGCCTCAGCCCCGGCCCGG + Intronic
1130598066 15:85260062-85260084 CCCAGGCCTCACCTCCCTCCAGG + Intergenic
1131525756 15:93151140-93151162 CCCATGACTCTGCTGCCGAAAGG - Intergenic
1132038581 15:98506085-98506107 CCCATCCCACATCTCCCCCATGG + Intronic
1132132882 15:99300714-99300736 CTCATGCCTCAGCTTCCTGAGGG - Intronic
1132720930 16:1315289-1315311 CCCCTGCCCCAGGTCCCGCCTGG - Intronic
1134302936 16:13007656-13007678 CCCCAGCCTCAGCTCTCACATGG + Intronic
1136495589 16:30641604-30641626 CCCCAGCCTCAGCTCCCAAAGGG - Intergenic
1136549692 16:30976408-30976430 CCCAGGCCCCAGCTCTGGCAAGG - Intronic
1138258911 16:55598957-55598979 ACCCTGCTTCAGCTCACGCACGG - Intergenic
1138720322 16:59072417-59072439 ACCCTGCTTCAGCTCACGCATGG - Intergenic
1139993723 16:70961148-70961170 CCCATGCCTGGGCTCCTCCAGGG - Intronic
1140127314 16:72128895-72128917 AGAATGCCTGAGCTCCCGCAGGG - Intronic
1140876297 16:79155593-79155615 CCAATCCCTCATCTCCAGCAGGG + Intronic
1141587696 16:85045910-85045932 CCCATGGCTGTGCTCCTGCAGGG + Intronic
1141640010 16:85335519-85335541 CCCACGCCCCAGCACCTGCAGGG - Intergenic
1141716517 16:85730096-85730118 CTCCTTCCTCAGCTCCCCCAGGG - Intronic
1142141845 16:88476079-88476101 CCCAGGCCTCAGACCCCACAGGG + Intronic
1142226290 16:88879217-88879239 CCCCTGCCTCGGCTCCCGTGCGG - Intronic
1142426895 16:90006304-90006326 CACCTGCCCCAGCTCCTGCAGGG - Exonic
1142706690 17:1699708-1699730 CCCCTGCCTCAGCTGCAGCTGGG + Intergenic
1142917424 17:3153230-3153252 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1143786042 17:9256484-9256506 CCCATCCGTCAGCTTTCGCAAGG + Intronic
1144092097 17:11866991-11867013 GCCCTGCTTCAGCTCGCGCATGG + Intronic
1145278893 17:21454303-21454325 CCCTTCCCCCAGCTCCCCCAGGG - Intergenic
1146780352 17:35665368-35665390 CACCTGCCTCAGCTTCCGTAAGG + Intronic
1146903281 17:36601793-36601815 GCCATGGCGCAGCTCCCGCCAGG - Exonic
1149595592 17:57862785-57862807 CCCCTTCCTCAGCTCCCTCCGGG - Exonic
1150195732 17:63296575-63296597 CCAATGTCTCAGCTGCCTCAGGG - Intronic
1150380012 17:64712983-64713005 CCCAGGCCTCAGTGCCCTCATGG + Intergenic
1150777811 17:68095776-68095798 GCCATGCCTCAGCTCCCTGCTGG - Intergenic
1150839650 17:68595877-68595899 TCCCTGCCCCAGCTCCCCCATGG - Intronic
1152166340 17:78710089-78710111 TCTAGGCCTCAGCTCCCTCATGG + Intronic
1152316410 17:79583201-79583223 CCCAAGCCTCAGCTTCCTCCTGG + Intergenic
1152366701 17:79860567-79860589 CCCAGGCCTCTGCTGCAGCACGG - Intergenic
1203191199 17_KI270729v1_random:191512-191534 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1154210958 18:12377732-12377754 CCCATGACTCAGCTGGCGCTCGG - Intergenic
1155474561 18:26225353-26225375 CCAATTCCTGAGCTCCCGCCTGG - Intergenic
1156236025 18:35205939-35205961 GCCCTGCCCCAGCTCGCGCACGG - Intergenic
1156395793 18:36698828-36698850 CCCAAGCCTCAGTTCCCACAGGG + Intronic
1156517024 18:37688777-37688799 CCCATGCCTCATATCTCCCATGG + Intergenic
1157271112 18:46276980-46277002 CCCATGCCTCACCTCCATCCTGG - Intergenic
1157294548 18:46433311-46433333 GCCAGGCCTCAGCGCCCACATGG + Exonic
1157641132 18:49215921-49215943 GCCCTGCTTCGGCTCCCGCACGG - Intronic
1158663376 18:59409790-59409812 CCCCTGCTTCGGCTCGCGCACGG + Intergenic
1160045374 18:75381702-75381724 TCCCTGCCTCAGCTCTCGCTGGG + Intergenic
1160521395 18:79510240-79510262 CCCATCCCTGAGTTTCCGCACGG - Intronic
1160724178 19:610395-610417 CGCCCGCCTCACCTCCCGCAGGG - Exonic
1162956624 19:14102420-14102442 CCCAAGCCTCAGCTTTCTCATGG - Intronic
1163530867 19:17848078-17848100 CCCCGCCCCCAGCTCCCGCAGGG - Intergenic
1163831602 19:19549743-19549765 CCGATGCCTCAGCCCTCCCAGGG + Intergenic
1164294328 19:23896277-23896299 ACCCTGCTTCAGCTCGCGCACGG + Intergenic
1164307696 19:24019301-24019323 GCCCTGCTTCAGCTCACGCACGG + Intergenic
1164755364 19:30685244-30685266 CCCATGCTTCATCTTCCACAGGG + Intronic
1165242972 19:34482030-34482052 CCCGGGCTCCAGCTCCCGCAGGG - Exonic
1166324742 19:42042361-42042383 CCCATCCCACAGCACCCGCCAGG + Intronic
1166578411 19:43867132-43867154 GCCCTGCTTCTGCTCCCGCACGG + Intergenic
1168690807 19:58376161-58376183 CCCCTGCCTCAGCTTCCCAAAGG + Intronic
925491203 2:4395389-4395411 TCCAGGCCTGAGCTCCTGCATGG - Intergenic
926755875 2:16235412-16235434 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
927334804 2:21909163-21909185 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
927863452 2:26574574-26574596 CCCAGTCCACAGCTCCCGCCTGG - Intronic
928398641 2:30962446-30962468 CCCATGCCTCAGAGCCCCCATGG + Intronic
930220328 2:48739987-48740009 GCCCTGCTTCAGCTCGCGCATGG - Intronic
930605187 2:53486295-53486317 CCCATGCCCAAGCCCCCGGAAGG + Intergenic
930837884 2:55814179-55814201 ACCCTGCTTCAGCTCACGCATGG - Intergenic
931021245 2:58046996-58047018 CCCGGGCCTCAGCTCCGGCCCGG + Intronic
932459411 2:71872714-71872736 CCCAGGCCCCAGCTTCCCCAGGG - Intergenic
933257648 2:80098972-80098994 ACCCTGCTTCAGCTCACGCACGG + Intronic
936036570 2:109117605-109117627 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
937059503 2:118970939-118970961 CCTAAGCCTCAGCTCACACAGGG - Intronic
937453072 2:122018527-122018549 GCCCTGCTTCAGCTCGCGCAGGG + Intergenic
938666800 2:133547024-133547046 GCCCTGCTTCAGCTCGCGCACGG - Intronic
939869629 2:147512425-147512447 GCCATGCCACAGCTCCCTCGAGG + Intergenic
942449230 2:176098803-176098825 TCCTTGCCTCAGCGCCCCCAGGG - Intergenic
946252637 2:218422940-218422962 CCCATGCCTCACCTCCCAAAAGG + Intronic
948173402 2:235924672-235924694 CCCAAGCCTCAGTTCCCACAGGG + Intronic
948636318 2:239340099-239340121 CCCATGCCCCAACTGCTGCAGGG - Intronic
1169714586 20:8600946-8600968 GCCCTGCTTCAGCTCGCGCACGG + Intronic
1170515104 20:17120747-17120769 GCCCTGCTTCAGCTCGCGCATGG + Intergenic
1172703249 20:36864979-36865001 CCCATCCCTGAGCCACCGCAGGG + Intergenic
1172848674 20:37945036-37945058 CCAATGCCCCAGCTCCCTCTTGG + Exonic
1173673697 20:44815617-44815639 CTCCTGCCTCAGCTCCCCCGAGG - Intergenic
1175501115 20:59451749-59451771 CCCATTCCCCAGCTGCCCCAGGG - Intergenic
1176109277 20:63404200-63404222 CTCATGCCTCAGCGGCCCCATGG + Intergenic
1176138949 20:63536859-63536881 CCCGTGCTCCAACTCCCGCAGGG + Intronic
1177136131 21:17307037-17307059 ACCATGGCTCAGCTGCTGCAGGG + Intergenic
1177814449 21:25960643-25960665 CCCAGGCCTCAGCTCCTCCAGGG + Intronic
1179343124 21:40531386-40531408 CACATGCCCAAGCTCCTGCACGG + Intronic
1180243813 21:46532246-46532268 CCCATGGCTCAGGTCCCGTGTGG + Intronic
1180428358 22:15220486-15220508 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1181779799 22:25184462-25184484 CTCACACCTCAGGTCCCGCAAGG + Intronic
1182776981 22:32838488-32838510 CCCAAGGCTCAGCACCCTCAAGG - Intronic
1183100447 22:35580538-35580560 CCCATTCCTCCGCTCCAGCTGGG + Intergenic
1183317522 22:37145087-37145109 CCATTGCCTCAGCTCCCTCGAGG - Intronic
1183439471 22:37815287-37815309 CCCAGGCCTCAGGTGCCACATGG - Intronic
1184128125 22:42501753-42501775 CTCATCCCTCTTCTCCCGCAAGG + Intergenic
1184136915 22:42555066-42555088 CTCATCCCTCTTCTCCCGCAAGG + Exonic
1184505005 22:44895227-44895249 CCCTGGCCTCAGCTTCCCCATGG + Intronic
1185038215 22:48490391-48490413 CCCAGCCCTCAGCTCACGCCCGG - Intronic
1185200863 22:49503966-49503988 CCCATGCCTCAGCTCAAGTTAGG - Intronic
949660503 3:6272858-6272880 GCCCTGCTTCAGCTCACGCACGG + Intergenic
954451925 3:50576286-50576308 CCCAGGCCTCAGTTTCCTCATGG + Intronic
955030196 3:55209292-55209314 GCCCTGCTTCAGCTCACGCATGG - Intergenic
955430729 3:58842311-58842333 GCCCTGCTTCAGCTCGCGCACGG - Intronic
955481553 3:59395316-59395338 ACCCTGCTTCAGCTCACGCACGG - Intergenic
956873797 3:73442822-73442844 CCCATGCCACAGCTCCTCCCAGG + Intronic
959013625 3:101108488-101108510 GCCCTGCCTCAGCTCACGCACGG - Intergenic
959891575 3:111562054-111562076 GCCCTGCTTCGGCTCCCGCACGG + Intronic
961535267 3:127566893-127566915 CCCATGGCCCAGCTCCAGCCCGG + Intergenic
962318039 3:134370975-134370997 CCCATGCCTCAGCTCCCGCAGGG + Exonic
962484761 3:135831535-135831557 CCCAAGCCTCAATTCCCACAGGG + Intergenic
966735409 3:183182900-183182922 GCCCTGACTCAGCTCCCACAGGG - Intronic
966767671 3:183477968-183477990 GCCCTGACTCAGCTCCCACAGGG + Intergenic
967737220 3:192965472-192965494 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
967829802 3:193909292-193909314 CTCCTGCCCCAGCTCCTGCAGGG - Intergenic
968230076 3:197000350-197000372 GCCATGCCCCAGCACCCCCATGG - Intronic
968649779 4:1755931-1755953 CCCATGCTTCAGCTCCATCCAGG + Intergenic
968837437 4:2975419-2975441 ACCCTGCCTCTGCTCCCCCACGG - Intronic
969455103 4:7295995-7296017 GCCATGACGCAGCTCCCACAGGG - Intronic
969945693 4:10781240-10781262 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
970278376 4:14426498-14426520 GCCCTGCTTCAGCTCACGCACGG + Intergenic
970611461 4:17728922-17728944 GCCCTGCTTCAGCTCGCGCATGG - Intronic
974546544 4:63315833-63315855 CCCATGCCTAAACTCCCTCGAGG + Intergenic
974690723 4:65294083-65294105 ACCCTGCTTCAGCTCGCGCACGG + Intergenic
975034551 4:69664168-69664190 GCCCTGCTTCAGCTCGCGCATGG - Intergenic
976031297 4:80757905-80757927 CCCATGCTCCCCCTCCCGCAAGG - Intronic
976479813 4:85528103-85528125 CCTATTCTTCAGCTCTCGCAGGG - Intronic
976794705 4:88919718-88919740 GCCCTGCTTCAGCTCGCGCATGG - Intronic
977159384 4:93614157-93614179 GCCCTGCTTCAGCTCGCGCACGG + Intronic
977199495 4:94099065-94099087 GCCCTGCTTCAGCTCACGCACGG - Intergenic
977678263 4:99771284-99771306 GCCCTGCCTCGGCTCCCGCACGG + Intergenic
978140570 4:105313209-105313231 CCCCTGCTTCAGCTCTCGCTGGG + Intergenic
979376696 4:119954577-119954599 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
979432529 4:120648306-120648328 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
980462177 4:133128902-133128924 CCAATGCCAAAGCTCCCTCAAGG + Intergenic
980955062 4:139419594-139419616 CCCATGCCCCATTTCCCGTAAGG + Intronic
981169526 4:141605491-141605513 CCCATGCCTGAGCTTCCCCGAGG - Intergenic
981388032 4:144153874-144153896 GCCCTGCTTCAGCTCACGCACGG + Intergenic
982114848 4:152089832-152089854 CCCTTGCTGCAGCACCCGCATGG - Intergenic
983402442 4:167281980-167282002 GCCCTGCTTCAGCTCGCGCAAGG + Intergenic
983407577 4:167349381-167349403 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
983716638 4:170788833-170788855 GCCCTGCTTCAGCTCACGCACGG + Intergenic
983798950 4:171903289-171903311 GCCCTGCTTCAGCTCGCGCACGG - Intronic
983899897 4:173122651-173122673 CCCATGCCTCATCTGGCTCATGG - Intergenic
984705277 4:182843260-182843282 CCCACCCCTCCGCTCCTGCAAGG + Intergenic
985272064 4:188203125-188203147 CACATTCCTCAGCTACAGCAGGG - Intergenic
985658551 5:1144263-1144285 GCCATGCCCAAGCTCCCACAAGG + Intergenic
985690485 5:1308645-1308667 CCCCTGCCTCTGCTCCTACAGGG + Intergenic
985725398 5:1513405-1513427 CCGAGGGCTCAGCTCCTGCAAGG + Intronic
985727731 5:1524573-1524595 CTCAGGCCTCAGGCCCCGCAGGG + Intergenic
985989301 5:3542394-3542416 TCCATGACTCAGCTCTCTCATGG - Intergenic
986227349 5:5828272-5828294 CCCATGCCTCAGCTGGCCCTGGG - Intergenic
986573295 5:9187842-9187864 CTCAGGACTCAGCTGCCGCAGGG - Intronic
988739403 5:34055279-34055301 CCCATGCCATAGCTACCACATGG + Intronic
989055548 5:37363020-37363042 CTCCTGCCTCAGCTCCCGAGTGG + Intronic
989219062 5:38934747-38934769 CACCTGCCTCAGCTTCCCCAAGG + Exonic
990338899 5:54802776-54802798 CTCATGCCTCTTCTCGCGCAGGG + Intergenic
991703123 5:69333921-69333943 CCGAAGCCGCACCTCCCGCATGG + Intergenic
992148821 5:73880398-73880420 GCCCTGCTTCAGCTCACGCATGG + Intronic
993123101 5:83799461-83799483 GCCGTGCTTCAGCTCACGCACGG + Intergenic
993511049 5:88771856-88771878 CCATTCCCTCAGCTCCCACAGGG - Intronic
993663637 5:90668456-90668478 ACCCTGCTTCGGCTCCCGCATGG + Intronic
993798786 5:92302804-92302826 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
995361423 5:111302391-111302413 GCCCTGCTTCGGCTCCCGCACGG - Intronic
996956413 5:129188090-129188112 TCCATGCCTTAGCTCTGGCATGG + Intergenic
997187157 5:131893557-131893579 GCCCTGCTTCAGCTCACGCATGG + Intronic
998149885 5:139750830-139750852 CCCAGGCCTCAGATCCAGCAAGG - Intergenic
999631051 5:153571861-153571883 CCCATGCCTCAGGTCCCCAGAGG + Intronic
1000544127 5:162578193-162578215 ACCCTGCTTCAGCTCGCGCACGG - Intergenic
1002533977 5:179866020-179866042 CCCATGCCACACCTCCTGCCTGG + Intronic
1002682244 5:180975660-180975682 CCCAAGCCTCAGCTGCTCCATGG + Intergenic
1006424050 6:33952863-33952885 CTCCTGCCTCAGCTTCCACAGGG + Intergenic
1006595782 6:35191888-35191910 CCCTTCCCTCAGCTCCGCCATGG + Intergenic
1006644866 6:35509154-35509176 CCCCTGCCTCTGCTCCCTGAAGG + Intronic
1007015038 6:38457111-38457133 CCCATGACTGAGCTCCAGCCAGG - Intronic
1007857264 6:44870794-44870816 GCCCTGCTTCAGCTCGCGCAGGG - Intronic
1007956049 6:45918776-45918798 CCCATACCTTAGCACCAGCAAGG + Intronic
1008101067 6:47391980-47392002 CCCAGGCCTTAGCTCCTGGATGG - Intergenic
1008349858 6:50477698-50477720 ACCCTGCTTCAGCTCACGCATGG - Intergenic
1009166801 6:60350712-60350734 GCCCTGCCTCGGCTCACGCACGG + Intergenic
1009254319 6:61363220-61363242 GCCCTGCTTCAGCTCGCGCATGG + Intergenic
1011315585 6:86027334-86027356 ACCCTGCTTCAGCTCGCGCACGG + Intergenic
1012852665 6:104465685-104465707 CCCAAGCCTCAGTTTCCACAGGG + Intergenic
1013014685 6:106150510-106150532 TGCATGCCTCAGCTCCTGCAAGG + Intergenic
1013035152 6:106375137-106375159 CTCCTGCCTCAGCTTCCCCAAGG - Intergenic
1014387289 6:120818087-120818109 ACCCTGCTTCAGCTCGCGCATGG - Intergenic
1015432537 6:133147926-133147948 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1016305881 6:142682979-142683001 CCCAAGCCTCAGCTCCCAGTTGG - Intergenic
1017323580 6:153120600-153120622 CCCATAGCACAGCTCCCGCCCGG + Intronic
1017350541 6:153436411-153436433 CACATGCCTGAGCTCCTTCAAGG - Intergenic
1018146545 6:160895851-160895873 CACATGCCTGAGCTCCTTCAAGG + Intergenic
1018749271 6:166789033-166789055 GCCCTGCTTCAGCTCGCGCACGG - Intronic
1019407051 7:889341-889363 CCCAGGCCTCAGGTCCCGTATGG - Intronic
1020536534 7:9404602-9404624 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1021753520 7:23828560-23828582 GCCCTGCTTCAGCTCACGCATGG + Intronic
1021831691 7:24618681-24618703 ACCAAGCCTCCGCTCCCACAAGG + Intronic
1022082896 7:27041549-27041571 CCCAAGCCCCAGTTCCCACAGGG + Intergenic
1022108123 7:27211173-27211195 CCCATGGCTCTGCTCCCCTAGGG + Intergenic
1022374594 7:29801722-29801744 CCCCTGCCTCACATCCCACAAGG + Intergenic
1023968520 7:44975934-44975956 CCCAGGCCTCAGCTGCAGCCTGG + Intronic
1024459003 7:49640344-49640366 CCCATGTCACAGATCCTGCAAGG - Intergenic
1024699325 7:51890067-51890089 GCCCTGCTTCAGCTCGCGCATGG - Intergenic
1025097322 7:56106377-56106399 CCGAAGCCGCACCTCCCGCATGG - Exonic
1026653033 7:72232179-72232201 AGCATGCATCAGCTCCGGCAAGG + Intronic
1026893348 7:73996047-73996069 CCCATGACTAAGCTGCCTCAGGG + Intergenic
1027201133 7:76064479-76064501 CCCAACCCTGAGCTCTCGCAGGG - Intronic
1027276975 7:76567176-76567198 GCCCTGCTTCAGCTCACGCACGG + Intergenic
1027509074 7:79056147-79056169 CTCCTGCCTCAGCCCCCGAAAGG - Intronic
1028537863 7:91909528-91909550 GCCCTGCTTCAGCTCACGCACGG + Intergenic
1029421607 7:100474733-100474755 CCAATGCCCCAGCTCCCACTGGG + Intronic
1032082418 7:128866281-128866303 ACCATGCCTCACCTCACACAGGG - Intronic
1033093347 7:138407058-138407080 CCCAAGCCTCAGTTTCCACAGGG + Intergenic
1033150514 7:138910805-138910827 CCTCTGCCTCAGCTCCCACCTGG + Intronic
1034941604 7:155234246-155234268 CCCATGCCACAGCTGCCTCTTGG - Intergenic
1034945514 7:155259395-155259417 CCCATCCCTCAGCCTCCACACGG - Intergenic
1035341941 7:158167808-158167830 CCCATGCCCCAGCATCAGCATGG - Intronic
1035639538 8:1173852-1173874 GCCCTGCTTCGGCTCCCGCACGG + Intergenic
1036021813 8:4854559-4854581 GCCCTGCTTCAGCTCACGCACGG - Intronic
1037914872 8:22766936-22766958 CCCATGCCTCAGTTTCCTCATGG + Intronic
1038415186 8:27389816-27389838 CTCAGCCCTCAGTTCCCGCAGGG - Intronic
1039300238 8:36201219-36201241 GCCCTGCTTCAGCTCGCGCATGG + Intergenic
1039767597 8:40647221-40647243 GCCCTGCTTCAGCTCACGCACGG - Intronic
1039956016 8:42207673-42207695 GGCCTGCCTCAGCTCCCTCATGG - Exonic
1041171837 8:55150531-55150553 CCCATTCCTCAGCTCACCCCCGG + Intronic
1041999203 8:64102389-64102411 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1042870507 8:73393837-73393859 CTCCTGCCTCAGCTTCCCCAAGG + Intergenic
1043119739 8:76308266-76308288 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1043271490 8:78339579-78339601 GCCATGCCTCAGCTATTGCAAGG - Intergenic
1043514195 8:80981135-80981157 CCCCGGCCTCAGCACCCTCATGG + Intronic
1044968379 8:97595544-97595566 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1047841617 8:128760008-128760030 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1048566568 8:135605820-135605842 CCAATGTCTCAGCTTCCTCAAGG + Intronic
1049425849 8:142537564-142537586 CCCAGTCCTCAGCCCCTGCAGGG + Intronic
1049844538 8:144793449-144793471 ACCCTGCCTCAGCCCCTGCAGGG - Intergenic
1051002976 9:12307633-12307655 TCCATGCCTCGGATTCCGCAAGG - Intergenic
1051252502 9:15175809-15175831 CCAAGGCCTCATCTCCTGCATGG - Intronic
1051917584 9:22226303-22226325 GCCCTGCTTCAGCTCACGCACGG + Intergenic
1052373334 9:27690677-27690699 GCCCTGCTTCAGCTCACGCACGG - Intergenic
1054886540 9:70204901-70204923 GCCCTGCTTCAGCTCGCGCATGG + Intronic
1055741171 9:79391318-79391340 CCGAAGCCGCACCTCCCGCATGG + Intergenic
1056484482 9:87042034-87042056 GCCCTGCTTCAGCTCGCGCACGG - Intergenic
1057859045 9:98625169-98625191 CCCATGCCCCAGTTGCCACACGG + Intronic
1059921932 9:119169275-119169297 GCCCTGCTTCAGCTCGCGCACGG - Intronic
1061840036 9:133353373-133353395 CCCCTGCCTCCACTCCCTCAAGG + Intronic
1062015996 9:134291695-134291717 CCCAAGCCTCTCCTCCCCCAGGG + Intergenic
1062188129 9:135229439-135229461 CCCAGGCCCCTCCTCCCGCAGGG - Intergenic
1062458293 9:136651189-136651211 TCCATGCCGCAGCTCCTGCCAGG + Intergenic
1203790963 EBV:151283-151305 CCCGTGCCCCAGCTCCGTCACGG + Intergenic
1186805647 X:13138296-13138318 GCCCTGCTTCAGCTCGCGCACGG + Intergenic
1188852760 X:35151412-35151434 CACATTCCTCAGCTGCAGCAGGG - Intergenic
1190403199 X:50060303-50060325 GCCCTGCTTCAGCTCGCGCACGG - Intronic
1190757704 X:53415078-53415100 TCCATGGATCAGGTCCCGCAGGG + Exonic
1191136465 X:57070095-57070117 CCCATCCCTCGCCTCCCGCCTGG + Intergenic
1191649273 X:63519279-63519301 ACCCTGCCTCTGCTCGCGCATGG - Intergenic
1191708147 X:64115851-64115873 GCCATGCTTCGGCTCGCGCACGG + Intergenic
1192294084 X:69828546-69828568 CCCTTGCTTCGGCTCGCGCACGG + Intronic
1192843213 X:74878835-74878857 GCCCTGCTTCAGCTCGCGCATGG + Intronic
1192906884 X:75560997-75561019 GCCCTGCTTCAGCTCGCGCATGG + Intergenic
1193617181 X:83703541-83703563 CTCATAGCTCAGCTCCCGCTTGG + Intergenic
1194271882 X:91825521-91825543 GCCCTGCTTCAGCTCGCGCACGG + Intronic
1194306555 X:92256288-92256310 ACCCTGCTTCAGCTCGCGCACGG + Intronic
1194762880 X:97815366-97815388 CCCATGCCTCTTCTCCCCAAGGG - Intergenic
1195616728 X:106918345-106918367 CCCAGGCCTGAGCTCAGGCATGG + Intronic
1196473280 X:116052745-116052767 GCCCTGCTTCAGCTCGCGCAAGG + Intergenic
1200758099 Y:7010688-7010710 CACCTGCCTCAGCTCCCAAAGGG - Intronic
1201614793 Y:15885593-15885615 ACCATGCTTCAGCTCACGCATGG - Intergenic
1201645340 Y:16223835-16223857 GCCCTGCTTCAGCTCCTGCATGG + Intergenic
1201657473 Y:16361487-16361509 GCCCTGCTTCAGCTCCTGCATGG - Intergenic