ID: 962319829

View in Genome Browser
Species Human (GRCh38)
Location 3:134381476-134381498
Sequence TTGGGAGAGCAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962319819_962319829 13 Left 962319819 3:134381440-134381462 CCTCTGAGTCTCCTGCCTGGAGG No data
Right 962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG No data
962319823_962319829 -2 Left 962319823 3:134381455-134381477 CCTGGAGGCTGGCAGCCAGCATT No data
Right 962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG No data
962319822_962319829 2 Left 962319822 3:134381451-134381473 CCTGCCTGGAGGCTGGCAGCCAG No data
Right 962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG No data
962319817_962319829 25 Left 962319817 3:134381428-134381450 CCAGTGAAGGATCCTCTGAGTCT No data
Right 962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962319829 Original CRISPR TTGGGAGAGCAGAATGAGGA GGG Intergenic
No off target data available for this crispr