ID: 962319937

View in Genome Browser
Species Human (GRCh38)
Location 3:134382030-134382052
Sequence GGGCGCTTGCGCCAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962319932_962319937 0 Left 962319932 3:134382007-134382029 CCAGGCCTTGTCAGGACTGGTAT No data
Right 962319937 3:134382030-134382052 GGGCGCTTGCGCCAGGAAGCTGG No data
962319928_962319937 18 Left 962319928 3:134381989-134382011 CCACTGAGGTGGCTCATTCCAGG No data
Right 962319937 3:134382030-134382052 GGGCGCTTGCGCCAGGAAGCTGG No data
962319926_962319937 26 Left 962319926 3:134381981-134382003 CCTTTTTCCCACTGAGGTGGCTC No data
Right 962319937 3:134382030-134382052 GGGCGCTTGCGCCAGGAAGCTGG No data
962319935_962319937 -5 Left 962319935 3:134382012-134382034 CCTTGTCAGGACTGGTATGGGCG No data
Right 962319937 3:134382030-134382052 GGGCGCTTGCGCCAGGAAGCTGG No data
962319927_962319937 19 Left 962319927 3:134381988-134382010 CCCACTGAGGTGGCTCATTCCAG No data
Right 962319937 3:134382030-134382052 GGGCGCTTGCGCCAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962319937 Original CRISPR GGGCGCTTGCGCCAGGAAGC TGG Intergenic