ID: 962322989 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:134406770-134406792 |
| Sequence | GAGACGCGCCGCGGCAGCGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 962322987_962322989 | -5 | Left | 962322987 | 3:134406752-134406774 | CCGGGCAGGTGCGCGGGGGAGAC | No data | ||
| Right | 962322989 | 3:134406770-134406792 | GAGACGCGCCGCGGCAGCGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 962322989 | Original CRISPR | GAGACGCGCCGCGGCAGCGC CGG | Intergenic | ||