ID: 962322989

View in Genome Browser
Species Human (GRCh38)
Location 3:134406770-134406792
Sequence GAGACGCGCCGCGGCAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962322987_962322989 -5 Left 962322987 3:134406752-134406774 CCGGGCAGGTGCGCGGGGGAGAC No data
Right 962322989 3:134406770-134406792 GAGACGCGCCGCGGCAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962322989 Original CRISPR GAGACGCGCCGCGGCAGCGC CGG Intergenic