ID: 962323370

View in Genome Browser
Species Human (GRCh38)
Location 3:134409608-134409630
Sequence CTCGGTTGGTTCATTTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962323370_962323374 0 Left 962323370 3:134409608-134409630 CCAGAATAAATGAACCAACCGAG No data
Right 962323374 3:134409631-134409653 AATAAACTGGAAAAGTAGAATGG No data
962323370_962323375 19 Left 962323370 3:134409608-134409630 CCAGAATAAATGAACCAACCGAG No data
Right 962323375 3:134409650-134409672 ATGGAATTTTCAAATTAACAAGG No data
962323370_962323377 21 Left 962323370 3:134409608-134409630 CCAGAATAAATGAACCAACCGAG No data
Right 962323377 3:134409652-134409674 GGAATTTTCAAATTAACAAGGGG No data
962323370_962323376 20 Left 962323370 3:134409608-134409630 CCAGAATAAATGAACCAACCGAG No data
Right 962323376 3:134409651-134409673 TGGAATTTTCAAATTAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962323370 Original CRISPR CTCGGTTGGTTCATTTATTC TGG (reversed) Intergenic
No off target data available for this crispr