ID: 962332686

View in Genome Browser
Species Human (GRCh38)
Location 3:134493467-134493489
Sequence ACATGGGAACCTTTTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962332686 Original CRISPR ACATGGGAACCTTTTTCTTT AGG Intronic
900941369 1:5800718-5800740 ACATGGGAACATTTTTAAATAGG + Intergenic
903255238 1:22093452-22093474 ATATGGGATACATTTTCTTTAGG + Intergenic
906735947 1:48128179-48128201 ACATAGTTATCTTTTTCTTTTGG - Intergenic
908022846 1:59916067-59916089 ATATGGGAACCTTTTTAGCTTGG - Exonic
909215505 1:72882541-72882563 AAAAGGGAACAGTTTTCTTTTGG + Intergenic
910536366 1:88302513-88302535 ACATAGGAACCATTTTGTTCTGG + Intergenic
910903532 1:92148731-92148753 ACATGGAAACATTCTTCTTTTGG - Intergenic
911344782 1:96683182-96683204 ACCTGGGAATCTGTTACTTTGGG - Intergenic
912775690 1:112505078-112505100 ACAGTGGACCCTTCTTCTTTGGG + Intronic
916316673 1:163456136-163456158 ACATTATATCCTTTTTCTTTAGG - Intergenic
918694631 1:187529620-187529642 ACATGGCAATCTCTTTCTTAAGG - Intergenic
921348224 1:214208886-214208908 ACTTGGGTGCCTTTGTCTTTTGG + Intergenic
921438968 1:215161374-215161396 ACTTGGGAAACTTTTTTTATGGG + Intronic
924482107 1:244445115-244445137 AACTGGCAACCTTTTTCTTTAGG - Intronic
1063656656 10:7997019-7997041 ACATGGGAATCTGTTTCTCAAGG + Intronic
1065337878 10:24673412-24673434 ACATGGGTTCATGTTTCTTTTGG - Intronic
1065562427 10:26977207-26977229 AAATGGGATCTGTTTTCTTTGGG - Intergenic
1066040355 10:31543157-31543179 TCATGTGAACCCTGTTCTTTTGG + Intergenic
1066284137 10:33947741-33947763 AGATGGCAATCTTTTTTTTTAGG - Intergenic
1067749171 10:48958594-48958616 ATATAGGGACCTTTTTTTTTAGG + Intronic
1069036801 10:63654230-63654252 AGATGGGAATTTTTGTCTTTTGG - Intergenic
1069398479 10:68016229-68016251 GAATGTAAACCTTTTTCTTTTGG + Intronic
1072551957 10:96485883-96485905 ACATCGGACACTTTTTCTTTGGG - Intronic
1072676613 10:97471026-97471048 CCTTGGGAACTTTTGTCTTTAGG + Intronic
1073907050 10:108294692-108294714 ATATGAGTACCTTTTTCTTAGGG + Intergenic
1075269510 10:121036321-121036343 CCATGGGAATCCTTTTCTTGAGG + Intergenic
1075934273 10:126326379-126326401 ACAGGGGGTCCTTTCTCTTTGGG + Intronic
1076248444 10:128966007-128966029 ACTTGGGAACCTTTGGCTCTTGG - Intergenic
1076527969 10:131124300-131124322 ACCCTGGAACCTTGTTCTTTTGG - Intronic
1077771430 11:5223388-5223410 ACATAGTTACCTTTTTCTTGTGG + Intergenic
1077942484 11:6858001-6858023 ATATTGTAACCTATTTCTTTGGG + Intergenic
1080551630 11:33377340-33377362 ATAGCGGAACCCTTTTCTTTTGG + Intergenic
1080661719 11:34301885-34301907 ACAAGCGATCCTTTTGCTTTAGG - Intronic
1081189799 11:40089463-40089485 ACCTGGGAGCGTTTCTCTTTTGG - Intergenic
1081707764 11:45195082-45195104 GCATGGAAACCTGTTTCTTTAGG + Intronic
1088475326 11:110232137-110232159 ACTGTGAAACCTTTTTCTTTAGG + Intronic
1088703642 11:112439510-112439532 ACATTGGCATCCTTTTCTTTTGG + Intergenic
1090240976 11:125181636-125181658 ACATGGGGAACTATTTCTATGGG - Intronic
1090359699 11:126163774-126163796 CTATGGGAACCTTTGCCTTTGGG - Intergenic
1091056239 11:132421513-132421535 TGATGGGAACATTTTACTTTGGG + Intronic
1091422144 12:351003-351025 ACTTGGGAAACAGTTTCTTTCGG - Intronic
1091595597 12:1876775-1876797 ACATGGGATCTGTTTCCTTTGGG + Intronic
1093143029 12:15532435-15532457 ACATGGGACAATTTGTCTTTTGG + Intronic
1093843228 12:23932056-23932078 TCATGGAAACTTTTTTTTTTTGG - Intronic
1093953194 12:25187721-25187743 CCTTGGGGACCTTTTTGTTTTGG - Intronic
1094327880 12:29259512-29259534 ATATGGGAACTTTATTCTTTAGG - Intronic
1095412615 12:41940552-41940574 AAAATGGAACCTATTTCTTTAGG - Intergenic
1096187518 12:49591415-49591437 AGGTGGGCAGCTTTTTCTTTCGG - Intronic
1096552632 12:52383395-52383417 ACATGGGCACCTTTTTCCTCAGG + Intronic
1096729682 12:53598391-53598413 ACATTGCTACCTCTTTCTTTTGG - Intronic
1099311123 12:81024915-81024937 TAATGGTAACCTTTTCCTTTGGG + Intronic
1100741173 12:97595300-97595322 AAGTGGGAACCTTTTGTTTTGGG + Intergenic
1101086043 12:101237663-101237685 AAATGGGTGCTTTTTTCTTTAGG + Intergenic
1102133778 12:110555126-110555148 ACATGTGAAACTATTTCTCTGGG + Intronic
1103593018 12:122005610-122005632 ACCTGGGAACCTCTTTCTGCAGG + Intergenic
1106316657 13:28600210-28600232 ATATGAGCAACTTTTTCTTTTGG - Intergenic
1108596823 13:51956501-51956523 ACCCGGGAACCTTTCTCTGTTGG - Intronic
1109133484 13:58618217-58618239 AAATAAGAACCTTTTTCTTAGGG - Intergenic
1109386031 13:61629912-61629934 ACATAGCAAAATTTTTCTTTTGG + Intergenic
1110957617 13:81575595-81575617 ACATAAGAATTTTTTTCTTTTGG + Intergenic
1111242370 13:85492190-85492212 ACATTGTAACCTATTTGTTTAGG + Intergenic
1111352932 13:87055797-87055819 AAATGTAAACCATTTTCTTTTGG - Intergenic
1111958357 13:94782392-94782414 TCATGGGAACTCTTTCCTTTTGG - Intergenic
1112911588 13:104492047-104492069 ACATGGGCACGTTTTCCTCTTGG + Intergenic
1113270838 13:108672327-108672349 AAATGGAAACTTTTTTCTTATGG - Intronic
1115267913 14:31520523-31520545 ACATGAAAAGCTTTTTATTTTGG + Intronic
1119920160 14:78439233-78439255 ACCAGGGTACCTCTTTCTTTGGG + Intronic
1120463678 14:84828294-84828316 CTATGAAAACCTTTTTCTTTTGG - Intergenic
1121843221 14:97151751-97151773 TCACGGGAAGGTTTTTCTTTCGG + Intergenic
1124954295 15:34349887-34349909 GCATGGGATCCATTTGCTTTGGG + Intronic
1127124611 15:55799975-55799997 ACATGGCAGCCATTTTGTTTTGG + Intergenic
1128530112 15:68439371-68439393 ACATTTTAATCTTTTTCTTTGGG + Intergenic
1130189505 15:81719892-81719914 ATATTTGAACCTGTTTCTTTGGG + Intergenic
1130216259 15:81973257-81973279 ATATGGTAAACTTTTCCTTTAGG - Intergenic
1130723192 15:86410191-86410213 ACTGAGGAAGCTTTTTCTTTTGG + Intronic
1131425817 15:92344647-92344669 AAATGGGATCTTTTCTCTTTGGG + Intergenic
1133183383 16:4076412-4076434 AAACTGGAGCCTTTTTCTTTGGG - Intronic
1134753744 16:16648100-16648122 GCCTAGGAACCTTTTTCCTTTGG - Intergenic
1134992315 16:18710943-18710965 GCCTAGGAACCTTTTTCCTTTGG + Intergenic
1137335935 16:47549001-47549023 ACGTGGAAACCTTTTTCTTTAGG + Intronic
1137743150 16:50800709-50800731 ATATGGGAAGATTTTTCTCTGGG + Exonic
1138848813 16:60600989-60601011 ACATCAGAACTTTTTTCTTGGGG + Intergenic
1139015077 16:62679742-62679764 ATGTGGGAACTTGTTTCTTTTGG - Intergenic
1139970787 16:70773417-70773439 AAATTCCAACCTTTTTCTTTTGG + Intronic
1143069440 17:4278198-4278220 CCATGGAAACCTGTTTCCTTAGG - Intronic
1145187341 17:20806349-20806371 ACATGGGAACCCTTTTGATGTGG + Intergenic
1146043502 17:29481604-29481626 CCTTGGGAGCCTCTTTCTTTTGG + Intronic
1147937713 17:44022786-44022808 AAATGGCATGCTTTTTCTTTCGG + Intronic
1148645093 17:49215484-49215506 ACATGGAAAGCTTTTTTTTTTGG + Intronic
1148979094 17:51555808-51555830 TCATGGGAGTCTATTTCTTTTGG + Intergenic
1149222577 17:54432654-54432676 AAATGGGAACCATTCTCTTAGGG - Intergenic
1150583772 17:66499126-66499148 TCATAGGAATCTTTATCTTTAGG - Intronic
1154357875 18:13636069-13636091 GGATGAGAACATTTTTCTTTGGG - Intronic
1155116936 18:22778109-22778131 ACATGGTCACCTTCTTCTCTGGG + Intergenic
1156075719 18:33276578-33276600 CCTTGGAAACCTTTTTCTTTTGG - Intronic
1156891131 18:42190282-42190304 ACTTGGGTACCATTTTCTGTGGG + Intergenic
1159314631 18:66756024-66756046 ATATGGGAACCTCTTTATCTTGG + Intergenic
1163461668 19:17441707-17441729 ACATGGGGGACTTTTTTTTTTGG + Intronic
1163909318 19:20175702-20175724 ACATGGGAGACTTTTCATTTTGG - Intronic
1163971866 19:20806019-20806041 ACATTGAAACATTTTGCTTTGGG - Exonic
926946665 2:18195448-18195470 ACATGCGAAGTTTTTTCCTTGGG - Intronic
929244249 2:39684948-39684970 TCACTGGAACCTTTTTCTCTTGG + Intronic
929349607 2:40933970-40933992 CCAAGGGAACAATTTTCTTTGGG + Intergenic
930950376 2:57135576-57135598 AGATGGAAAGCTTTTTTTTTTGG + Intergenic
933022453 2:77211006-77211028 ACAGGGGAGCTTTTTTCTGTTGG - Intronic
936078941 2:109419100-109419122 TCATGGGACCAATTTTCTTTAGG + Intronic
937136542 2:119558401-119558423 GCCTGGGAAACTTTTTGTTTGGG + Intronic
937679646 2:124630088-124630110 ACTTGGGATTCTTTTTTTTTTGG - Intronic
940256011 2:151729943-151729965 ACATGGAAATTTTTTTCTTATGG + Intronic
940898659 2:159105846-159105868 CCATTGGTAACTTTTTCTTTTGG + Intronic
943283594 2:185968601-185968623 TCATGGGAACATTTTTGTGTGGG - Intergenic
943518536 2:188918032-188918054 ACATGGGTAACTTTCACTTTTGG + Intergenic
943737375 2:191371683-191371705 ACTGGGGAACCTGTTACTTTGGG - Intronic
944831954 2:203541884-203541906 TCATTGCAACCTTTTTCTATAGG + Intergenic
946009201 2:216551436-216551458 ACAATGGAATATTTTTCTTTGGG - Intronic
946050795 2:216860675-216860697 ACATTGCCACCTGTTTCTTTGGG + Intergenic
946181162 2:217949836-217949858 GCAAGGGAACATTTTTCTTGGGG + Intronic
948587815 2:239030601-239030623 ACAAGGGAACTTTTTGGTTTGGG - Intergenic
1169044841 20:2526977-2526999 AAATGGGAAGATTTTTCTCTGGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173410557 20:42805887-42805909 ACATGCTATCCTTGTTCTTTTGG - Intronic
1174522814 20:51144823-51144845 AAATGGGAAGGTTTTGCTTTCGG + Intergenic
1176330283 21:5543068-5543090 ACCTGGGATTCTTTTTCATTTGG - Intergenic
1176397474 21:6277883-6277905 ACCTGGGATTCTTTTTCATTTGG + Intergenic
1176439683 21:6711221-6711243 ACCTGGGATTCTTTTTCATTTGG - Intergenic
1176463945 21:7038290-7038312 ACCTGGGATTCTTTTTCATTTGG - Intergenic
1176487506 21:7420069-7420091 ACCTGGGATTCTTTTTCATTTGG - Intergenic
1177928764 21:27252612-27252634 ACATGGGTACCATTTTTTTGTGG - Intergenic
1178288619 21:31347118-31347140 ACAGGGGACCCTTTATTTTTAGG - Intronic
1178480152 21:32973487-32973509 TCATGGAAACCTTGCTCTTTGGG + Intergenic
1179000169 21:37450336-37450358 ATGTGGGAACCTTTTTCATCAGG + Intronic
1179126276 21:38594031-38594053 ACAAGGAAACCTTTTCCTGTTGG - Intronic
1179973698 21:44850837-44850859 ACATGAGAATCTTTTTCCCTTGG - Exonic
1184534923 22:45079965-45079987 ACATGTGAACATTTTCCATTTGG - Intergenic
1184874439 22:47264413-47264435 ACATTTCAGCCTTTTTCTTTTGG + Intergenic
949122921 3:409240-409262 ACGTGATTACCTTTTTCTTTTGG + Exonic
949322831 3:2830468-2830490 ACATGCAGAGCTTTTTCTTTTGG + Intronic
949610787 3:5701463-5701485 ACCGGAGAAGCTTTTTCTTTTGG - Intergenic
949671922 3:6407881-6407903 ACAGGAAAACATTTTTCTTTAGG - Intergenic
950092285 3:10304566-10304588 TCATGGGAACCTGTTTGGTTTGG - Intronic
950854656 3:16093814-16093836 GCGTGGCAACCTTTGTCTTTAGG + Intergenic
951154207 3:19329575-19329597 AGAAGGGAACGTCTTTCTTTAGG + Intronic
951671383 3:25186866-25186888 ACAGGCTTACCTTTTTCTTTGGG - Intronic
952013244 3:28926693-28926715 TTGTGGGAACATTTTTCTTTTGG + Intergenic
952524979 3:34200500-34200522 AAATGGGACCCTGCTTCTTTTGG + Intergenic
958975642 3:100665509-100665531 ACTTGGGCACCTTTTTCTAGTGG + Intronic
959028292 3:101267845-101267867 AATTGGGAACCTTCTTTTTTGGG + Intronic
960275392 3:115723088-115723110 ACTTTCTAACCTTTTTCTTTAGG - Intergenic
960291612 3:115892257-115892279 ACATATGAACCTGTTTCTGTTGG - Intronic
961132207 3:124479575-124479597 ACTTAGGAACCATTTGCTTTAGG + Intronic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
962472651 3:135726163-135726185 ACATGTGCACATGTTTCTTTAGG + Intergenic
966898527 3:184463813-184463835 ACATTGGAACCTTTGCCTATAGG + Intronic
967612453 3:191523655-191523677 AAATGAGAAACTTTCTCTTTGGG - Intergenic
968045412 3:195621288-195621310 CCACAGGAACCTTTTTCCTTAGG - Intergenic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
971778789 4:31003831-31003853 AAATCAGAACCTTTTTTTTTCGG - Intronic
974005392 4:56551349-56551371 TTCTGGGACCCTTTTTCTTTGGG + Intronic
974229223 4:59088456-59088478 ACATGGGAAAGTGATTCTTTTGG + Intergenic
974408302 4:61505069-61505091 AAAGGGGAACCTTTGTCTGTCGG - Intronic
976046439 4:80953947-80953969 ATATGGGTCCCTTTTACTTTTGG - Intronic
979341471 4:119529517-119529539 ACATGGGAAACTCATTATTTTGG + Intronic
979938568 4:126729811-126729833 TTATTGTAACCTTTTTCTTTTGG + Intergenic
981874894 4:149530133-149530155 AGATGGGGACATTTTTCTTTGGG - Intergenic
983461476 4:168029625-168029647 ACAATGAGACCTTTTTCTTTTGG - Intergenic
983926900 4:173412418-173412440 ACATGGGAGCCATTTTATTGAGG - Intergenic
984187120 4:176558719-176558741 ACATGGGAAATTTTTGGTTTGGG + Intergenic
984942096 4:184941848-184941870 ACATGGGACCCTGCTTCTCTAGG + Intergenic
986064352 5:4221081-4221103 ACAAGGGAACCTCTCACTTTTGG - Intergenic
988137677 5:27195886-27195908 ACATTCAAAACTTTTTCTTTTGG + Intergenic
988822474 5:34901223-34901245 ACATTGGAAGTTTTTTTTTTTGG - Intergenic
989041781 5:37236942-37236964 ACATGGGAACATGTTTCTCATGG + Intronic
989990429 5:50757508-50757530 ACCTGGAAACATTTTTATTTGGG + Intronic
990162320 5:52956058-52956080 ACAATGGCACTTTTTTCTTTTGG - Exonic
990209723 5:53469553-53469575 ACTTGGAAAGCTTTTCCTTTAGG - Intergenic
991066854 5:62433081-62433103 CTGTGGGAACCTTTTTATTTTGG + Intronic
992704674 5:79378751-79378773 ACAAGGGAACCTTTCATTTTTGG - Intronic
993693301 5:91029039-91029061 ACATTAGAACTTTTTTCTTTAGG + Intronic
995025060 5:107410552-107410574 ACCTGGGAACCCTTTTTTTATGG - Intronic
995589307 5:113682710-113682732 ACATGGAATCCTTTTTACTTTGG - Intergenic
998633158 5:143923480-143923502 AGATGGGAAGCTATTTCTTAAGG - Intergenic
1000696561 5:164392764-164392786 AGATGTGAAACATTTTCTTTTGG - Intergenic
1000780675 5:165476730-165476752 ACAAGGGAATCTTTGTCTCTCGG + Intergenic
1002788366 6:420835-420857 AGATGGGAGCCAATTTCTTTAGG + Intergenic
1004074293 6:12330953-12330975 ACAAGAGAACTTATTTCTTTGGG + Intergenic
1005980319 6:30831435-30831457 ACAAGGGAACCCCTTTCTGTTGG - Intergenic
1008422170 6:51314115-51314137 CTATGGGAACCAATTTCTTTTGG + Intergenic
1008589124 6:52975677-52975699 ACATGGGAACCTCTTTTTGTTGG + Intergenic
1008699734 6:54084591-54084613 AGCTGGGAACCTTTTTAATTTGG + Intronic
1008850806 6:56018833-56018855 CCATGGGAGCCTTGTTCTCTTGG + Intergenic
1010595820 6:77762808-77762830 AAATGGAAATCTTTTTCTTTTGG + Intronic
1011470165 6:87701173-87701195 ACAGGGACATCTTTTTCTTTGGG - Intronic
1011507087 6:88057362-88057384 TCATGGAATCCTTTTTCTTATGG + Intronic
1012389735 6:98723957-98723979 GCATGGAAAGCTTTGTCTTTGGG - Intergenic
1013384643 6:109613934-109613956 ACATTCAAACATTTTTCTTTGGG + Intronic
1014805439 6:125824331-125824353 ACTTGGGAGACTTTTGCTTTTGG + Intronic
1015077562 6:129178996-129179018 ACATGGCAACTTTTTACTATGGG - Intronic
1020041853 7:5009756-5009778 ACATGTGTACCTATTTCTGTTGG + Intronic
1020655296 7:10922049-10922071 GGATGGGAATCTTTATCTTTTGG - Intergenic
1020840294 7:13209258-13209280 ACATGGGACCCTTCTCATTTTGG + Intergenic
1021260079 7:18444702-18444724 ACATTGGCACTTTTTTATTTCGG - Intronic
1022434960 7:30374242-30374264 ACATAGCAACTTTTTTTTTTTGG - Intronic
1023231360 7:38033599-38033621 ATCTGGGATCCTTTTTTTTTAGG + Intergenic
1023236016 7:38088302-38088324 ACATGGGCATTTTTTTCTTTTGG - Intergenic
1023385137 7:39649103-39649125 AAATGGCAACCTCATTCTTTAGG - Intronic
1023669131 7:42557680-42557702 TCATGGGCACATTTTCCTTTTGG - Intergenic
1024208559 7:47184366-47184388 ACATGGGCACTTGTCTCTTTTGG - Intergenic
1024529400 7:50378876-50378898 ACCTGGGACCCTTTATATTTAGG - Intronic
1025088675 7:56044244-56044266 GCATGGGAATATTTTTCTTGAGG + Intronic
1025704736 7:63852621-63852643 CCATGGGAATATTTTTCTTGAGG + Intergenic
1025900775 7:65742745-65742767 CCATGGGAATATTTTTCTTGAGG + Intergenic
1026190691 7:68123543-68123565 ATCTGGGAATATTTTTCTTTTGG + Intergenic
1028175121 7:87647481-87647503 ACATTGCTACATTTTTCTTTTGG + Intronic
1028831269 7:95328735-95328757 ACATGGGAAACCTTTGCTCTTGG - Intergenic
1030537496 7:110787655-110787677 AAATAGGAATCTTTTTGTTTTGG - Intronic
1031515454 7:122692982-122693004 ACATGGGAAGATTTATCATTTGG - Intronic
1031633941 7:124079232-124079254 ACAGGGGTACCTTTGTCATTTGG + Intergenic
1035861764 8:3036795-3036817 ACATGGGATTCTTTTCTTTTTGG + Intronic
1036450195 8:8859351-8859373 ACATGGTGAACTTTTTTTTTTGG - Intronic
1037181223 8:16007562-16007584 ACATGAGATCCTTTTTATTTGGG + Intergenic
1038337487 8:26657030-26657052 ACATGGGAGCTTTTTATTTTCGG + Exonic
1038997219 8:32937477-32937499 ACTTTGTAACCTTTTTTTTTAGG - Intergenic
1039087382 8:33793423-33793445 ACATCATAGCCTTTTTCTTTCGG + Intergenic
1040005871 8:42620393-42620415 ACATGGTCACCTTTATTTTTTGG + Intergenic
1040761229 8:50847455-50847477 ACAAGGTATCCTTTCTCTTTCGG + Intergenic
1042377903 8:68076788-68076810 CCAAAGCAACCTTTTTCTTTTGG - Intronic
1043587447 8:81785520-81785542 TCTTGGAAACATTTTTCTTTTGG - Intergenic
1044359598 8:91266367-91266389 ACATGGGATGCCTTTTATTTGGG + Intronic
1050489664 9:6174730-6174752 ACATTGGTATCCTTTTCTTTTGG - Intergenic
1051357183 9:16250341-16250363 GCATGGGTAACATTTTCTTTGGG - Intronic
1051738314 9:20226227-20226249 AAATGGGAAGCCTTTTCTTATGG - Intergenic
1053091073 9:35277249-35277271 AGATGGCATCCTTTTTCTTTGGG + Intronic
1056549228 9:87637724-87637746 ACTTGGGAACCATTTTCCTAAGG - Intronic
1057486124 9:95485763-95485785 ACATTAGCACCTTCTTCTTTAGG + Exonic
1059478599 9:114570277-114570299 ACATGGGAGACTTTTTCTTCAGG + Intergenic
1060473713 9:123969951-123969973 ACATTGGCACATTTTTCTGTAGG - Intergenic
1061229442 9:129305754-129305776 ACATGTGCACTTATTTCTTTTGG - Intergenic
1203431812 Un_GL000195v1:97258-97280 ACCTGGGATTCTTTTTCATTTGG + Intergenic
1186829207 X:13373874-13373896 ACAGGGGAAGCTTTTATTTTGGG - Intergenic
1187036527 X:15546021-15546043 CCATGAGCACCTTTTTATTTTGG + Intronic
1188348309 X:29095624-29095646 ACATGGTGACCTTAATCTTTTGG + Intronic
1188365897 X:29314667-29314689 CCAGTGGCACCTTTTTCTTTTGG + Intronic
1188653251 X:32658122-32658144 ACATGGGAATATTTATGTTTAGG - Intronic
1189565824 X:42240103-42240125 GCCTGGTAACCTTTTTCTGTTGG - Intergenic
1189606422 X:42682952-42682974 ACATTAGAATCTTTTCCTTTTGG + Intergenic
1193068221 X:77279926-77279948 ACATGGGAGACTTTTCATTTTGG + Intergenic
1193332310 X:80248720-80248742 AAATGGGAACCACTTTCCTTAGG + Intergenic
1193373272 X:80724974-80724996 TGATGGGAACATTTTTATTTGGG - Exonic
1193379818 X:80805962-80805984 AGATGGGATACTTTTTCTTGGGG - Intronic
1194041028 X:88942158-88942180 AAAAGGGAAGCTTTTTCTATAGG - Intergenic
1196581173 X:117380746-117380768 ACATGGGAGCATTTTTCTGGAGG - Intergenic
1197558128 X:127982720-127982742 ACATAAGAATTTTTTTCTTTTGG + Intergenic
1197658466 X:129143957-129143979 ACATAGGAAAATTTTTCTTGTGG - Intergenic
1197941147 X:131791914-131791936 ACATGGGAATGTTGTTATTTTGG + Intergenic
1198113558 X:133523704-133523726 ACATGAAGACCTTTTTCCTTAGG + Intergenic
1199995985 X:153027142-153027164 ACATTGGAACCATTTTCCTGAGG - Intergenic
1200001670 X:153065224-153065246 CCATGGGCATCTTTTTCTTGTGG + Intergenic
1201403195 Y:13625335-13625357 TCAAGGAAATCTTTTTCTTTTGG + Intergenic
1202075623 Y:21035355-21035377 ACAAGGGCAGCTTTTTTTTTAGG + Intergenic