ID: 962333320

View in Genome Browser
Species Human (GRCh38)
Location 3:134500560-134500582
Sequence TGGAGAAAAGGCAACACCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 1, 2: 7, 3: 18, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962333320 Original CRISPR TGGAGAAAAGGCAACACCGT TGG (reversed) Intronic
903609610 1:24600814-24600836 AGGAGAGAAGGCAACATCCTGGG - Intronic
905413324 1:37787512-37787534 TGGAGAAAAAGAAAGACCCTTGG - Intergenic
907745857 1:57212911-57212933 TACAGAAAAGGCAACACTGACGG + Intronic
907946294 1:59139514-59139536 TGGGGAAAAGGCCAGACAGTGGG - Intergenic
910516196 1:88062959-88062981 TGGAAAAAAAGCACCACTGTGGG + Intergenic
910751046 1:90631277-90631299 TAGAGAAAAGGGTACACTGTTGG + Intergenic
912930924 1:113960313-113960335 TTAACAAAAGGCAACACTGTTGG - Intronic
913524448 1:119677600-119677622 TTGGAAAAAGACAACACCGTGGG - Intronic
915005850 1:152635342-152635364 TGGAGAAAAGGGAACACTACTGG + Intergenic
916615900 1:166439120-166439142 TTGAGAAAAGGGAATACTGTTGG - Intergenic
917065976 1:171093789-171093811 TGGAGAAAAGGAAACACTGTTGG - Intronic
920131780 1:203737613-203737635 TGGAGCAAAGGCAACATGATAGG + Intronic
921958113 1:221004997-221005019 TGGACAAATGGCAAAACCATTGG + Intergenic
923939698 1:238808014-238808036 TAGAGAAAAGGCTACAGCATTGG + Intergenic
1063731971 10:8708228-8708250 CAGAGAAAAGGGAACACTGTTGG - Intergenic
1065325958 10:24551122-24551144 TGGAGAAAAGCCAAGGCCCTGGG + Intergenic
1066551984 10:36568664-36568686 TGGAGAAAAAGGAACACTTTTGG - Intergenic
1067428590 10:46227443-46227465 TGTACAAAAGGGAACACGGTGGG - Intergenic
1068024554 10:51627066-51627088 TGGAGAAAAGGAAGCAAGGTAGG + Intronic
1068283295 10:54904853-54904875 TGGAGAAAAGGGAAGAAGGTGGG + Intronic
1069297822 10:66868937-66868959 TGGAGAAAATGAAACACCATGGG + Intronic
1071253292 10:83842564-83842586 TCCAGAGAAGGCACCACCGTGGG + Intergenic
1076083696 10:127606388-127606410 TGGAGAAAAGGAACCACCCAGGG + Intergenic
1076176801 10:128374499-128374521 TGGAGAGAAGCCAATACTGTAGG - Intergenic
1076178634 10:128387989-128388011 TGGAGAGAAGCCAACACTGACGG - Intergenic
1079919205 11:26410771-26410793 TGTAGAATAGGCTACACCGAGGG + Intronic
1081730371 11:45367887-45367909 AGGAGAAAAGGAAACACAGATGG - Intergenic
1083387298 11:62321036-62321058 TGGAGAGAAGATAACACAGTTGG + Intergenic
1087031399 11:93708767-93708789 TGGTGAGAAGGGAACACCGTTGG - Intronic
1087279533 11:96194769-96194791 GGAAGAAAAGGCACCACCGAAGG + Intronic
1087571845 11:99937627-99937649 AGGAGAAAAGGGAAAACTGTGGG + Intronic
1088994539 11:114985154-114985176 GGGAGAAAAGGCACCTTCGTAGG + Intergenic
1089096923 11:115927164-115927186 TGGAGAACAGGCAGCACTCTGGG + Intergenic
1089250586 11:117157620-117157642 TTGAGAAAAGGAAACAGCATTGG + Intronic
1089384164 11:118057131-118057153 TGGAGAAAGGGCGACACTGAAGG + Intergenic
1090238414 11:125165588-125165610 TGGAGACAGGGGAACACCGGCGG + Intronic
1090425601 11:126605123-126605145 AGGAGAAAAGCCAAGAGCGTGGG - Intronic
1090794672 11:130124479-130124501 TGGAGAAAAGGGAAAACTCTTGG - Intronic
1091025027 11:132134447-132134469 CGGATAAAAGACAACACCTTGGG - Intronic
1091344022 11:134840626-134840648 TGGAGAAAAGGGAACCCTGCTGG + Intergenic
1091346930 11:134861093-134861115 TGGAGAAAAGGGAAGCCTGTTGG + Intergenic
1093605263 12:21081102-21081124 TGTAGAAAAGGCAAAACAATGGG + Intronic
1094912914 12:35309116-35309138 TGTAGAAAAGGAAACATCTTCGG + Intergenic
1094937916 12:35714473-35714495 TGTAGAAAAGGAAACATCTTCGG + Intergenic
1094966151 12:36171379-36171401 TGTAGAAAAGGAAACATCTTCGG + Intergenic
1095180955 12:39145589-39145611 TGGAGAGCAGGCGACACCGAGGG + Intergenic
1096961729 12:55585630-55585652 TAGAGAAAAGGCAACAAAGAGGG - Intergenic
1099905329 12:88763513-88763535 TGGAGGAAAGGCACCACTGAGGG + Intergenic
1102420746 12:112800951-112800973 GGAAGAAAAGGCAGCAGCGTGGG + Intronic
1102659908 12:114517095-114517117 TGGAGGAAGGGTAACACCCTAGG - Intergenic
1102962260 12:117100307-117100329 TGGAGAGAAGGCAATGCCGGTGG + Intergenic
1105662056 13:22507214-22507236 TGGATAAAAAGCAAAACTGTGGG + Intergenic
1106261332 13:28069571-28069593 AGGAGAAAAGGAAATACAGTAGG + Intronic
1107161989 13:37241028-37241050 TGGAGAAAAGGGAACACTGTTGG + Intergenic
1108713066 13:53053346-53053368 TGGGGAAAAAGCAAAGCCGTAGG - Intergenic
1109869101 13:68307996-68308018 TGGAGAAAAGTCAACACATTTGG + Intergenic
1113032327 13:106007958-106007980 TCGGGAAAAGGCAAGACTGTAGG - Intergenic
1115465220 14:33707786-33707808 TGGAGGAAAGGCAGCCCCATAGG + Intronic
1115948241 14:38689387-38689409 TGAAGGAAAGGCAACACAGCAGG + Intergenic
1118033723 14:61843198-61843220 TGGAGCAAAGGGAACACTGTTGG - Intergenic
1119106049 14:71925036-71925058 TGGAAAAAAGGGTACACTGTTGG - Intergenic
1120335720 14:83151729-83151751 TGGAGAAAAGGGAAAACAGATGG + Intergenic
1121639018 14:95472966-95472988 TGGAGACAAGCCAACAGAGTTGG + Intronic
1122078017 14:99247977-99247999 TGGAGAAAAGGCAGCAGCCAAGG - Intronic
1123979313 15:25585058-25585080 TGGAGAAAAGGGAACATTGTTGG - Intergenic
1124252847 15:28118288-28118310 TGGAGGAGAGGCAGCCCCGTGGG - Intronic
1126205879 15:46044176-46044198 TGCAGAAAGGGCCACACGGTAGG - Intergenic
1127569919 15:60231832-60231854 AGGAGAAAAGCCAAGACCGTTGG + Intergenic
1128239908 15:66094733-66094755 TGGAGAAGCGGTAACTCCGTTGG + Intronic
1131528124 15:93168310-93168332 TGTAGAAAAGGCAAAACTATAGG - Intergenic
1135166302 16:20142018-20142040 TGGACAGAAGGCAACAGAGTTGG - Intergenic
1135246549 16:20862049-20862071 TGGAGGAAAGGGAACAGCATTGG - Intronic
1136030170 16:27496952-27496974 GAGAGTAAAGGCCACACCGTGGG + Intronic
1136569963 16:31090785-31090807 TCCAGAGAAGGCAACACCGAGGG + Intronic
1137632057 16:49953788-49953810 AGGAGAAAAGGCAGCACCTGAGG + Intergenic
1139533941 16:67560230-67560252 TGGAGAAAAACCAACACACTGGG + Intergenic
1140136338 16:72209024-72209046 TGGAGAAAAGGCAGCCACGCTGG - Intergenic
1140296939 16:73718039-73718061 TGGAGAAAAGATAACACGTTAGG - Intergenic
1141001000 16:80307752-80307774 GCGAGAAAAGTCACCACCGTGGG + Intergenic
1141468579 16:84223026-84223048 GGGAGAAGAGGCAACAACGCGGG + Intronic
1141569575 16:84926048-84926070 TGGAGAACTGGCAACCCCGAGGG - Intergenic
1142939236 17:3367862-3367884 TGGTGAAAAGGGAACACTGTTGG - Intergenic
1143668204 17:8376859-8376881 TGGAGACTTGGCAACAACGTGGG - Intronic
1144941408 17:18944424-18944446 TTTGGAAAAGGCAAAACCGTGGG + Intergenic
1146111235 17:30091634-30091656 TTGAGAAAAGGCAAAAACTTGGG - Intronic
1150205280 17:63400151-63400173 TGGAGATGTGGCAACACTGTTGG - Intronic
1151260963 17:72915599-72915621 TGGAGAAAGGCCAGCACGGTTGG - Intronic
1155282820 18:24257992-24258014 TGGAGAAAGGGGAACACTGTTGG + Intronic
1156939531 18:42748778-42748800 TGGATAAAAGGCTACACATTGGG + Intronic
1157230586 18:45912046-45912068 TGTAGTAAAGACAACACCCTGGG - Intronic
1157931154 18:51825012-51825034 GGGAGAAAAGGCAACCCTTTGGG - Intergenic
1158179700 18:54700227-54700249 TGGAGCAAAGTCAAGACTGTTGG - Intergenic
1159728338 18:71992471-71992493 TCTAGAAAAGGCAAAACCATAGG + Intergenic
1164016160 19:21257581-21257603 TGGAGCAAAGAGAACATCGTTGG + Intronic
1166540865 19:43604819-43604841 TGGAGAAAAAGGAACAGGGTGGG - Intronic
1166586177 19:43951369-43951391 TAGAGGAAAGGAAGCACCGTCGG + Exonic
1166868934 19:45858852-45858874 TGGAGAAAAAGCAACACAGATGG - Intronic
1167394185 19:49216928-49216950 TGGAGAGAAGACAAAACAGTGGG - Intergenic
1168441682 19:56373564-56373586 TGGAGAAAAGGAAACTGCCTTGG + Intergenic
925446650 2:3931885-3931907 TGGATAAAAGGCTACACATTGGG - Intergenic
927186712 2:20487372-20487394 TGCAAAAGAGGCAGCACCGTTGG + Intergenic
927339516 2:21966470-21966492 TGGGGAAAAGGCAAAATTGTTGG + Intergenic
930527120 2:52543999-52544021 TGGAGAAAAAGAAATACTGTTGG - Intergenic
930880729 2:56267214-56267236 TGGAGAACTGGCAAGAGCGTGGG - Intronic
931143850 2:59494379-59494401 TGGAGAAAAGGGAACACTGTTGG - Intergenic
931216985 2:60254662-60254684 TGGAGAAAGGGGAACACTGTTGG - Intergenic
931839390 2:66132466-66132488 TGGAGAAAAGGCCTCACCCTGGG - Intergenic
931998601 2:67862991-67863013 TGGAGGAAAGGAAACACTCTGGG + Intergenic
932426028 2:71635884-71635906 TGGAGAAAAAGCAACAAAGAGGG + Intronic
932481809 2:72045197-72045219 TGGAGAAATTGGAACACTGTGGG - Intergenic
932556300 2:72827403-72827425 TGGAGATAAGGCAACACTGTAGG + Intergenic
933974542 2:87497654-87497676 TGGAGAAAAGTAAACCCCTTGGG + Intergenic
936319282 2:111453160-111453182 TGGAGAAAAGTAAACCCCTTGGG - Intergenic
937057230 2:118949241-118949263 TAGTGGAAAGGCAACAACGTGGG + Intronic
937743627 2:125385868-125385890 TCTAGAAAAGGCAAAACCATGGG + Intergenic
937753000 2:125500352-125500374 TAGAGAAAAGGGAACACTGGTGG - Intergenic
943220280 2:185094984-185095006 TGGAGAAAAAGGAACACTGCTGG + Intergenic
944028873 2:195207881-195207903 TTGAGAAAAGGCAAAACTATGGG - Intergenic
945062084 2:205918181-205918203 TGGTGAAGAGGCAACACAGTTGG + Intergenic
946027068 2:216678328-216678350 TGGAGGAAAGTCACCACCTTTGG + Intronic
947400747 2:229729330-229729352 TGGAGAAATAGGAACACTGTTGG + Intergenic
948316775 2:237033228-237033250 TGGAGAAAAGTTAACAAAGTAGG - Intergenic
1169587479 20:7102318-7102340 CAGAGAAAAGGGAACACCTTTGG + Intergenic
1169771138 20:9202165-9202187 TGCAGTAAAGGCAACATTGTAGG + Intronic
1171988711 20:31678962-31678984 AGAAGGAAATGCAACACCGTGGG - Intronic
1173534503 20:43799266-43799288 CTGAGAAAAGGCAAAACCGTTGG + Intergenic
1173858103 20:46263980-46264002 TGGAGAAAAGGTAACAGATTTGG + Intronic
1178197386 21:30362933-30362955 CAGAGAAAAGGGAACACTGTTGG + Intronic
1178808439 21:35859169-35859191 TGGAGGAAAGGCAGCTCCTTCGG + Intronic
1180136020 21:45862314-45862336 TGCACAAAATGCAATACCGTGGG + Intronic
1180377344 22:12106439-12106461 TGGAGAAATAGGAACACTGTTGG - Intergenic
1182761005 22:32722332-32722354 TGGAGAAAAGACAGCAGAGTCGG + Intronic
950563442 3:13749279-13749301 TGGAGAAGAGGCACCACCGGAGG - Intergenic
951435819 3:22663208-22663230 TCTAGAAAAGGCAAAACCATAGG + Intergenic
954173011 3:48820372-48820394 TGGAGAAAAGGGAACACATTAGG + Intronic
955109578 3:55935020-55935042 TGGAGTAAAGGCTACATCTTTGG - Intronic
956184872 3:66552891-66552913 TGGGCAAAGGGCAACACAGTTGG - Intergenic
958933395 3:100231531-100231553 TCGAGACTAGGCAACACAGTGGG + Intergenic
960481142 3:118191379-118191401 TGGAGCAAAGGGAACACTGTTGG - Intergenic
960901746 3:122561039-122561061 TGAAGAGAAGGAAACACAGTAGG - Intronic
960980999 3:123226317-123226339 TGGAAGAAAGGGAACACTGTTGG - Intronic
962333320 3:134500560-134500582 TGGAGAAAAGGCAACACCGTTGG - Intronic
1202738508 3_GL000221v1_random:33068-33090 TGGAGAAAAGGGAACACAAACGG + Intergenic
969715994 4:8868352-8868374 GGGAGAGAGGGCACCACCGTTGG + Intronic
970986717 4:22167360-22167382 TAGAGAAAAGGGAGCACTGTTGG - Intergenic
971150326 4:24024504-24024526 TTGAGAAAAGGCAAAACCCAAGG - Intergenic
975543155 4:75534929-75534951 TGGAGAAATAGGAACACTGTTGG + Intronic
978006202 4:103620264-103620286 TGGAGAAAAGGGAACACTGTTGG + Intronic
980186652 4:129470305-129470327 TGGTGAAAAGGGAACACTTTAGG - Intergenic
980615302 4:135213442-135213464 TGGAGAAAGGGCAACAGAGCTGG - Intergenic
984056364 4:174934089-174934111 CAGAGAAAAGGGAACACTGTTGG - Intronic
984943677 4:184954915-184954937 TGGAGAAGAGGCTACATCCTGGG + Intergenic
985325897 4:188769926-188769948 TGGATAAAAGACTACACAGTGGG - Intergenic
1202758952 4_GL000008v2_random:91898-91920 TGGAGAAATAGGAACACTGTTGG - Intergenic
986222465 5:5781240-5781262 TGGAAAAAAGGCAACCTCATAGG + Intergenic
986928318 5:12786379-12786401 TCTGGAAAAGGCAACACCATGGG - Intergenic
988965220 5:36409865-36409887 TGGAGAAAAGGGAACACTGTTGG + Intergenic
989413070 5:41142188-41142210 TGGAGAAAATACAACACGGAAGG - Intergenic
991143814 5:63277750-63277772 TGGAGAAATAGGAACACTGTTGG - Intergenic
991522079 5:67511689-67511711 TGCAGAAAAGGCAACATCAAAGG + Intergenic
992432763 5:76725691-76725713 TCAAGAAAAGGTAACACCTTAGG + Intronic
995405701 5:111793130-111793152 TGTAAAAAAGGCAATACGGTTGG - Intronic
996639653 5:125736972-125736994 TGGTGAAAAGGGAGCACTGTTGG + Intergenic
997888514 5:137654032-137654054 TCTAGAAAAGGCAAAACCATAGG + Intronic
998695781 5:144637572-144637594 TGGAGGAAAGGGAACACTATTGG + Intergenic
1001165270 5:169359799-169359821 CAGAGAAAAGGGAACACTGTTGG + Intergenic
1002198032 5:177511767-177511789 TGGAGAGAAGGGAAGACTGTCGG + Exonic
1012385489 6:98677017-98677039 AGGAGTAAAGGCAACACAATGGG + Intergenic
1014363063 6:120505143-120505165 TCTGGAAAAAGCAACACCGTAGG - Intergenic
1022223098 7:28334010-28334032 TGGAGAAAAGGAAACACCGTTGG - Intronic
1022834636 7:34102124-34102146 TGGAGAAAAGGCAAACCTGGGGG - Intronic
1025147529 7:56517751-56517773 TGAAGAAATGGCAGCACAGTTGG + Intergenic
1025576829 7:62655481-62655503 TGGTGAAAAGGAAATACCTTTGG - Intergenic
1026318830 7:69251262-69251284 TGAAGAAATGGCAGCACAGTTGG - Intergenic
1026511113 7:71027934-71027956 TGGAGAGAAAGCAGAACCGTGGG - Intergenic
1026675046 7:72421230-72421252 TGGATAAAAGACAACATCTTGGG - Intronic
1027745434 7:82068154-82068176 TGGGGAAACTGCAACACTGTAGG - Intronic
1028139912 7:87262422-87262444 TGGAGAAAATGGAACCCAGTTGG - Intergenic
1028695641 7:93708012-93708034 TCTAGAAAAGGCAACACCATAGG - Intronic
1028910660 7:96203944-96203966 TGGAGAAAGTGCAACAGAGTGGG + Intronic
1029389263 7:100264107-100264129 GGGAGATAAGTCAACACCGAGGG + Intronic
1031559408 7:123220282-123220304 TGGAGAAAGGGCAATACTGCTGG - Intergenic
1031921685 7:127606769-127606791 TGGGGAATAGGCAGCACTGTTGG - Intergenic
1032656348 7:133934682-133934704 TGGTGAAAAAGCAACAGCGGGGG - Intronic
1032849202 7:135778927-135778949 TGGAGAAAGAGGAACACTGTTGG + Intergenic
1033152178 7:138925009-138925031 TGGAGAAAAGGCCTCAGCGCTGG - Intronic
1033415760 7:141160175-141160197 GGGATAAAAGGCAACACATTGGG - Intronic
1034844972 7:154436152-154436174 TGGATAAAAGGCAAGACCAGTGG + Intronic
1037611898 8:20483040-20483062 TGGAGAAAAGGCATCAGAGAAGG + Intergenic
1038858239 8:31356712-31356734 TGGAGAAAAGGGAACACTGTTGG - Intergenic
1040301785 8:46191791-46191813 GGGAGAAGCGGCAACACCGCAGG + Intergenic
1040335943 8:46416035-46416057 AGGAGAAAAGGCAGCACTGCAGG + Intergenic
1041829099 8:62132620-62132642 TGGAGAAAACGAAACACTGATGG - Intergenic
1042083938 8:65087784-65087806 TAGAGAAAGGGCAGCACCTTGGG - Intergenic
1044173544 8:89087636-89087658 GAGGGAAAAGACAACACCGTGGG + Intergenic
1045040758 8:98221811-98221833 TGGAGAAACAGGAACACTGTTGG + Intronic
1047057765 8:121185812-121185834 TGGAGAAATGGAAACACTTTTGG + Intergenic
1047204007 8:122789025-122789047 TGGAGAGAAGGAATCCCCGTGGG + Intronic
1047346014 8:124029393-124029415 TGGAGAAATAGGAACACTGTTGG - Intronic
1049740406 8:144238223-144238245 TGGAAAAATGGCAACACTGCAGG - Intronic
1052156232 9:25194520-25194542 TGGAGAAAAACCAACATGGTAGG + Intergenic
1052202519 9:25799966-25799988 TGGGGAAAAGGGAACACTCTGGG - Intergenic
1052554186 9:29992533-29992555 TGGAGAAATAGGAACACTGTTGG - Intergenic
1054164209 9:61705007-61705029 TGGAGACAAGACAAGACAGTGGG + Intergenic
1055534034 9:77217930-77217952 TGGAGAAAAGGGATTACTGTTGG - Intronic
1055772232 9:79729897-79729919 TGGACTAAAGGCAACCCTGTGGG - Intergenic
1056039601 9:82649260-82649282 TGTGGAAAAGGCAAAACTGTAGG - Intergenic
1056966016 9:91163534-91163556 TAGCGAAAAGGCACCACCCTCGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057571367 9:96206603-96206625 TGGAAAAAAGGCAAGACCACGGG - Intergenic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058262091 9:102847173-102847195 TGGAGAAATAGGAACACTGTTGG - Intergenic
1058511953 9:105728700-105728722 TGGAGAAATAGGAACACTGTTGG - Intronic
1058959788 9:109981824-109981846 TAGAGAAAAGGGAACACTCTTGG + Intronic
1059895292 9:118857138-118857160 TGGAGAAAATGCAACCAAGTTGG + Intergenic
1061273448 9:129556939-129556961 GGGTGAAAAGGCAAAACTGTCGG + Intergenic
1203539735 Un_KI270743v1:76797-76819 TGGAGAAATAGGAACACTGTTGG - Intergenic
1188592677 X:31857748-31857770 TTTTGAAAAGGAAACACCGTAGG - Intronic
1188992991 X:36846869-36846891 TGGAGAAAATGCAAAAACATGGG + Intergenic
1189216918 X:39333501-39333523 TGGAGAAAAGGAGACAGAGTTGG - Intergenic
1194269980 X:91800727-91800749 TGGAAAAAAGGCAAAACCAAAGG + Intronic
1194949136 X:100104301-100104323 GGGAGAAAAGGCAAAAGCCTTGG - Intergenic
1198077126 X:133204486-133204508 GGGAGAAAATGGAACACCCTAGG + Intergenic
1198330964 X:135622037-135622059 TGGCGAAAAGGCCACATGGTTGG + Intergenic
1198335961 X:135666958-135666980 TGGCGAAAAGGCCACATGGTTGG - Intergenic
1199102264 X:143816333-143816355 TGGAGAACTGGCAGCATCGTGGG + Intergenic
1199646083 X:149914059-149914081 TGGAGAAAATGGAACACTGTTGG + Intergenic
1200587222 Y:5022166-5022188 TGGAAAAAAGGCAAAACCAAAGG + Intronic