ID: 962334468

View in Genome Browser
Species Human (GRCh38)
Location 3:134514375-134514397
Sequence AAGGAGAAAAAAAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4781
Summary {0: 1, 1: 3, 2: 38, 3: 460, 4: 4279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962334468 Original CRISPR AAGGAGAAAAAAAATGAGAA TGG Intronic
Too many off-targets to display for this crispr