ID: 962335602

View in Genome Browser
Species Human (GRCh38)
Location 3:134527547-134527569
Sequence GCTTTTCTTGCCCCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962335602_962335609 20 Left 962335602 3:134527547-134527569 CCTGCTGGTGGGGCAAGAAAAGC 0: 1
1: 0
2: 1
3: 21
4: 168
Right 962335609 3:134527590-134527612 CATGCCAGCAAAGCCATGTGGGG 0: 1
1: 5
2: 11
3: 42
4: 220
962335602_962335607 18 Left 962335602 3:134527547-134527569 CCTGCTGGTGGGGCAAGAAAAGC 0: 1
1: 0
2: 1
3: 21
4: 168
Right 962335607 3:134527588-134527610 CACATGCCAGCAAAGCCATGTGG 0: 1
1: 4
2: 7
3: 37
4: 266
962335602_962335608 19 Left 962335602 3:134527547-134527569 CCTGCTGGTGGGGCAAGAAAAGC 0: 1
1: 0
2: 1
3: 21
4: 168
Right 962335608 3:134527589-134527611 ACATGCCAGCAAAGCCATGTGGG 0: 1
1: 4
2: 15
3: 60
4: 233
962335602_962335604 -5 Left 962335602 3:134527547-134527569 CCTGCTGGTGGGGCAAGAAAAGC 0: 1
1: 0
2: 1
3: 21
4: 168
Right 962335604 3:134527565-134527587 AAAGCAAAACCTGCCGGCATAGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962335602 Original CRISPR GCTTTTCTTGCCCCACCAGC AGG (reversed) Intronic
900080805 1:856128-856150 GCTCTTCCTTCCCCACCTGCTGG + Intergenic
900504480 1:3022472-3022494 CCTGTTCGTGCCCCAGCAGCTGG + Exonic
901255326 1:7820448-7820470 GTTTCTCTTACACCACCAGCTGG + Exonic
901721214 1:11199476-11199498 GCTTCTCTCCTCCCACCAGCTGG + Intronic
902178840 1:14672210-14672232 GCTTTTGTTTCCCAACCAGCTGG - Intronic
904364700 1:30002815-30002837 GCTTTTCTTCCTCCCCCATCCGG + Intergenic
906214459 1:44030770-44030792 GCCTATCTGGCCCCTCCAGCCGG - Intronic
909547670 1:76866108-76866130 GCTTTTCCTGCCCTAACAACTGG + Intergenic
916337802 1:163692829-163692851 GCTTGTATTGCTCCGCCAGCTGG + Intergenic
916744006 1:167670443-167670465 TCTTTCCTTTTCCCACCAGCAGG - Intronic
917489464 1:175485609-175485631 GCTTTTCCTGCCACACATGCTGG + Intronic
919329310 1:196149042-196149064 CCTTCTCTTGCCTCACCATCTGG + Intergenic
919874786 1:201856375-201856397 GCTTTTGATGACCCACCATCAGG - Intronic
920053089 1:203175156-203175178 CCCTTTCTTGCTCCACCAGCAGG - Intronic
921776962 1:219112271-219112293 GTTTTCCTTGCCCCACCAGTGGG + Intergenic
922446919 1:225705680-225705702 ACTTTTCCTTCCCCACCACCGGG + Intergenic
1064140010 10:12782618-12782640 GTGTTCCTTCCCCCACCAGCAGG + Intronic
1065109246 10:22423898-22423920 ACTTTTCTTCCTCCATCAGCTGG - Intronic
1066311397 10:34200436-34200458 GCATTTCTTGCCTCTCCTGCGGG - Intronic
1066455542 10:35568682-35568704 GCTGTTCTTGCCCCGCTTGCAGG + Intronic
1067042479 10:42962398-42962420 CCTTGTCTTGCCCCAGCTGCAGG + Intergenic
1068620533 10:59176781-59176803 GCTCTTCTTGCCCACCCGGCCGG + Exonic
1070588308 10:77782502-77782524 GCGTTTCTTGTTCCACCAACTGG + Intergenic
1071299474 10:84245461-84245483 ACTTTTCATGTCCCTCCAGCCGG + Intronic
1072614296 10:97039158-97039180 GCTTTTCTCCCCCCACCCCCAGG - Intronic
1073646836 10:105313718-105313740 GCTTTTCTTTCCCCAACGTCTGG - Intergenic
1074503534 10:114045871-114045893 GATTTTTTTCCCCCACCAGGTGG + Exonic
1077040407 11:518697-518719 GCGTTTCCTGCCCCACCTGCTGG - Intergenic
1077745595 11:4901021-4901043 GGCTTTCATCCCCCACCAGCTGG + Intronic
1082771466 11:57210948-57210970 CCTTTCCTTGCCCCACCCCCAGG - Intergenic
1082998251 11:59269392-59269414 GCTTTCCTTTTCCCTCCAGCTGG - Intergenic
1083559714 11:63663593-63663615 GTTCTTATTGCCCCAGCAGCAGG + Intronic
1084337858 11:68471558-68471580 GCTTTTCCTGCACCACCATGTGG - Intronic
1085121835 11:73972395-73972417 GCATTTCATGCCTCACCATCTGG - Intergenic
1085945448 11:81265738-81265760 GCTCTTGTTGTCCCACCTGCTGG + Intergenic
1089334005 11:117709995-117710017 GCCATCCTTGCCCCAACAGCAGG - Intronic
1089847407 11:121469161-121469183 TCTTTTCTTTCCCCATCCGCAGG - Intronic
1091039636 11:132264914-132264936 GCTGTGCCTGTCCCACCAGCAGG + Intronic
1094091233 12:26652547-26652569 GCTCTTATTGCCCCAGCTGCTGG + Intronic
1094196522 12:27755752-27755774 CCATTTCTTTCCCCACAAGCTGG + Exonic
1096273045 12:50181953-50181975 GCGTCTCTTGGCCAACCAGCAGG - Exonic
1096786663 12:54020834-54020856 GCTTTTGTTGCCCAAGCAGCTGG + Intronic
1098787572 12:74779441-74779463 GCTTTTCTAGGCCCATGAGCTGG - Intergenic
1098909497 12:76194600-76194622 ACTTTCCTTGCCCCAACACCTGG + Intergenic
1103407839 12:120687929-120687951 GCTTTCCTTGCCCCTTCTGCAGG + Intronic
1107901132 13:45015570-45015592 GCTTTCCTTTCCCTATCAGCTGG - Exonic
1109326126 13:60869948-60869970 GCCTTCCTTGCCCCTCCAGTAGG - Intergenic
1112832221 13:103467055-103467077 GCTTTTCTTGGCCACCCAGATGG + Intergenic
1113823204 13:113230251-113230273 GCTTTTCCTACCCCACCCACTGG + Intronic
1114336922 14:21699831-21699853 GCTTTTGGTGCCCCGCTAGCAGG - Intergenic
1117567470 14:57009677-57009699 GCTTATCTTGCCTAACCAGATGG + Intergenic
1119201064 14:72753316-72753338 TCTCTTCTTGCGCCAGCAGCGGG + Exonic
1121437718 14:93929916-93929938 GGTCTCCTTGCCCCACCTGCAGG + Intergenic
1122099184 14:99393858-99393880 GCTTTTCTTGGCCCAAATGCAGG - Intergenic
1122369910 14:101223866-101223888 GCTGGTCTGGCCCCACCACCAGG - Intergenic
1123050893 14:105541528-105541550 CTATTTCTTGCCCCACCACCAGG - Intergenic
1127353376 15:58174420-58174442 GCCATTCTTGCCACAGCAGCGGG - Intronic
1127828190 15:62724843-62724865 GCTTTCCTTGCTCCTCCTGCTGG + Intronic
1128878241 15:71219914-71219936 GCTTTTCTGAACACACCAGCTGG - Intronic
1129390053 15:75215893-75215915 GCTTTCCTTGCAACCCCAGCAGG + Intergenic
1129664524 15:77572110-77572132 ACTTTTCACGCCCCACCAACAGG - Intergenic
1130535411 15:84781717-84781739 GTTTTTCTTCTCCCTCCAGCAGG + Intronic
1130936863 15:88478125-88478147 CCTTTGCTTGCACCTCCAGCTGG + Exonic
1135650491 16:24202097-24202119 GCTGTTTTTGCCCAGCCAGCAGG - Intronic
1141103241 16:81213064-81213086 GCTTTCCTGGACCCTCCAGCGGG + Intergenic
1141950583 16:87336592-87336614 GCTGTTCCTGCCCCACCGGTGGG - Intronic
1142202576 16:88768171-88768193 CCAGCTCTTGCCCCACCAGCTGG - Intronic
1142618869 17:1153162-1153184 CCCTTTCTTGCCCCATCATCAGG + Intronic
1142933908 17:3311295-3311317 GCTCTTCTTTCCCCACCTCCTGG + Intergenic
1144172565 17:12672636-12672658 ACTTATCTTCCCTCACCAGCAGG - Intronic
1145749020 17:27342011-27342033 GCTGTCCTTGCCCCACCCCCAGG + Intergenic
1147618046 17:41842511-41842533 TCTCTTCTTCCCCCACCACCAGG - Intronic
1152516173 17:80826144-80826166 GGTTTTCTTGCCCCAGCTGCTGG - Intronic
1152609406 17:81308230-81308252 GCTTTTGTAGGCCCACCAGCAGG - Intergenic
1152627563 17:81394846-81394868 GCTTTTGCTGCCCAAGCAGCGGG + Intergenic
1153880720 18:9419554-9419576 GTTTTTCTTGCCCGTCCAGCAGG + Intergenic
1154036385 18:10806256-10806278 CCTTTTCAGGCCCCACCTGCGGG - Intronic
1154220886 18:12453112-12453134 GCTTTTGTTGCCGAACCAGGAGG - Exonic
1159001764 18:62981185-62981207 GCTTGCCTTCCACCACCAGCAGG + Intergenic
1159511600 18:69402192-69402214 GCTTTTCTGGACCAGCCAGCCGG - Intronic
1160705675 19:529057-529079 GATTTTCAAGCCCCTCCAGCTGG - Intergenic
1160910987 19:1473710-1473732 GCTTTCCTTGTCCCCCCAGCTGG - Exonic
1161698859 19:5784376-5784398 GTGTTTCCAGCCCCACCAGCAGG - Exonic
1166448681 19:42879973-42879995 ACTGTTCTTGCCCAACCTGCAGG - Intronic
1166620867 19:44298850-44298872 GCTTTTCTTCCCTCTCCAACTGG + Exonic
1166624366 19:44336665-44336687 GCTTTTCTTCTCTCTCCAGCTGG + Exonic
927290421 2:21399584-21399606 TCTTTTGTTACCCCTCCAGCTGG - Intergenic
928333635 2:30377215-30377237 ACTTTTACTGACCCACCAGCTGG + Intergenic
932771936 2:74505333-74505355 GCTTACCTTGCCGAACCAGCGGG + Exonic
933433635 2:82216268-82216290 CCTTATCTTGCCCCACTAGAAGG + Intergenic
935084648 2:99833121-99833143 GCTTCTCTTGTCCCACCATCCGG + Intronic
937297726 2:120819867-120819889 GCCTCTCTTCCCCCAGCAGCAGG - Intronic
938887712 2:135670022-135670044 GCTTCTCTTGCCCAAGGAGCTGG - Intronic
948902696 2:240964410-240964432 GCTGTGCTGGCCCCACCAGGAGG + Intronic
1170941753 20:20853951-20853973 CCTTTGCTTGCACCTCCAGCTGG - Intergenic
1173852690 20:46228739-46228761 GCCTGCCTGGCCCCACCAGCAGG - Intronic
1174479757 20:50822739-50822761 GATTCTCGTGCCCCAGCAGCTGG + Intronic
1175488904 20:59365445-59365467 CCTTCTCTTCCCCCACCATCAGG + Intergenic
1181416677 22:22764621-22764643 GATTCTCTGGCCCCAACAGCAGG + Intronic
1182045346 22:27269907-27269929 GCTTTTCATGCCCCACCCTGCGG - Intergenic
1182793284 22:32971291-32971313 GCTTTTTTTATCCCCCCAGCTGG + Intronic
1184853005 22:47131570-47131592 ACTCTTCTTGCTCCAGCAGCAGG - Intronic
950482819 3:13255133-13255155 TCTTTTCTTTCCAAACCAGCTGG + Intergenic
951250811 3:20392456-20392478 GCTTTTTTTCCCCCATCAACTGG + Intergenic
953971466 3:47351838-47351860 GAGATTCTTGCCCCACCAGCAGG + Intergenic
954334581 3:49908916-49908938 GCCTCTCTTGCCCAGCCAGCGGG - Exonic
955557399 3:60152736-60152758 GCTTTCCGTACCCCACCAGCAGG + Intronic
955938594 3:64127014-64127036 GCTGGTGTTGCCCCAGCAGCTGG - Intronic
959731866 3:109613299-109613321 GCTTTTTATTCCTCACCAGCTGG - Intergenic
961726173 3:128932542-128932564 GCACTTCTTGCCCATCCAGCAGG + Intronic
962335602 3:134527547-134527569 GCTTTTCTTGCCCCACCAGCAGG - Intronic
962901819 3:139768140-139768162 GCCTTTCTTGACCCCCAAGCTGG - Intergenic
966737039 3:183195119-183195141 GCTTTTCTTCCCCCAACACTTGG - Intronic
966808239 3:183822761-183822783 GCTATTCAGGCCCCTCCAGCTGG - Intronic
966943780 3:184763305-184763327 GCCTAACTTGTCCCACCAGCTGG - Intergenic
967556366 3:190863128-190863150 GCTTTTCTTACCCCACGTCCAGG - Intronic
967781860 3:193449115-193449137 CCCTTTCTTTCTCCACCAGCTGG + Intronic
967982741 3:195075593-195075615 GCTGTGCTTTCCCCTCCAGCAGG + Intronic
968986643 4:3879254-3879276 GCTTCTCCTGCCCCCTCAGCTGG - Intergenic
970058007 4:11996962-11996984 GCTCTTCTTGCCTGACCTGCAGG + Intergenic
975283623 4:72592269-72592291 GCTTTTCATCCCCTTCCAGCAGG - Intergenic
975895226 4:79081572-79081594 GCTTTTTTTCCCCCACTGGCTGG + Intergenic
976898178 4:90138083-90138105 TATTCTCTTTCCCCACCAGCTGG + Intronic
978679115 4:111356807-111356829 GGCTTTCTTGACCCACCAGTGGG + Intergenic
979009994 4:115355321-115355343 GCTCTTCATCCCCCACCAACTGG - Intergenic
981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG + Intergenic
983155954 4:164349023-164349045 GCTTTACTTTTCCCACCAGATGG + Intronic
985622140 5:961288-961310 GCTGTTGTCTCCCCACCAGCTGG - Intergenic
987373713 5:17216714-17216736 ACGTCTCTCGCCCCACCAGCTGG + Intronic
987576423 5:19734016-19734038 ACTTTTCTTGCCCCATTTGCCGG - Intronic
991298275 5:65103398-65103420 GCTGTTCCTCCCCCAGCAGCAGG + Intergenic
992473665 5:77081898-77081920 GCATCTCTTTCCCCACCAGATGG - Intronic
995538553 5:113161945-113161967 GCTTGTCTTGCCTCACCACAGGG + Intronic
996273584 5:121638130-121638152 GTTTTTCATGACCCATCAGCTGG + Intergenic
996900280 5:128537001-128537023 GCTTCTCTGGCCCCTGCAGCAGG + Intronic
997659018 5:135576009-135576031 GATTTTCTTTCCCCATCAACTGG - Intronic
998192497 5:140038910-140038932 TCTTTTCTTCCCCAGCCAGCTGG - Intronic
1001401878 5:171450899-171450921 GTTTTTCTTTCTCCCCCAGCAGG + Intronic
1003486539 6:6585004-6585026 CCTTTGCTTGTCCCACCTGCTGG + Intergenic
1004933253 6:20482411-20482433 GCCTTTCTTCCCCCACCACCTGG + Intronic
1005818168 6:29574393-29574415 GCCTTTCTGCCCCCATCAGCAGG + Intronic
1006752360 6:36386809-36386831 GCTTCCCTTTCCCCACCAGGAGG - Intronic
1006813345 6:36835059-36835081 GCTTCCCTCTCCCCACCAGCTGG - Intronic
1006813568 6:36836551-36836573 ACTGTTCTGGGCCCACCAGCAGG + Intronic
1010341187 6:74755061-74755083 GCTTTTTTAGCCCCACCATTGGG - Intergenic
1013072727 6:106743626-106743648 TATTTTCTTTCCCCACCATCTGG - Intergenic
1014788202 6:125641831-125641853 GTTTTTCCTCTCCCACCAGCAGG + Intergenic
1016560970 6:145394971-145394993 TCTTCACTTGCTCCACCAGCTGG + Intergenic
1018246384 6:161828537-161828559 GCTTTTCCTGCCCCTCCCACAGG + Intronic
1018578068 6:165280544-165280566 GCTTTTTCTGCCCCATAAGCTGG + Intronic
1018650119 6:165986239-165986261 GGTTTTCTTTCCCCACCCCCTGG + Intronic
1020033947 7:4952440-4952462 GCTGTTCTTTCAGCACCAGCAGG - Intronic
1022595439 7:31709233-31709255 GCTTTTATTTCCACAACAGCTGG - Intergenic
1027407511 7:77877411-77877433 TCTTTTCTTTCCTCACTAGCAGG + Intronic
1027446507 7:78279812-78279834 GCTTTTCTGGCTCCAATAGCAGG + Intronic
1027608817 7:80333764-80333786 GCTCTTCTTGTCCTCCCAGCAGG - Intergenic
1028083047 7:86600831-86600853 GCTTTACTTGCCCCACTAGCAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030008892 7:105146036-105146058 GATCTTCTTCCCCCACCATCAGG + Intronic
1030754214 7:113268798-113268820 GCTTTTGTTTCACCACCAGCTGG + Intergenic
1033777007 7:144622472-144622494 CCTTTTTTTCCCCCACTAGCAGG - Intronic
1034225392 7:149477295-149477317 GCTTCTCTTGCCCCAGCATTGGG - Intronic
1036810648 8:11866195-11866217 TCTTTTCTTTCCCCAGCTGCTGG - Intronic
1037373586 8:18205624-18205646 GCTTTCCTTGATCCACCAGCAGG - Intronic
1037777807 8:21847267-21847289 GCTTTTCTTGCCTCACCATTTGG + Intergenic
1039264435 8:35809117-35809139 GCTTTCCTTGCCTCACCAGTGGG + Intergenic
1039898158 8:41730958-41730980 GCTTTCCTTACCCCACGAGGAGG + Intronic
1039940176 8:42083729-42083751 GCTTTTGTTGCCCAAGCTGCTGG + Intergenic
1041078173 8:54187985-54188007 GATTTTCCTGCCTCAGCAGCTGG - Intergenic
1041447257 8:57966147-57966169 GCTTTTCTTTTCTCAACAGCTGG - Intergenic
1044731538 8:95232308-95232330 GCTGTTCTTGCCCTACCATAAGG - Intergenic
1045048383 8:98300863-98300885 CCTTTCCCTGCCCCATCAGCAGG - Intergenic
1047048723 8:121084803-121084825 GATTTTCTTGGCCCTCCAGGAGG + Intergenic
1047321354 8:123786979-123787001 GCTTTCCTTCCCTGACCAGCTGG - Intronic
1050283145 9:4073592-4073614 CCTTTTCATGAACCACCAGCAGG - Intronic
1055079678 9:72257097-72257119 GCATTTCCTTCCCCACCTGCTGG - Intronic
1055444598 9:76369858-76369880 ACTTTGCTTCCACCACCAGCTGG + Intergenic
1058360048 9:104134466-104134488 GCTATGCTTGCACCACCAGAGGG + Exonic
1058447076 9:105064041-105064063 GCCCTTCCTGCCACACCAGCAGG + Intergenic
1058657979 9:107242061-107242083 TCTTTTCTTTCCCCACCTCCTGG - Intergenic
1061500906 9:131001357-131001379 TTTTTTCTTCCTCCACCAGCTGG + Intergenic
1061620785 9:131810019-131810041 GCTTCTCTGGCCCAGCCAGCTGG - Intergenic
1185971809 X:4672913-4672935 GCATTTCTTGCTCCAGCTGCTGG - Intergenic
1187191893 X:17043495-17043517 GCCTTTCTTGCCCCCCCCCCCGG + Intronic
1187684042 X:21798753-21798775 GCTTTTCTTTCCCCTCCCGCTGG - Intergenic
1189986152 X:46555161-46555183 TCTTTTCTTCCCCCAGCAGATGG + Intergenic
1190277656 X:48909642-48909664 ACTTTTCTAGCCCTAACAGCCGG - Intronic
1192684489 X:73289203-73289225 GCTTTCCTTGTCCCGCCAGCAGG + Intergenic
1195463883 X:105158469-105158491 TCTTTTCTTTCCCCACCAAATGG + Intronic
1195618684 X:106932440-106932462 GCCTTTCTTGCTCAACCAGCTGG - Intronic
1198055522 X:132991129-132991151 GGTTATCTTTCCCCATCAGCTGG + Intergenic