ID: 962340284

View in Genome Browser
Species Human (GRCh38)
Location 3:134576568-134576590
Sequence ACAGCTGCTAAGTGGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962340284_962340290 13 Left 962340284 3:134576568-134576590 CCAGCTTGCCACTTAGCAGCTGT 0: 1
1: 0
2: 2
3: 57
4: 306
Right 962340290 3:134576604-134576626 GTTTCTTCATATGCAGAATGTGG 0: 1
1: 4
2: 104
3: 798
4: 3394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962340284 Original CRISPR ACAGCTGCTAAGTGGCAAGC TGG (reversed) Intergenic
900732975 1:4274999-4275021 ACAGCTGGTACGTGCCAAACTGG - Intergenic
900948730 1:5845690-5845712 ACAGCAGCTCTGTGGCCAGCAGG + Intergenic
901643195 1:10703419-10703441 GGAGCTGCTGAGGGGCAAGCAGG - Intronic
901798648 1:11694520-11694542 ACAGCTGCTAAGTGATCAGCTGG - Intronic
902691362 1:18111658-18111680 TCAGCTGCGATGTGTCAAGCAGG + Intronic
903334697 1:22617038-22617060 ACAACTGCGATGTGACAAGCAGG + Intergenic
903376401 1:22869135-22869157 ACAGCTGCTCAGAGCCCAGCTGG + Intronic
903517361 1:23920471-23920493 ACAGCTATTCAGTGGCAAACTGG - Intergenic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
904476559 1:30768918-30768940 CCAGATCCTAAGTGGCAAACTGG + Intergenic
905775210 1:40663933-40663955 CCAGCTGCTATGTGGGTAGCAGG - Intronic
906274334 1:44505149-44505171 ACAGCTTCTAAGTGGCAGTCAGG + Intronic
907473940 1:54692911-54692933 ACAGGTGGCAAGTGGTAAGCTGG - Intronic
909720616 1:78765154-78765176 ACAGCATATAAATGGCAAGCAGG - Intergenic
911120988 1:94296255-94296277 AGAGCTACTAAGTGACTAGCAGG - Intergenic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
911514684 1:98852887-98852909 ACAGCTACTAAGTGACTACCAGG - Intergenic
911612198 1:99969889-99969911 AGAGCTGCCAAGTGCCGAGCTGG + Intronic
912506786 1:110162029-110162051 TCTGTTGCTAAGTGACAAGCTGG + Intronic
912756415 1:112328583-112328605 AGAGCTGCTAACAGGCAATCAGG + Intergenic
913488083 1:119352217-119352239 ACAGCTGCTAAGTGACTAACAGG - Intergenic
915431441 1:155869908-155869930 ACGGCTGGCAAGTGGTAAGCTGG - Intronic
917666729 1:177232255-177232277 CCAGGTGCTAAGTGGCTACCAGG - Intronic
919131450 1:193455990-193456012 TCAGCTGCTGAGTGGCAGGCAGG + Intergenic
919766914 1:201133458-201133480 ACAGCTGCTCAGTGCCTACCAGG - Intergenic
919978250 1:202626797-202626819 AGAGCTGCTAAGTGTCAGGTTGG - Intronic
920268592 1:204745590-204745612 ACAGCTGATAACAGGCCAGCAGG + Intergenic
922474617 1:225898663-225898685 ACAGCTGGTGAGTGGCACACTGG + Intronic
922671383 1:227510711-227510733 GCAGCTGCTAAGTGGCCAACAGG - Intergenic
922715731 1:227870274-227870296 ACAGCAGCAAAGTGGCGGGCAGG - Intergenic
923318575 1:232805782-232805804 GCAGCAGCAAGGTGGCAAGCGGG - Exonic
924180131 1:241432394-241432416 ACAGCTGTTAAGTGGCAGAATGG + Intergenic
924243816 1:242062687-242062709 GCAGCTGCTAAGTGGCCAACAGG - Intergenic
924478720 1:244406633-244406655 ACAGCTACTAAGTGACTAACAGG - Intergenic
1062763392 10:44586-44608 GCAGCTGCTAAGTGGCCAACAGG + Intergenic
1063187791 10:3666257-3666279 ACAGTTGCTAAGTGGTGACCCGG + Intergenic
1067285908 10:44907646-44907668 ACAGCTGCTAACTGCAAAGCCGG + Intergenic
1067744147 10:48922314-48922336 ACAGCTACTAAGTGACGAACAGG - Intronic
1069815989 10:71194724-71194746 ACAGCTGTCCTGTGGCAAGCTGG + Intergenic
1069948078 10:72001033-72001055 ACAGCTGGGAGGTGGCAGGCAGG + Intronic
1072250401 10:93577803-93577825 ACAGCTTGTAAGTGGCAATCAGG + Intronic
1072363295 10:94682298-94682320 ACAGCTCATAAATGGCAGGCTGG - Intergenic
1072383925 10:94904340-94904362 ACAGCTCATAAATGGCAGGCTGG - Intergenic
1072635125 10:97173133-97173155 CAAGCTGCTAAGTGAGAAGCTGG + Intronic
1073838780 10:107474547-107474569 ACAGCTTGTAAGTGGTAAACTGG - Intergenic
1073845259 10:107546400-107546422 ACAGCTGCTAAGTGACTAATGGG + Intergenic
1074346424 10:112690625-112690647 ACAGCTTATAAATGGCAAGATGG - Intronic
1074390530 10:113053893-113053915 ACAGCTGGGAGGCGGCAAGCTGG + Intronic
1075685187 10:124359714-124359736 ACAAGTTCTAAGTGGAAAGCAGG + Intergenic
1076198254 10:128536381-128536403 ACAGCTACTAAGTGACAAGTGGG + Intergenic
1077461956 11:2715222-2715244 ACAGCTAGAAAGTGGCCAGCTGG + Intronic
1079363697 11:19791275-19791297 CCAGCTGCCAAATGGCAAGAGGG + Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080016002 11:27507090-27507112 AGAGCTGCTAATGGGCAAGGTGG - Intergenic
1080347818 11:31344481-31344503 ACAGCTTGTAAGTGGGCAGCAGG - Intronic
1080750926 11:35149407-35149429 GCTGCTGTTAAGTGGCAAGAGGG - Intronic
1080891459 11:36412130-36412152 ACAGCTACTAAGTGGCTGCCAGG + Intronic
1082867958 11:57917049-57917071 ACAGCTGATAAGAGGCAGTCTGG - Intergenic
1083391499 11:62354605-62354627 ACGGCTGCTAAGTGACTAACAGG + Intronic
1085403865 11:76250229-76250251 TCACCTGCAATGTGGCAAGCAGG + Intergenic
1086047130 11:82546462-82546484 ACAGCTACTTAGTGGCAGGAAGG - Intergenic
1087217133 11:95506285-95506307 ATGGCTGCTAAGTGGCTAACGGG - Intergenic
1088760398 11:112923964-112923986 ACAGCTACTAAGAGACAAACAGG + Intergenic
1089299615 11:117490702-117490724 ACAGCTGGTGAGTGGCAGGAAGG + Intronic
1089368166 11:117933834-117933856 AGAGCTGCTGAGAGGCTAGCTGG - Intergenic
1090740529 11:129655425-129655447 ACAGGTACAGAGTGGCAAGCCGG + Intergenic
1091316007 11:134614538-134614560 CCAGCTGCTCAGTGGCAAGGTGG + Intergenic
1091539179 12:1443600-1443622 ACAGCTGCTGTGTGTCAAGCAGG + Intronic
1091815331 12:3433536-3433558 ACAGCTGGTAAGTGGCAGAGTGG + Intronic
1092361833 12:7843254-7843276 ATAGCTGCTGAGTAGAAAGCCGG + Intronic
1092579492 12:9822660-9822682 AAAGGTGCAGAGTGGCAAGCTGG + Intergenic
1094164130 12:27424784-27424806 AAAGCTGCTAAGTGGCCACTAGG + Intronic
1094813267 12:34162348-34162370 GCAGCTGCTAAGTGGCCAAGAGG + Intergenic
1095380220 12:41581960-41581982 AAAGCTGCTGAGTGTCAAGGAGG + Intergenic
1096719727 12:53512151-53512173 ATAACTGCTAAGTGGCAAGGGGG + Exonic
1097011145 12:55954295-55954317 ACTGCTGCTATGTGGCAACTGGG + Exonic
1097393632 12:59046348-59046370 ACAGCTGGAAAGTGGAGAGCTGG - Intergenic
1097685327 12:62685474-62685496 ACAGTTAATAAGTAGCAAGCTGG - Intronic
1101424324 12:104575616-104575638 TGAGCTGCTGAGTGGCCAGCAGG + Intronic
1101580824 12:106039733-106039755 TCACCTGCAATGTGGCAAGCAGG + Intergenic
1102100869 12:110277822-110277844 TTAGCTGCTAAAAGGCAAGCTGG - Intergenic
1103007014 12:117429250-117429272 TAATCTGCAAAGTGGCAAGCGGG - Intronic
1103125737 12:118420876-118420898 ACAGCCAGTAAATGGCAAGCCGG + Intergenic
1103686803 12:122738584-122738606 ACAGCTACTAAGTGACTACCAGG + Intergenic
1104143541 12:126010507-126010529 ACAGCTGCTAAGTGCAAAAGAGG + Intergenic
1104800125 12:131548914-131548936 GCAGCTACTAAGTGGCCAGTGGG + Intergenic
1105056122 12:133100806-133100828 ACAGCTCCTAAGTGACTAACAGG + Intronic
1106085898 13:26541339-26541361 ACAGCTATTAAGTGGCAGGCTGG - Intergenic
1110173537 13:72530824-72530846 ACAGCTGCAAAGAGGGAAACCGG + Intergenic
1111592228 13:90364273-90364295 ACAGCTACTTAGTGGCAGGTTGG + Intergenic
1113143933 13:107186106-107186128 ACAGCTACTAAGTGACTAACAGG - Intronic
1116053810 14:39838663-39838685 ACAGCTGGTAGGTGGAAAACTGG + Intergenic
1117126428 14:52631930-52631952 CCAGCTGCTATTTGGCAAGTTGG + Intronic
1119167340 14:72505687-72505709 ACAGCTGGTAGGTGGCAGCCAGG - Intronic
1119408971 14:74416939-74416961 ACAGCTGGTGAGTGGGGAGCTGG + Intronic
1120120068 14:80668210-80668232 ACAGCTGCTATGTGAAGAGCTGG + Intronic
1120904629 14:89609662-89609684 ACAGCTGTTAAGTGGCAGGGAGG + Intronic
1121245916 14:92460766-92460788 ACAGCTGATAAGTGGGGAGGTGG + Intronic
1121880565 14:97496928-97496950 ACAGCTGCAAAATGGCAGCCTGG - Intergenic
1122349864 14:101082882-101082904 ACAGCTTCCAAGTGGCAAGCTGG + Intergenic
1122833734 14:104421032-104421054 ACAGGTGCTCCGTGGCAGGCTGG - Intergenic
1124493875 15:30174731-30174753 AGAGCTGCTAAGTGTCAGGTTGG - Intergenic
1124706676 15:31972298-31972320 AGGGCTGCTGAGTGGCCAGCAGG - Intergenic
1124749693 15:32363915-32363937 AGAGCTGCTAAGTGTCAGGTTGG + Intergenic
1125253370 15:37732510-37732532 ACAGCTACTAAGTGACAAACAGG + Intergenic
1125298017 15:38223435-38223457 ACAGCTGCTCAGAGTCAACCTGG - Intergenic
1126313389 15:47341499-47341521 ACAATTGCTCAGTGGCAAGATGG - Intronic
1126317757 15:47388536-47388558 ACAGCTACTAAGTGACTAACAGG - Intronic
1126521516 15:49600672-49600694 ACAGATGTTAAGTGGCTGGCTGG - Intronic
1126653709 15:50953563-50953585 ACAGCTACTAAGTGACTAACAGG - Intronic
1126914304 15:53448492-53448514 AAAGATGCTAAGTGGCAGGGGGG - Intergenic
1127063684 15:55214648-55214670 ACAGTAACTAAGAGGCAAGCAGG - Intronic
1132379988 15:101359617-101359639 AGAGCTGCTGAGTGCCATGCAGG + Intronic
1132686518 16:1164529-1164551 ATGGCTGCTAAGTGGCCATCAGG + Intronic
1132780353 16:1621080-1621102 ACAGCTGCTCAGTGCCCAGCAGG - Intronic
1133197099 16:4178806-4178828 ACAGCTGTTAAGAGGAGAGCTGG - Intergenic
1133322287 16:4921822-4921844 CCAGCTGCAAAGTGGAGAGCTGG + Intronic
1133669911 16:8008170-8008192 ACCGCTGCTAAGAGAAAAGCAGG + Intergenic
1134667277 16:16028008-16028030 ACAGCTAGGAAATGGCAAGCTGG + Intronic
1134685040 16:16152697-16152719 ACAGCTAGTAAGTGGCAGGGCGG + Intronic
1134808940 16:17150640-17150662 ACAGCTGGTGAGTGGCAATGAGG + Intronic
1134884745 16:17780613-17780635 ACAGCTAGTAAATGGCAAGGTGG + Intergenic
1135274437 16:21099592-21099614 ATAGCTACTAAGTGGCAAGGTGG - Intronic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1136346837 16:29681181-29681203 ACTGCTGCTGAGTGGCAGTCAGG - Intronic
1137065890 16:35842873-35842895 ATGGCTGCTAAGTGGAAAACTGG - Intergenic
1139395515 16:66635605-66635627 TCAGCTGCTGAGGGGGAAGCAGG - Intronic
1140269188 16:73447687-73447709 ACTGCTGCTAAGAGGAAAGAAGG + Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1141222613 16:82085233-82085255 TCAGCTGCTCAGTGGCAAGATGG + Intronic
1141406370 16:83797199-83797221 ACATATGCTAACTGGCAATCAGG + Intronic
1141410062 16:83827110-83827132 ACAGCTGGTAAGAGGCGAACTGG + Intergenic
1145306517 17:21678514-21678536 ACAGCAGCCAAGGGGCATGCTGG + Intergenic
1145783065 17:27576582-27576604 ATAGCTACTAAGTGACAAACAGG + Intronic
1146465202 17:33080760-33080782 ACGGCTGCTAAGTGACCAGCAGG + Intronic
1148878510 17:50707505-50707527 ACGGCTGGTAAGTGGGGAGCGGG - Exonic
1152182650 17:78833591-78833613 ACAGTTACTAAGGGGCAAACTGG + Intronic
1152956301 18:44917-44939 GCAGCTGCTAAGTGGCCAACAGG + Intergenic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1154975495 18:21453651-21453673 TCACCTGCTGAGTGGCCAGCTGG + Intronic
1155181949 18:23355639-23355661 AAAGCTGCTATGTGGCTAGTGGG - Intronic
1156919823 18:42508126-42508148 ACAGCTACTAAGTGACTAACGGG + Intergenic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1159068331 18:63594074-63594096 TCAGCTGATAAGAGGCAAACTGG + Intronic
1159620907 18:70637210-70637232 ACAGCTACTAAGTGACTAACAGG - Intronic
1160110605 18:76026336-76026358 ACAGCAGCTAAGTGACTAACAGG + Intergenic
1160213674 18:76907059-76907081 ACAGCAGCGCAGTGGCACGCAGG - Intronic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1162347403 19:10127706-10127728 ACAGCCGCTAAAAGTCAAGCAGG - Intergenic
1163586820 19:18168816-18168838 GGAGATGCTGAGTGGCAAGCGGG + Exonic
1163637481 19:18444063-18444085 ACAGCTGCTCAGAGCCAAGGGGG - Exonic
1163774716 19:19211488-19211510 ACAGCTGGTAAGAGGCACGCAGG - Intergenic
1164109903 19:22146482-22146504 AAAACTGGTAAGAGGCAAGCTGG - Intergenic
1164875027 19:31678649-31678671 TGAGCTGCTAAGGGGCAAGAGGG + Intergenic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
1168097985 19:54126307-54126329 CCAGCTGATAAGTGGCCATCAGG - Intronic
926248586 2:11139758-11139780 ACAAATGCCAAGTGTCAAGCAGG - Intronic
926784813 2:16508624-16508646 ACAGCCGCTAATAGGCAAGGAGG + Intergenic
927941792 2:27108408-27108430 ACAGAGGTTAAGTGGCAAGGTGG + Intronic
929013439 2:37470790-37470812 AAAGCTGCTAAGTGACTAACAGG - Intergenic
929316241 2:40482624-40482646 ACAGCTGGTAAGTGGCAGAGTGG + Intronic
930709073 2:54533109-54533131 ACGGCTGCTAAGTGACTAACAGG + Intronic
930713021 2:54567034-54567056 ACAGCTGCTCACTGGAAAGCAGG - Intronic
930736174 2:54781211-54781233 ACAGCTAGTGAGTGGCAGGCTGG + Intronic
932431054 2:71673703-71673725 ATAGCTAGGAAGTGGCAAGCTGG - Intronic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
933670615 2:85004013-85004035 CCAGCTGCTAAGTGACTAGTGGG + Intronic
933786945 2:85850714-85850736 ACATCTGAGAAGTGGCAAGAGGG + Intronic
934612497 2:95751615-95751637 ACAGCTTCTATGTGACCAGCTGG - Intergenic
934841655 2:97627829-97627851 ACAGCTTCTATGTGACCAGCTGG + Intergenic
936102577 2:109595928-109595950 ACAGATGCTGAGAGGCAAGCAGG - Intronic
936142383 2:109951503-109951525 ACAGCTACTAAGTGACTAGTGGG - Intergenic
936152791 2:110030834-110030856 TCAGCTGTTAAGTGGAAAGGAGG + Intergenic
936179073 2:110249462-110249484 ACAGCTACTAAGTGACTAGTGGG - Intergenic
936191889 2:110340578-110340600 TCAGCTGTTAAGTGGAAAGGAGG - Intergenic
936202305 2:110419970-110419992 ACAGCTACTAAGTGACTAGTGGG + Intronic
936249442 2:110856325-110856347 ACAGCTACTAAGTGACTAACGGG - Intronic
936589352 2:113788432-113788454 AGAGCTGCTAGGTGTCAAGGTGG + Intergenic
937135365 2:119547006-119547028 ACACCTGGTAAGTGGAGAGCTGG + Intronic
938722438 2:134078591-134078613 ACAGCTGCTAAGAGAAAAACAGG + Intergenic
940583185 2:155607701-155607723 AGATCTGCTAACTGGTAAGCTGG + Intergenic
940765804 2:157788444-157788466 ACATCTGCTCAGTGACTAGCAGG - Intronic
941577134 2:167247348-167247370 CCAGCGGCCAAGTGGCAAGGGGG + Exonic
942518273 2:176775983-176776005 ATAGCTAGTAGGTGGCAAGCAGG + Intergenic
943626642 2:190208864-190208886 AGAGCTGGTAAGTGGCAAATGGG - Exonic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
945714317 2:213338405-213338427 AAAGATGCAGAGTGGCAAGCTGG + Intronic
945721402 2:213422119-213422141 TCACCTGCAAAGTGGCAAGCAGG - Intronic
945828208 2:214750485-214750507 ACAGCTGCTCAGAGACAAGGAGG - Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946719847 2:222592986-222593008 ACAGCTACTAAGTGACTAACGGG - Intronic
947583276 2:231335195-231335217 ACAGCTGGTCAGTGGCCAGCAGG + Intronic
948217418 2:236242153-236242175 ACAGCTGCTAACTAGCCAGGCGG - Intronic
948301051 2:236907671-236907693 GGAGCTGCTTCGTGGCAAGCTGG + Intergenic
1168917983 20:1506925-1506947 ACAGCTCCTAAGTGCCTGGCTGG - Intergenic
1169477615 20:5947021-5947043 ACATCTGCTGAGTGCCAACCAGG + Intronic
1169665406 20:8029483-8029505 TCAGCAGCCAAGTGGAAAGCTGG + Intergenic
1170873433 20:20229468-20229490 ACAGGTGCTGAGAGGTAAGCAGG + Intronic
1170974713 20:21151162-21151184 ACAGCTAGTAAGTGGCATACTGG + Intronic
1171005992 20:21466289-21466311 ACAGATTCTAAGTCTCAAGCTGG - Intergenic
1173648206 20:44646691-44646713 CTAGCTGCTAAGCGGCAGGCAGG + Intronic
1173934986 20:46853526-46853548 ACAGCTGCTAAGTGACTAATGGG + Intergenic
1174732705 20:52933398-52933420 ACAGCCAAGAAGTGGCAAGCGGG + Intergenic
1174999025 20:55606012-55606034 ACAGCTCCTAAGTGGGAAGTTGG - Intergenic
1175231468 20:57476200-57476222 AGAGTTGCTGAGTGGCAAGCTGG - Intergenic
1176290305 21:5040440-5040462 TCAGCTGCTATGTGGGGAGCTGG + Intronic
1177832164 21:26151204-26151226 ACAGCAGTGAAGTGGCAAGGAGG + Intronic
1178972593 21:37194408-37194430 TCAGCTTCTAAGTGGCTCGCGGG - Intronic
1179866950 21:44223201-44223223 TCAGCTGCTATGTGGGGAGCTGG - Intronic
1180627748 22:17205536-17205558 ACAGCTGGTAAATGGCCAGTTGG - Intronic
1180640269 22:17292585-17292607 TCAGCAGCCAAGTGGCCAGCAGG + Intergenic
1182922599 22:34093834-34093856 ATAGCTGCTCAGTAGCAAGGTGG + Intergenic
1183998571 22:41655037-41655059 ACAGCTACTAAGTGACTAACTGG - Intronic
949826517 3:8171148-8171170 ACAGCTGCTATGTATCAAGAAGG - Intergenic
949926264 3:9044329-9044351 GCAGCTACTAAGTGGCCAGTGGG + Intronic
950236269 3:11323370-11323392 ACAGCTGGTAGGAGGGAAGCTGG - Intronic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
950438849 3:12995549-12995571 ACAGCAGCTAAGGGGTGAGCTGG + Intronic
951505410 3:23439619-23439641 ACAGCTGCTCAAGGACAAGCTGG - Intronic
951745443 3:25972738-25972760 TCAGCTACTAAGTGACTAGCGGG - Intergenic
953419771 3:42745409-42745431 ACAGCTGGTGAGTGGAGAGCTGG + Intronic
953700802 3:45194281-45194303 ACAGTTCCTAAGTGACGAGCTGG - Intergenic
954925616 3:54231818-54231840 ACAGCTGCTCACTGTCCAGCAGG + Intronic
955326667 3:58013954-58013976 ATAGCTACTTAGTGGCAAGTGGG - Intronic
955440755 3:58952407-58952429 ACAGCTGCTAAATGACTAACAGG - Intronic
956103489 3:65792642-65792664 TCAGCTACTAAGTGGCTAACAGG + Intronic
957388448 3:79529612-79529634 ACAGCTAATAAGTGACAAACAGG + Intronic
959137612 3:102443924-102443946 ACAGGTGCAAAGTGGAAAGCAGG - Intronic
959784912 3:110284505-110284527 ACAGCTGCGATCTGGGAAGCAGG - Intergenic
960189021 3:114680846-114680868 AGTGCTGCTAAGTTGTAAGCTGG - Intronic
961706252 3:128788125-128788147 ACAGCTACTAAGTGACTAACGGG - Intronic
962306632 3:134293181-134293203 GCATCTGCTATGTGCCAAGCAGG + Intergenic
962340284 3:134576568-134576590 ACAGCTGCTAAGTGGCAAGCTGG - Intergenic
966892515 3:184417592-184417614 ACAGCTAACAAGTGGCAAGTGGG + Intronic
967355048 3:188559877-188559899 AAAGCTGCTATGTGAAAAGCTGG - Intronic
968358034 3:198123324-198123346 GCAGCTGCTGAGTGGCCAACAGG - Intergenic
968793235 4:2683768-2683790 ACACCTGGTAAGTGGAATGCTGG - Intronic
970662481 4:18301585-18301607 ACAGTTGGTAAGTGGTAAACTGG - Intergenic
972145927 4:36025368-36025390 CCAGCTGCTACTTAGCAAGCTGG + Intronic
972240912 4:37190666-37190688 ACAGCTACTAAGTGACTAACAGG + Intergenic
973312603 4:48725656-48725678 ACTGCTCCTAAGTGACTAGCGGG - Intronic
973564816 4:52173869-52173891 GCAGCTGCTTAGTGGCAAACTGG + Intergenic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
976873608 4:89827161-89827183 ACAGCTGGTAAGGAGTAAGCAGG + Intronic
978180128 4:105784158-105784180 ACAGATGCTAAATGAAAAGCAGG - Intronic
978198873 4:106001548-106001570 ACAAATGGTAAGTGGCCAGCAGG + Intronic
978914355 4:114105463-114105485 ACTGCTGCTAAGTGGCAGCATGG + Intergenic
979550265 4:121983119-121983141 ACAGCTGCTAAGTGACTAACAGG + Intergenic
981453874 4:144931531-144931553 AAAGGCACTAAGTGGCAAGCTGG - Intergenic
984265368 4:177492188-177492210 ACAGCTGCTAAGTGACTAATGGG + Intergenic
985440421 4:189979762-189979784 GCAGCTGCTAAGTGGCCAACAGG + Intergenic
985475368 5:75824-75846 ACATCTGTTACGTGGCACGCAGG + Intergenic
985536863 5:469943-469965 CCTGCTGCTAAGTGGGAAGCTGG - Intronic
985920942 5:2973071-2973093 ACAACTGCTAAGAGAGAAGCCGG + Intergenic
985997335 5:3604273-3604295 GCAGCTGCTCTGTGGCCAGCAGG + Intergenic
986096098 5:4555329-4555351 TCACCTGCTGAGTGGCAGGCAGG + Intergenic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
986746932 5:10753270-10753292 ACAGCTGGCAAGCGGCAAACTGG + Intronic
987177566 5:15331297-15331319 ACAGCTACTAAGTGACTAACGGG + Intergenic
989067235 5:37476336-37476358 ACAGCTGCAAAATGGCAGGAGGG - Intronic
990765037 5:59173048-59173070 ACAACTACTAAGAGGAAAGCTGG + Intronic
991284577 5:64957528-64957550 ACAGCTGATAGGTAGAAAGCTGG + Intronic
991577937 5:68124244-68124266 AAAGATGCAGAGTGGCAAGCTGG + Intergenic
994503748 5:100613462-100613484 ACAGCAGATGAGTGGCAGGCAGG + Intergenic
995594432 5:113732849-113732871 ACAGCTGGTAACTGGCATCCTGG - Intergenic
996467027 5:123814886-123814908 TAAGCGACTAAGTGGCAAGCAGG + Intergenic
998444401 5:142187451-142187473 TCAGATGCTTAGTGCCAAGCTGG - Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999587070 5:153101389-153101411 ACATCTGATAAATGGCATGCAGG + Intergenic
999681803 5:154067689-154067711 CCACCTGCTAGGTGCCAAGCAGG + Intronic
1000114998 5:158145686-158145708 GCAGCTGCTAACTTACAAGCAGG + Intergenic
1001057041 5:168458290-168458312 ACAGCTGCTAAGTACAAAGCTGG + Intronic
1001917863 5:175576400-175576422 ACAGCTGCTAAATGCCAAAATGG - Intergenic
1004317217 6:14600070-14600092 ATAGCTGCTAAGAGGAAAGATGG + Intergenic
1004663529 6:17730504-17730526 ACAGCTACTAAGTGACTAACAGG - Intergenic
1005376840 6:25191481-25191503 ACAGGTGCGAAGTGGTAAGTAGG + Intergenic
1005940004 6:30553616-30553638 ACACCTGCTGAGTGGGGAGCTGG - Intronic
1006482301 6:34306342-34306364 AAAGCTGTTAAGTGGCAACAAGG + Intronic
1006816849 6:36857280-36857302 ATAGCTGGTAAGTGGCAATGTGG + Intronic
1007262284 6:40572114-40572136 ACATGTGATAAGTGGCATGCAGG - Intronic
1007446268 6:41908762-41908784 ACAGCTGGCAAGTAGGAAGCGGG - Intronic
1007652990 6:43434629-43434651 AGAGCTGCTGAGTGGCATTCGGG + Exonic
1010841844 6:80655643-80655665 ACAGCTACTAAGTGACTAACAGG + Intergenic
1011226104 6:85108990-85109012 ACAGCTGGTTAGTGGCAGACTGG - Intergenic
1011930611 6:92707168-92707190 ACAGCTGCTAAGTGACTAATGGG - Intergenic
1012418178 6:99032613-99032635 GCAGCTGCTGAGTGGCAAGAAGG - Intergenic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1015585888 6:134775994-134776016 AGAGCTGGTAACTGGCAAGATGG + Intergenic
1017944230 6:159080586-159080608 ACATCTGCTAATGGGCAAGGTGG + Intergenic
1018004194 6:159605080-159605102 ACAGGTGCTTATTGGCAGGCAGG + Intergenic
1018361906 6:163079020-163079042 ACAGCTAGTTAGTAGCAAGCTGG - Intronic
1018470461 6:164091960-164091982 ATGGCTACTAAGTGGCTAGCAGG - Intergenic
1018772834 6:166986868-166986890 ACTGTTACCAAGTGGCAAGCTGG - Intergenic
1019103762 6:169651752-169651774 GCTGCTGCTAACTGGCATGCTGG + Intronic
1020249120 7:6453048-6453070 ACATCAGCCAGGTGGCAAGCTGG + Intronic
1020349889 7:7208116-7208138 ACAGCTGCTAAGTGACTATCGGG - Intronic
1021845707 7:24760434-24760456 TCAGCTGGTAAGTGGTAGGCTGG - Intergenic
1022300724 7:29099827-29099849 ACAGCTGTTATGTGGCCAACTGG - Intronic
1022707641 7:32819582-32819604 AGAGCTGCTAAGTGGCAGCCAGG - Intergenic
1023888184 7:44375440-44375462 ACCTCTGCTAAGTGGAAGGCAGG - Intergenic
1024973487 7:55092061-55092083 ACAGCTGCTTAATGGATAGCAGG + Intronic
1026377183 7:69763598-69763620 ACAGCCTCTAAGTGGCTAACAGG - Intronic
1026407163 7:70078249-70078271 ACAGCTACTAAGTGACTAACAGG + Intronic
1026929415 7:74215562-74215584 ACGTCTGCTAAGTGGAAAGATGG - Intronic
1028704397 7:93821720-93821742 AAAGCTGCTAAGTTGCCAGCAGG + Intronic
1029710610 7:102297223-102297245 ACAACTCCTAAGTGGCGAGCGGG - Intronic
1029900583 7:104035104-104035126 ACAGCTGTCAGGTGGCAGGCTGG - Intergenic
1030738783 7:113083985-113084007 GCAGCTGCCAATTGGCTAGCAGG - Exonic
1030865516 7:114697991-114698013 ACACCTGCTAAGTTGCATCCAGG + Intergenic
1031309587 7:120178878-120178900 AGAGCCTCTAAGTGGTAAGCAGG + Intergenic
1031697153 7:124872481-124872503 ACAGCTACTAAGTGACAAACAGG - Intronic
1032275861 7:130454772-130454794 ACAGCTTCTCAGTGGCAAGGAGG + Intergenic
1032924639 7:136589488-136589510 ACAGTTGTCAAGTGTCAAGCTGG + Intergenic
1033880368 7:145874378-145874400 ACAGCTACTAAGTGACCAACAGG - Intergenic
1034613723 7:152396072-152396094 ACAGCTACTAAGTGTGAGGCTGG + Intronic
1036090914 8:5664380-5664402 ACAGCTGATAAGTGGTAGCCAGG + Intergenic
1038502868 8:28060199-28060221 GTAGCTGCTTAGTGCCAAGCTGG - Intronic
1038707033 8:29903813-29903835 ACAGCTGCTATGTGGGAGGGAGG + Intergenic
1038792894 8:30684352-30684374 ACAGCTGGCAAGTTTCAAGCTGG + Intronic
1038868024 8:31460865-31460887 AGAGCTTGTAAGTGGCAAGAGGG - Intergenic
1039010642 8:33089385-33089407 ACAACTGCTATGAGGCAAGCAGG + Intergenic
1039949918 8:42162300-42162322 ACAGCTGCCCAGTGGGAAGCTGG - Exonic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1041520549 8:58751246-58751268 ACAGCTGCTAAGTAGGAAGTTGG + Intergenic
1041958408 8:63583051-63583073 AGAGCTACTAAGAGGTAAGCTGG - Intergenic
1042790930 8:72605281-72605303 CCAGCTGCCAAGGAGCAAGCAGG - Intronic
1043515925 8:80994555-80994577 ACAGGAGCTAAGTGGCAGGGAGG + Intronic
1045979226 8:108164967-108164989 ATAGCTGGTAAGTGACATGCTGG + Intergenic
1047202283 8:122777369-122777391 ACAGCTGATAAGTTAGAAGCAGG - Intergenic
1047711255 8:127554743-127554765 ACAGCTGCTAAGTGACTGACAGG + Intergenic
1048039884 8:130716988-130717010 CAAGCAGGTAAGTGGCAAGCTGG - Intergenic
1048583815 8:135754259-135754281 ACTGCTGCTAAGTGACTAACGGG - Intergenic
1050857942 9:10385607-10385629 ACAGCTGTTAAGTGGAAGTCAGG - Intronic
1051592369 9:18789393-18789415 AGAGCTGCTAAGTGGCAAAGCGG + Intronic
1053531044 9:38881217-38881239 AGAGATGCAATGTGGCAAGCTGG + Intergenic
1054203267 9:62105649-62105671 AGAGATGCAATGTGGCAAGCTGG + Intergenic
1054635095 9:67482715-67482737 AGAGATGCAATGTGGCAAGCTGG - Intergenic
1055557202 9:77487115-77487137 ACAGCTACTAAGTGACTAGTAGG + Intronic
1055599199 9:77897751-77897773 GCAGCTGCTAAGTGCCAAGATGG + Intronic
1057316997 9:93975903-93975925 AAAGCTGCAAAGTGGCATTCGGG - Intergenic
1058693861 9:107542578-107542600 ACAGCTACTAAGTGGCTAATGGG + Intergenic
1058800533 9:108540834-108540856 AGAGCTGGTAAGTGGCATGGTGG + Intergenic
1059247521 9:112861473-112861495 ACACCTGGTAAGTGGCAGGTGGG + Intronic
1059936648 9:119318599-119318621 AGAGCCCCCAAGTGGCAAGCAGG + Intronic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1060829663 9:126705712-126705734 ACAGCTGGGAAGCGGCAGGCTGG + Intergenic
1061177368 9:129005823-129005845 TCAGCTGGGAAGTGGCAGGCAGG - Intronic
1062585169 9:137245941-137245963 CCTGCTGCTAAGTGGCCAGCAGG - Intronic
1062741900 9:138179859-138179881 GCAGCTGCTAAGTGGCCAACAGG - Intergenic
1186996162 X:15125404-15125426 AAAGCTGCTAAGTGTCAAAATGG + Intergenic
1187440887 X:19318742-19318764 ACAGGTTCTATGTTGCAAGCTGG - Intergenic
1187725661 X:22199598-22199620 ACAGCTACTAAGTGACTAACAGG - Intronic
1189577161 X:42366356-42366378 ACAGCTGCTGAGTGACTAACAGG + Intergenic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1190736861 X:53261308-53261330 ACAGCTGGTCAGTGGCAGTCAGG - Intronic
1190937751 X:55011882-55011904 ACAGCTTCTAAGTTGCAACTGGG - Intronic
1191781128 X:64866909-64866931 ACTGCTGCTATGTTCCAAGCTGG - Intergenic
1193714729 X:84924954-84924976 AAAGGTGCAGAGTGGCAAGCTGG - Intergenic
1196932949 X:120698941-120698963 AAAGGTGCAAAATGGCAAGCCGG + Intergenic
1199483036 X:148318984-148319006 ATAGCTACTAAGTGGCTAACAGG - Intergenic
1201758403 Y:17514395-17514417 GCAGCTGCTAAGTGACCAACAGG + Intergenic
1201843152 Y:18391595-18391617 GCAGCTGCTAAGTGACCAACAGG - Intergenic
1201958209 Y:19649176-19649198 ACAACTGCTTGGAGGCAAGCTGG + Intergenic