ID: 962343110

View in Genome Browser
Species Human (GRCh38)
Location 3:134601758-134601780
Sequence GCACCCTTGTGAGCTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962343097_962343110 27 Left 962343097 3:134601708-134601730 CCAGGGGAGACACCCCTTTTGCT 0: 1
1: 0
2: 2
3: 6
4: 117
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343099_962343110 15 Left 962343099 3:134601720-134601742 CCCCTTTTGCTCGAGGCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343096_962343110 28 Left 962343096 3:134601707-134601729 CCCAGGGGAGACACCCCTTTTGC 0: 1
1: 0
2: 1
3: 14
4: 124
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343107_962343110 -4 Left 962343107 3:134601739-134601761 CCGGCCTGTTGGATGATGGGCAC 0: 1
1: 0
2: 1
3: 6
4: 125
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343101_962343110 14 Left 962343101 3:134601721-134601743 CCCTTTTGCTCGAGGCCGCCGGC 0: 1
1: 0
2: 0
3: 1
4: 18
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343095_962343110 29 Left 962343095 3:134601706-134601728 CCCCAGGGGAGACACCCCTTTTG 0: 1
1: 0
2: 1
3: 12
4: 230
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343094_962343110 30 Left 962343094 3:134601705-134601727 CCCCCAGGGGAGACACCCCTTTT 0: 1
1: 0
2: 0
3: 15
4: 156
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343105_962343110 -1 Left 962343105 3:134601736-134601758 CCGCCGGCCTGTTGGATGATGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343102_962343110 13 Left 962343102 3:134601722-134601744 CCTTTTGCTCGAGGCCGCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 42
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113
962343108_962343110 -8 Left 962343108 3:134601743-134601765 CCTGTTGGATGATGGGCACCCTT 0: 1
1: 0
2: 1
3: 7
4: 75
Right 962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962343110 Original CRISPR GCACCCTTGTGAGCTGGTTC TGG Intronic
903218781 1:21857401-21857423 GCCCCCCTGTGAGCCGGTGCTGG + Intronic
904401046 1:30256948-30256970 TCACCCTGGTGACTTGGTTCCGG - Intergenic
906869762 1:49465263-49465285 GCAGACATGTCAGCTGGTTCTGG + Intronic
908693711 1:66812433-66812455 ACACCCTAGTGTGCTGGTTAGGG - Intergenic
913529218 1:119721623-119721645 GCACCTCTGTGACCTGGTTCAGG + Intronic
915607121 1:156959489-156959511 TTAGCCTTGTGAGCTGCTTCTGG - Intronic
917691106 1:177470111-177470133 GCACCATTGTGTGCTGGAGCTGG - Intergenic
922728367 1:227936947-227936969 GCACCCTTCTCAGCTGCCTCTGG + Intronic
1065281263 10:24141113-24141135 GTACCCTTTTGAGCTGAGTCTGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067999857 10:51319972-51319994 GCACCACTGTGAGCTTGTTATGG - Intronic
1073221733 10:101880255-101880277 GCTGCCTTGTGTGATGGTTCGGG + Intronic
1074185764 10:111098388-111098410 GCACCCTGGCTAGCTGGTTTTGG + Intergenic
1079239690 11:18713846-18713868 GCACCTTAGTGTGCTGGGTCAGG - Exonic
1079433075 11:20415705-20415727 GCACACTTGTTACCTGGTTTGGG - Intronic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1083836637 11:65273402-65273424 GCATCCTTGAGAACTGGTACTGG + Intronic
1084216528 11:67649951-67649973 GCACACGTGTGACCTGGCTCTGG + Intronic
1091895315 12:4098173-4098195 CCAGCCTGGTGTGCTGGTTCAGG + Intergenic
1091931788 12:4402435-4402457 GGAGCCTTGAGAGCTGCTTCAGG + Intergenic
1092112045 12:5970825-5970847 GCAGCCTTGGGAGCTGGTGCTGG - Intronic
1094379282 12:29825446-29825468 GCACACTGCTTAGCTGGTTCTGG - Intergenic
1094867206 12:34549974-34549996 GCACACTTGGGAGCTCGTTGAGG - Intergenic
1095917473 12:47494516-47494538 CCAGCTTTGTGGGCTGGTTCTGG + Intergenic
1100392742 12:94158317-94158339 GCAGCCTGGTGAGCTGCTTGTGG - Intronic
1105279397 13:18954436-18954458 GGGCTCTTGTGAGCTGGTGCTGG - Intergenic
1106755180 13:32815167-32815189 GCATGCCTGTGAGCTGGCTCTGG + Intergenic
1108454228 13:50597129-50597151 GCTCCACTGTGAGCTGGTGCAGG + Intronic
1113465603 13:110510765-110510787 GCTCCCTTCTGACCTCGTTCTGG + Intronic
1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG + Intergenic
1117376956 14:55125854-55125876 GCTCCCTTCTAAGCAGGTTCTGG + Intronic
1119454115 14:74739549-74739571 GAACCCTTGTGCGCTGTTCCTGG + Intergenic
1119817669 14:77584848-77584870 ACACCCTTGTGATCGGGTTGCGG + Intronic
1122260861 14:100521911-100521933 ACACCCTTGTTAGGTGGCTCTGG - Intronic
1122750340 14:103928365-103928387 GCGCCCTTGTGGGCGGGCTCCGG - Intergenic
1124604320 15:31159773-31159795 GCAGCCTGGTGAGCTGGGTATGG + Intronic
1128285892 15:66436775-66436797 GCTCCCTTATGATCTGGTTCCGG - Exonic
1131470319 15:92690993-92691015 GCATCCTTGAGAGCTGATCCTGG - Intronic
1131508801 15:93037558-93037580 TTACCCTGGTGAGCTGGCTCGGG - Intronic
1132456401 16:26048-26070 GGGCCCTGGAGAGCTGGTTCTGG - Intergenic
1132869531 16:2109650-2109672 GCACCAATGTGAGCTGGTGCTGG - Exonic
1134717886 16:16365949-16365971 GCACCAATGTGAGCTGGTGCTGG + Intergenic
1134956864 16:18386210-18386232 GCACCAATGTGAGCTGGTGCTGG - Intergenic
1136152780 16:28362753-28362775 GCTCCTTGGTGAGCTGGCTCTGG + Exonic
1136923350 16:34350158-34350180 GCGCCCGTGTTGGCTGGTTCAGG + Intergenic
1136981223 16:35061648-35061670 GCGCCCGTGTTGGCTGGTTCAGG - Intergenic
1138844898 16:60553956-60553978 ATGCCCTTGTGAGCTGGTTGTGG - Intergenic
1139688322 16:68621818-68621840 GAACCCTTGTGGGCTGGGTGTGG + Intergenic
1142193241 16:88727477-88727499 GCACACTTGTGAGCAGATTTGGG + Intronic
1144678973 17:17180223-17180245 TCACCCTGCTGGGCTGGTTCTGG + Intronic
1144733008 17:17539685-17539707 GTGACCTTGTGAGCTGATTCAGG - Intronic
1145820460 17:27829932-27829954 GCCAGCTTGTCAGCTGGTTCAGG + Intronic
1145821481 17:27839891-27839913 GCCAGCTTGTCAGCTGGTTCAGG - Intronic
1146772154 17:35578721-35578743 GGGCCCTTGTGGGCTGGTTTTGG + Intronic
1148139985 17:45321521-45321543 ACACCACTGTGTGCTGGTTCTGG + Intergenic
1151028445 17:70706549-70706571 GGAACCTTCTGAGCGGGTTCTGG + Intergenic
1151807629 17:76416428-76416450 GCATCCCTCTGAGCTGCTTCTGG + Intronic
1152309994 17:79544281-79544303 GCATCCTTGGGGGCTGATTCTGG - Intergenic
1154411285 18:14143494-14143516 GCTCCCTTGCGAGCAGGTTGAGG - Intergenic
1159098267 18:63930402-63930424 CCACCCATGTGAGCTGGGTAGGG + Intronic
1159119122 18:64149028-64149050 GCCCACCTGTGAGCTGGTCCAGG - Intergenic
1161921248 19:7267855-7267877 GCAACCTAGTGAGGTTGTTCCGG + Exonic
1162240253 19:9346987-9347009 GCACCCTTGTTAATTTGTTCTGG + Intronic
1162558430 19:11402015-11402037 GCTCCTCGGTGAGCTGGTTCTGG + Exonic
925896936 2:8479647-8479669 GCTCCCATCTGAGCTGGTGCTGG - Intergenic
934765251 2:96876838-96876860 GCACCCTGCTGGGCTGGCTCGGG - Intronic
939591164 2:144065404-144065426 GCTCCCTTGTCCTCTGGTTCTGG + Intronic
940995548 2:160145662-160145684 GCACACCTGACAGCTGGTTCTGG - Intronic
945971152 2:216233580-216233602 GCACCAGTGTGAGCAGGTTCAGG + Intergenic
948958073 2:241309896-241309918 GCACCCTTGTCAGCTTCTTTGGG - Intronic
1169832232 20:9838112-9838134 GCACCCTTGTGAGCAGGGCGTGG - Intronic
1171370052 20:24656636-24656658 GCGCACTTGTGATCTGGTCCAGG - Intronic
1173977600 20:47198813-47198835 CCACCCCTGTGAGCTGACTCGGG + Intergenic
1181643155 22:24215332-24215354 GCCCCATTGAGAGCTGGATCTGG + Intergenic
1181820955 22:25475345-25475367 TCACCCTTGTGAGGTCATTCAGG + Intergenic
1183060074 22:35331018-35331040 GCACCCTGGGGAGATGGTCCAGG - Intronic
1183263946 22:36814365-36814387 GTACCCTTGTGAGATGGTTTAGG + Intronic
1185060437 22:48603660-48603682 GCACCTCTGTGGGCTGGTTGGGG - Intronic
949418960 3:3844992-3845014 GCAGCGTTGTGAGCTGGGTTAGG - Exonic
950136444 3:10584402-10584424 GGACACTTGTGGGCTGGGTCAGG - Intronic
950419811 3:12892303-12892325 ACACCCTTGCGAGGTGCTTCTGG + Intergenic
952080430 3:29751822-29751844 GCACGCAGGTGAGCTGGTGCAGG + Intronic
952107688 3:30088499-30088521 GCACACAGGTGAGCAGGTTCAGG + Intergenic
953369683 3:42376721-42376743 GCACCCTGTTGAGGTGGTTGAGG - Intergenic
954105313 3:48406698-48406720 GCAGCCCTGTGAGCTGGTTGGGG - Intronic
956612032 3:71134094-71134116 GCACCAGTGTGAGCGGGTTTGGG - Intronic
957717081 3:83942248-83942270 GCATACATGTGAGCTGGTGCAGG + Intergenic
960040854 3:113148614-113148636 GCACGCAGGTGAGATGGTTCTGG - Intergenic
962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG + Intronic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
963005467 3:140722885-140722907 GCAGCTTAGTGAGGTGGTTCTGG - Intergenic
973224046 4:47762733-47762755 GCACCCTTGTCCTCTGGTTGTGG + Intronic
977574875 4:98665093-98665115 TCACCCATGTGAGCTTGTGCTGG - Intergenic
981144048 4:141304323-141304345 GCACCCTTGTGAAAAGGCTCAGG - Intergenic
981741815 4:148010241-148010263 GCACCCCTTTTAGCTGGATCAGG + Intronic
983076520 4:163332695-163332717 GCACCTTTGTGAGGTGTTTGTGG - Exonic
985659455 5:1149218-1149240 GGACCCTTGTGCGCTGCTTGTGG - Intergenic
992086413 5:73281917-73281939 GCAGCCTTCAGGGCTGGTTCAGG + Intergenic
999208536 5:149867987-149868009 GGACACAGGTGAGCTGGTTCTGG + Intronic
1002868864 6:1147752-1147774 GCACCGTGGTGAGCAGGTCCTGG - Intergenic
1006575691 6:35043723-35043745 GCACCCTTTTGATGTGGATCTGG + Intronic
1009645991 6:66402290-66402312 GAACCCTAGTAAGCTGGTTTAGG - Intergenic
1010516975 6:76785256-76785278 GCAGCCATGTCAGCTGGTTGTGG - Intergenic
1016767409 6:147810461-147810483 GCACAATTGTGAGCTGGTCCTGG + Intergenic
1021879117 7:25076773-25076795 GCCCCATTGTGGGCTTGTTCTGG + Intergenic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1026168382 7:67931502-67931524 GCTCCCTTGTGAGCAGTTGCAGG + Intergenic
1028639891 7:93030047-93030069 GCACACTTTTGCGCTGGTTGTGG - Intergenic
1029737047 7:102470691-102470713 GCACCCTTGCCACCTTGTTCTGG - Intronic
1033040777 7:137916031-137916053 GCACACATGTGAACTTGTTCAGG + Intronic
1037813582 8:22100536-22100558 GCACCCCTGGGAGCTGGGTGGGG + Intronic
1038720171 8:30028037-30028059 GCTCCCTTATGATCTGGTTCCGG - Intergenic
1044916056 8:97113567-97113589 GCAGCATAGTGAGCAGGTTCTGG + Intronic
1048302646 8:133262750-133262772 GCAGCCATGTGATCTGTTTCTGG + Intronic
1049432675 8:142572477-142572499 TCAGCCTTGTGAGCTGGTGGTGG - Intergenic
1060177614 9:121508557-121508579 GCACCCTAGTGAACAGGTGCTGG - Intergenic
1060488475 9:124064741-124064763 GTAGCCTTGTGAGGTGGGTCCGG - Intergenic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1061806117 9:133138545-133138567 ACAACCCTGTGAGCTGGGTCCGG + Intronic
1062273215 9:135719167-135719189 ACACTCTTGAGAGCTGGCTCTGG - Intronic
1188729697 X:33631268-33631290 GCACCCTTGGGTGCTGGTGGAGG - Intergenic
1193443770 X:81574936-81574958 GAACCCTTGTGTGCTGTTTCAGG + Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1197750278 X:129959325-129959347 GCAGCCATGTGTGCAGGTTCAGG - Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1200399962 X:156013675-156013697 GGGCCCTGGAGAGCTGGTTCTGG + Intergenic