ID: 962344400

View in Genome Browser
Species Human (GRCh38)
Location 3:134608906-134608928
Sequence GGGTGTCCATAGGACCACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962344400_962344408 14 Left 962344400 3:134608906-134608928 CCGGAGTGGTCCTATGGACACCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 962344408 3:134608943-134608965 CACCATCTCCGACCCTAACATGG 0: 1
1: 0
2: 0
3: 2
4: 68
962344400_962344405 -9 Left 962344400 3:134608906-134608928 CCGGAGTGGTCCTATGGACACCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 962344405 3:134608920-134608942 TGGACACCCTGGATGGGAAGAGG 0: 1
1: 0
2: 2
3: 23
4: 260
962344400_962344411 21 Left 962344400 3:134608906-134608928 CCGGAGTGGTCCTATGGACACCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 962344411 3:134608950-134608972 TCCGACCCTAACATGGGCACTGG 0: 1
1: 0
2: 0
3: 6
4: 47
962344400_962344409 15 Left 962344400 3:134608906-134608928 CCGGAGTGGTCCTATGGACACCC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 962344409 3:134608944-134608966 ACCATCTCCGACCCTAACATGGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962344400 Original CRISPR GGGTGTCCATAGGACCACTC CGG (reversed) Intronic
901485354 1:9556362-9556384 GGGTGTCAATAGGGCCAACCTGG + Intronic
903681314 1:25099085-25099107 GGGTCTCCATAGGTCCTCCCTGG - Intergenic
912401155 1:109394499-109394521 CGGTGTCCTGATGACCACTCAGG - Intronic
915290406 1:154879325-154879347 CGGTGTCCATAGCAACCCTCCGG - Intergenic
919813720 1:201424865-201424887 GGCTGTGCTTAGGACCAGTCAGG + Intronic
1070303658 10:75224475-75224497 GGGTGACCATCTGACCACCCAGG - Intronic
1074044350 10:109823437-109823459 GTGTGCCCAGAGGACCACCCAGG - Intergenic
1085330192 11:75642233-75642255 GGGTGTCAATATGCCCACTATGG - Intronic
1093723755 12:22478919-22478941 GGGTATACATAGGACATCTCTGG + Intronic
1095964014 12:47854713-47854735 GGCTGGCCATTGGACCTCTCTGG + Intronic
1096357356 12:50952577-50952599 GGGTCTCCACAGCCCCACTCAGG + Intergenic
1111262525 13:85760611-85760633 GGGTGTCGAGAGGAACACACTGG - Intergenic
1117533917 14:56686425-56686447 GGGTGTCTGGAGGACCATTCAGG + Intronic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1132184575 15:99792192-99792214 GGAGGTCCATAAGGCCACTCTGG - Intergenic
1132432404 15:101772464-101772486 GGAGGTCCATAAGGCCACTCTGG + Intergenic
1133308200 16:4824848-4824870 GGGTGTCAAGAGGGCCACTGTGG - Intronic
1133367205 16:5219604-5219626 GGGTGTGCCTATGAGCACTCTGG - Intergenic
1134090877 16:11391093-11391115 GGGTGGTCACAGGAACACTCTGG + Intronic
1140105016 16:71952001-71952023 GGGAGTGCATGGTACCACTCTGG - Intronic
1144645449 17:16970658-16970680 GGTTGTCCACTGGCCCACTCTGG - Intronic
1158957673 18:62555893-62555915 GGGTGGCTATTGGACCACTTGGG + Intronic
1159416217 18:68152553-68152575 GGATGTCCAGAGGAACACACCGG + Intergenic
1159972302 18:74669385-74669407 GTGGATCCATAGGACCACTGAGG - Intronic
1160572407 18:79827229-79827251 GGGTGGACACAGGACCACTGAGG - Intergenic
1161311941 19:3599793-3599815 GGGTGACCAGAGGTCCAGTCAGG + Intronic
1162738606 19:12760742-12760764 GGGTGTTCATAGGCGCCCTCTGG - Intergenic
1165885690 19:39076666-39076688 AGGTGTTCACAGGACCCCTCTGG + Intergenic
1167236808 19:48320487-48320509 GGGTGACCCTAGAACCACGCTGG + Intronic
932164486 2:69493735-69493757 GAGTGCCCATGGGACCACACTGG + Intronic
932401027 2:71481361-71481383 GGGCTTCCAAAGGACCACCCGGG - Intronic
934704409 2:96466683-96466705 GCGTGCCCATAGGCCCACTCAGG - Intergenic
939957978 2:148542537-148542559 GGGTGTCTAAACAACCACTCGGG + Intergenic
940936881 2:159505953-159505975 CGGTGTCCAGATGAGCACTCAGG + Intronic
945330334 2:208531796-208531818 GGGTGTTCCTAGGACCACTAGGG + Intronic
1169192656 20:3667901-3667923 GGGTGCCCTGAGGACCACACGGG - Intergenic
1175172000 20:57087168-57087190 GGGTGGCAGTAGGACCACTGAGG - Intergenic
1176870543 21:14080277-14080299 GGGTGTGCACAGCAGCACTCCGG + Intergenic
1178421094 21:32443918-32443940 GGGTGACCATACGACCATCCAGG + Intronic
1180695436 22:17748865-17748887 CAGTGTCCAAAAGACCACTCTGG - Intronic
1183981800 22:41544753-41544775 GCGTTTCCAAAGGATCACTCTGG - Intergenic
1185346128 22:50311594-50311616 GGGTGTCCAGAGGAGCACCAGGG + Exonic
952507001 3:34016392-34016414 GGGTGTCCCTAGGTACACACTGG - Intergenic
953473324 3:43184934-43184956 GAGTGTCCAAAGGACCTTTCCGG - Intergenic
962344400 3:134608906-134608928 GGGTGTCCATAGGACCACTCCGG - Intronic
963938131 3:151075322-151075344 TGGTGTCCATGGGCCCACCCAGG + Intergenic
965235234 3:166110021-166110043 GGGTGTCCATACACCTACTCAGG + Intergenic
977318921 4:95486567-95486589 GGGTGTCCATATCTCCAGTCTGG + Intronic
981161104 4:141499774-141499796 GAGTGTCCATTTGACCACTCTGG + Intergenic
984464406 4:180079165-180079187 GGGTATCCATAGGTCCTCACCGG - Intergenic
985207077 4:187550207-187550229 GGGTGACCACATGGCCACTCAGG + Intergenic
996018440 5:118566937-118566959 GTGTGTCTATAGGAACATTCCGG - Intergenic
1001671880 5:173480540-173480562 GGATGTCCATAGGACCCTGCTGG - Intergenic
1003120937 6:3318590-3318612 AGGGGTACATAGGACCACACAGG - Intronic
1007444361 6:41894333-41894355 GGGTGTCTGTAGGACGATTCTGG - Intronic
1021182461 7:17523672-17523694 GGGTGGCCACAGGACCATTTAGG + Intergenic
1021221911 7:17984541-17984563 TGTTGTCCTTAGGACCAATCTGG + Intergenic
1022394856 7:29978269-29978291 GAGTGTCCATAGGAAATCTCTGG - Intronic
1024440229 7:49408231-49408253 GGATGTCCAGAGGAACACACCGG + Intergenic
1029050352 7:97680342-97680364 GGGTGACCACATGGCCACTCAGG - Intergenic
1033228502 7:139579201-139579223 GGGTGTTCAAAGGACGAATCAGG + Intronic
1033755807 7:144397693-144397715 GTCTGTCCTTAGGACCACACAGG + Intronic
1036711090 8:11078966-11078988 GGGTCACCTCAGGACCACTCCGG + Intronic
1043924347 8:86020348-86020370 GGGTGACCATGTGACCACTCAGG - Intronic
1046990204 8:120444665-120444687 TGGTGTCAAAAGGAGCACTCTGG - Intronic
1047562428 8:126002366-126002388 GGGTGTCCCCAATACCACTCAGG + Intergenic
1056590636 9:87963620-87963642 GGGTGACCAGGTGACCACTCAGG + Intergenic
1056815350 9:89796957-89796979 GGGCCTCCATGAGACCACTCTGG - Intergenic
1057251591 9:93507726-93507748 GAGTGTCAGTAGGACCACTCAGG + Intronic
1057288957 9:93788192-93788214 GGGTGACAAAAGTACCACTCTGG + Intergenic
1057732371 9:97621573-97621595 GTCCGTCCATAGGACCACCCGGG - Intronic
1059892479 9:118818265-118818287 GGGTGACCACATGGCCACTCAGG + Intergenic
1192314374 X:70040468-70040490 AGGTGGCCATAGGACCAGCCTGG - Intergenic
1201060431 Y:10039024-10039046 GGGTGTCCACACCACTACTCAGG - Intergenic
1202110305 Y:21410060-21410082 GGGTGTCCAAACCACTACTCAGG - Intergenic
1202119232 Y:21507622-21507644 GGGTGTCCACACCACTACTCAGG + Intergenic
1202121684 Y:21531162-21531184 GGGTGTCCACACCACTACTCAGG + Intronic
1202157321 Y:21898220-21898242 GGGTGTCCACACCACTACTCAGG - Intronic
1202159768 Y:21921761-21921783 GGGTGTCCACACCACTACTCAGG - Intergenic