ID: 962344640

View in Genome Browser
Species Human (GRCh38)
Location 3:134610260-134610282
Sequence CTGTGTACCTGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 387}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962344640_962344645 -9 Left 962344640 3:134610260-134610282 CCATCTTCCCTCCAGGTACACAG 0: 1
1: 0
2: 4
3: 40
4: 387
Right 962344645 3:134610274-134610296 GGTACACAGCATTCCAGGCATGG 0: 1
1: 0
2: 2
3: 27
4: 246
962344640_962344651 24 Left 962344640 3:134610260-134610282 CCATCTTCCCTCCAGGTACACAG 0: 1
1: 0
2: 4
3: 40
4: 387
Right 962344651 3:134610307-134610329 CCGAGAAGCTCTGCCCTGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962344640 Original CRISPR CTGTGTACCTGGAGGGAAGA TGG (reversed) Exonic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901334016 1:8433170-8433192 CTGTGTTCCTGGGTGCAAGATGG + Intronic
901632934 1:10656729-10656751 CCGAGAACCTGGAGGGAGGAGGG + Exonic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902606295 1:17571178-17571200 CTGCCAACCTGGAGGGAGGAAGG + Intronic
902711435 1:18242788-18242810 TTCTCTACCTGGAGGGATGAAGG - Intronic
902719711 1:18295855-18295877 CTGTCCCCCTGGAGGGACGAGGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903282325 1:22257139-22257161 TTGTGATCCTGCAGGGAAGAAGG - Intergenic
903733817 1:25517325-25517347 CTCTCTACCTGGTGGCAAGAAGG + Intergenic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904764400 1:32832524-32832546 CTGGGTTCCTGGAAGGCAGAAGG - Intronic
904801951 1:33099283-33099305 CTGGGTACCTGGAGGAAGGAGGG - Intronic
905087115 1:35390606-35390628 ATGTGTACCTGCAGGTCAGAGGG + Intronic
906100606 1:43257953-43257975 CTGTGCACCTGGAAGCAGGAGGG + Intronic
906242700 1:44251788-44251810 CTGTGTACCTGGCAGCAACATGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906261767 1:44397317-44397339 CTCTGTACCAGGAGAGAACAAGG + Intergenic
907372636 1:54013324-54013346 CTGTGTTCCTGCAGGGCAGGGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908796840 1:67838546-67838568 CTGTATATCTGGAGGCTAGATGG - Intergenic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
911651271 1:100391675-100391697 CTAAGGACCTTGAGGGAAGAGGG + Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913483540 1:119313103-119313125 CTGTGTACCAGGAAGGAAGTTGG + Intergenic
915943753 1:160135419-160135441 ATGGCTCCCTGGAGGGAAGACGG - Exonic
915979108 1:160409088-160409110 CTTTGTCCCTGGTGAGAAGAGGG + Intronic
916385994 1:164270990-164271012 CTGTATCCAAGGAGGGAAGAGGG - Intergenic
917611069 1:176689608-176689630 CTGAGTTCCAGGAGGTAAGACGG + Intronic
917709426 1:177669610-177669632 ATGAGTCCCTGGAGGGAAAAGGG - Intergenic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
919076289 1:192817170-192817192 CTGTCTATTTGGAGTGAAGAGGG + Intergenic
919669857 1:200328844-200328866 CCGTGTTCCTGGAAGTAAGAAGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
920572041 1:207024709-207024731 CCTTGTCCCTGGAGGGAAGGAGG - Intronic
922773710 1:228205436-228205458 CTGTATTCCAGGAGGAAAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1068288431 10:54970134-54970156 CTGTGTACTTGCATGGCAGAAGG - Intronic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1069855906 10:71440876-71440898 CTGGCTCCCTGGAGGGGAGAAGG - Intronic
1070341084 10:75499031-75499053 CTGGGAACCTGGAGGCAGGAGGG + Intronic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1071967021 10:90861982-90862004 ATGAGTACCTAGAGGGAAGAAGG - Intergenic
1072258432 10:93643214-93643236 CTGCAAACCTGGAGGCAAGATGG - Intronic
1073173836 10:101537851-101537873 CTATGTACCTTGAGGAAACATGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1074223920 10:111464732-111464754 CTGTGTAACTGGAGTGCAGGAGG + Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075911625 10:126130070-126130092 CTAGGAACCTGGAGGGAAGCTGG - Intronic
1076027774 10:127130443-127130465 CAGTTAAACTGGAGGGAAGAGGG + Intronic
1076293767 10:129368012-129368034 CTGTGCAGCTGGAGGCAAGTGGG - Intergenic
1076404142 10:130201215-130201237 GTGAGTACCCGGAGGGAAGGAGG + Intergenic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076891283 10:133284987-133285009 CTGTCTACCAGGAGGGCACAAGG + Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077907914 11:6548026-6548048 GTAGGTACCTGGAGGGAAGGTGG - Exonic
1078239262 11:9515255-9515277 CTGGATACCTGGAGAGAAGTTGG + Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080018061 11:27528124-27528146 TTTTGTACCTGTAAGGAAGATGG + Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080867102 11:36204999-36205021 CTGGGAACCTGAGGGGAAGATGG - Intronic
1081434367 11:43010886-43010908 ATGTGCACTAGGAGGGAAGATGG - Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083771816 11:64871764-64871786 CTTTGCACCTGGAGGGGAGAGGG + Intronic
1084324016 11:68388663-68388685 CTGAGCACCTAGAGGGAGGAAGG - Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1088029656 11:105231128-105231150 CTGTCTTCCTGGAGGCAAAAAGG - Intergenic
1088512559 11:110593391-110593413 GTGTGTATCTGTTGGGAAGAGGG - Intronic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1089048613 11:115526238-115526260 CTGAGCACCAGCAGGGAAGAGGG - Intergenic
1089363054 11:117903800-117903822 CTGTCTCCCTGCAGGGGAGAGGG + Exonic
1089556719 11:119319293-119319315 CTGGGTCCCTGCAGGGTAGACGG - Intronic
1089782161 11:120881311-120881333 CTGTGTACCTGGTGGGAGAAAGG - Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092166387 12:6345278-6345300 TTCTGTCCCTGGAGGGATGATGG - Intergenic
1093471369 12:19505614-19505636 CAGCGTAGCTGGAGGGAACAAGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1096693625 12:53335594-53335616 CTGGTTTCCTGGGGGGAAGAGGG + Intronic
1097031841 12:56095366-56095388 GTGGTTACCTGGAGAGAAGAGGG + Intronic
1097843487 12:64343770-64343792 TTGTGTCCCTGGAGGGATCATGG - Intronic
1097967616 12:65597567-65597589 TTGGGTACCTGGAGGGCAGCAGG + Intergenic
1098032130 12:66265720-66265742 CTGCCATCCTGGAGGGAAGATGG - Intergenic
1100421830 12:94442352-94442374 CTGGGGACCTGGGGGGAAGGAGG + Intronic
1100955501 12:99903455-99903477 CTCTGTAATTGGAGGGAATAAGG + Intronic
1101372511 12:104142105-104142127 CTGTGTACCAGAGTGGAAGAGGG - Intergenic
1101885792 12:108660559-108660581 CTGTTTGCCTATAGGGAAGAAGG - Intronic
1101957353 12:109222989-109223011 CTGAGCACCTGGAGGGCAGGAGG - Intronic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1103198718 12:119068985-119069007 CTGTGTAGCTCCAGGGAACAGGG + Intronic
1103924186 12:124414620-124414642 ATGTTTACCTGGAGGGCAGCAGG - Intronic
1104400998 12:128476071-128476093 CTGCCTACCTGGAGGAAAGCAGG - Intronic
1104818368 12:131661430-131661452 CTGTTTCCCTGGAGGGCAGCTGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1108315830 13:49236257-49236279 CTGTGAACCTAGAAGCAAGACGG + Intergenic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1109268252 13:60225307-60225329 CTGTGTATCTGGAGGAAGAAAGG - Intergenic
1110872730 13:80471327-80471349 CTGTGTAGCTTAAGGGAATATGG + Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1112755366 13:102626505-102626527 GTGTGTACCTAGAGGTAGGATGG + Intronic
1112862955 13:103857088-103857110 CAGTCTACCTGGAGGGAACAGGG + Intergenic
1113602798 13:111582652-111582674 CTGTGTCCCAGGAGTGTAGAGGG + Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119521144 14:75286421-75286443 CAGAGTGCCTGTAGGGAAGAAGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120479994 14:85037593-85037615 CTATGTACCTCCAGGGCAGAAGG + Intergenic
1120677328 14:87435937-87435959 CTGTGTACCTAAATGGGAGATGG + Intergenic
1120862459 14:89267075-89267097 CTTTTTTCCTGTAGGGAAGAAGG - Intronic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121527684 14:94630752-94630774 CTGGGTACCTGGGGAGAGGATGG - Intergenic
1121615651 14:95311822-95311844 CTGTATCCCTGGAATGAAGAAGG - Intronic
1124382247 15:29176735-29176757 CTGGCGACCTGGAGGGAAGGAGG - Intronic
1125389191 15:39173151-39173173 ATGTGTGCCTGCAGGGAAGGAGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1126460807 15:48913314-48913336 CTGTGTACCTAGAAGGATTATGG + Intronic
1128442568 15:67725936-67725958 CTATGTACGGGGAGGGAAAAGGG - Intronic
1128617383 15:69120921-69120943 CTTATTATCTGGAGGGAAGATGG + Intergenic
1130020942 15:80231189-80231211 ATGTGAACCTGGAGAGAAGTAGG - Intergenic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132380017 15:101359894-101359916 ATATGTACCTGGAGGTGAGAGGG - Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133372349 16:5254861-5254883 ATGTGTAGGTGGAGCGAAGAGGG + Intergenic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1139349739 16:66327568-66327590 CTATTTACCTGGAGTGGAGATGG - Intergenic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142540556 17:655447-655469 CTGTCTGCCTGGAGTGAATATGG + Intronic
1142540567 17:655517-655539 CTGTCTGCCTGGAGTGAATATGG + Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146560042 17:33860236-33860258 CTTTCTACCTGGAGGGAAGAAGG - Intronic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147016353 17:37494796-37494818 CTTTTTAGCTGGAGGGATGATGG + Intronic
1148000838 17:44386042-44386064 CTGTGCCCCTGGAGGGCCGAGGG - Exonic
1148606167 17:48930605-48930627 AGGTGTTCCTGGAGGGAAAAGGG + Exonic
1149895086 17:60422813-60422835 CTGTGTTCCTGGCGAGATGATGG + Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150289182 17:63971843-63971865 AGGTGTACCTGGGGGGGAGAGGG + Exonic
1151484360 17:74389302-74389324 TTGTGTAACTGTAGGGGAGAGGG + Intergenic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1153026640 18:678905-678927 CTGTGTATCTGCAGAGGAGAAGG + Intronic
1153968507 18:10203420-10203442 CTGATTATCTGGATGGAAGAAGG - Intergenic
1153973098 18:10244289-10244311 CTCTGCAGCTGGAAGGAAGATGG - Intergenic
1156357406 18:36354092-36354114 CTGTGTGCCTGGGGAGAAAAGGG + Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1157564781 18:48672632-48672654 CTCCCTACCTGGAGGCAAGAAGG + Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1159598886 18:70410002-70410024 CTGCTTACATGGAGGGAATATGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160024685 18:75208353-75208375 CTGCCAACCTGGAGGGAACAGGG + Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160915863 19:1496221-1496243 CTGTGCCCCTGGTGGGGAGAGGG - Intronic
1161136520 19:2623056-2623078 CTGTGTCCCAGGAGGCAAAAAGG + Intronic
1161238473 19:3209220-3209242 CTGCCAACCTGGAGGAAAGAGGG - Exonic
1161307350 19:3575406-3575428 CTGTCTGCCTGGAGGGAATAGGG + Intronic
1161900663 19:7116839-7116861 CTGTGAACCTGGAGGGCAAGGGG - Exonic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162807218 19:13144294-13144316 CTGGGTAGCTGGAGAGTAGAGGG - Exonic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165926311 19:39328229-39328251 CTGGGTCCCGGGAGGGAAGGAGG - Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
925670405 2:6304374-6304396 CTGTGTACTTTGAGGGGTGAGGG + Intergenic
925769287 2:7266628-7266650 CACTGTATCTGGAGGGAAGGAGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927129554 2:20046934-20046956 ATGTTCTCCTGGAGGGAAGAGGG - Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927943196 2:27118658-27118680 CTGTGTACCCTGAGGGCAGGTGG - Intronic
928545284 2:32323722-32323744 TGGTCTACCTGGAGAGAAGAAGG - Intergenic
928846266 2:35676870-35676892 CTGTGCACTTGGGGGAAAGAGGG - Intergenic
929285691 2:40133200-40133222 CTGTGCACCAAGAGGGTAGAGGG - Intronic
930058214 2:47268220-47268242 CTGAGTACCTGGAGAGAGAAAGG + Intergenic
932582368 2:73000183-73000205 CTGTTTACATGAAGTGAAGAAGG - Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
935268584 2:101414740-101414762 CTGTCCATCTGGAGGGCAGAGGG - Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
942046996 2:172105438-172105460 TTGTGTACATGGGGGAAAGAGGG + Intergenic
942371869 2:175294144-175294166 CTGTGTGCCTGGAGGGGGCATGG - Intergenic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
945163652 2:206919713-206919735 CTGATTACCTGGGGGGAAGAAGG - Intergenic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948409240 2:237746571-237746593 CTGTGTACTTGGAGGCACCAAGG - Intronic
948572425 2:238926082-238926104 CTGTGTACCTGGGAGGAGCATGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1170630243 20:18058811-18058833 CTTTATGCCTGGAGGGGAGAGGG + Intronic
1172390397 20:34561372-34561394 CTGGGCACCTGGCTGGAAGATGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174581390 20:51574230-51574252 CTGATCAGCTGGAGGGAAGATGG - Intergenic
1174750730 20:53108956-53108978 CTGAGTTCTTGGAGGGTAGAGGG - Intronic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175555219 20:59848108-59848130 CAGTATACCAGGAGGGAAGGAGG - Intergenic
1175835048 20:61988281-61988303 CTGTGCACCTGCAGGGAGGAGGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176087268 20:63303848-63303870 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087311 20:63304008-63304030 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087381 20:63304248-63304270 CTGCGCACCTGGAGGGAGGAAGG - Intronic
1176087394 20:63304288-63304310 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087417 20:63304368-63304390 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087430 20:63304408-63304430 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087443 20:63304448-63304470 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087466 20:63304528-63304550 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176087501 20:63304648-63304670 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176663959 21:9667012-9667034 CTGAGAACCTGGAGGGCTGATGG + Intergenic
1179502659 21:41819886-41819908 CTGAGGACCTGGAGGGGTGAGGG + Intronic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183328808 22:37208491-37208513 CTGTGAACCTGGGGGGCAGGTGG + Intronic
1183334351 22:37238073-37238095 CTGTGTACTTGGAGTGAAGTGGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1184847435 22:47097916-47097938 CTGTTTACCTGGAAGTAGGAGGG + Intronic
1184866488 22:47204483-47204505 CTGTGTGCCTGTGGGGAGGAGGG - Intergenic
1185056571 22:48581854-48581876 CTGTGTTCCTGGAGAGGGGAGGG + Intronic
1185274008 22:49942154-49942176 CTGTGTCCCAGGAAAGAAGAGGG + Intergenic
1185373092 22:50469866-50469888 CTGTAACCCTGGAGGGCAGATGG - Intronic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
950183866 3:10933282-10933304 CTGGGTACCTGGTGGGCAGCTGG - Intronic
951196108 3:19825540-19825562 CTGTGTCCCAGGTGGGAAGAGGG - Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
960021333 3:112957084-112957106 CTGTGTACTTGGGGGAAAGAGGG - Intronic
961522618 3:127475680-127475702 CTTTGTCCTTGGAGGGAAGCTGG + Intergenic
961581603 3:127887857-127887879 CTGAGAACCAGGAGGGCAGATGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962680259 3:137792017-137792039 CTGTGTACCTGCAGAACAGAAGG - Intergenic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
965036901 3:163451258-163451280 CTGTGCACCTGCAGGAAGGATGG - Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966986751 3:185187462-185187484 CTGTGTTCCAGGCAGGAAGATGG + Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
967431373 3:189389887-189389909 CTGTCTACCTAGAAGGAAGTAGG + Intergenic
967741734 3:193010480-193010502 CTGTGTTCCTGGAGGGAATGTGG + Intergenic
968347179 3:198019076-198019098 CTTTGTAGCTGCAGGGCAGAGGG + Intronic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
969449983 4:7267501-7267523 CTGGATACATGGAGGAAAGATGG + Intronic
969892798 4:10275344-10275366 TTGTGAACCTGGAGGGAAGAGGG + Intergenic
969904158 4:10377724-10377746 CTGTGTTCCTGAAGGAAACAGGG - Intergenic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970822881 4:20239433-20239455 CATTGTACCAGGAGGGAAGAGGG + Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
976544883 4:86323147-86323169 CTGGGTACCTGGGTGGCAGAGGG + Intronic
977544722 4:98363952-98363974 TTGAGTACCTGGACAGAAGATGG + Intronic
980087195 4:128403623-128403645 CTGTGTACCTAGAAGGATTATGG + Intergenic
981972736 4:150685099-150685121 CTCTGTACCATGAGGGAAGCTGG + Intronic
982612746 4:157596942-157596964 CTGTGTACCTGCAGGTCACAGGG + Intergenic
984472734 4:180197060-180197082 CTGTATACCTGTAAGAAAGATGG + Intergenic
985354171 4:189099444-189099466 TTGTCTTCCTGGAGTGAAGAAGG - Intergenic
985409415 4:189667692-189667714 CTGAGAACCTGGAGGGCTGATGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986273872 5:6256917-6256939 ATGTGTACCTGGAGCTAGGAAGG + Intergenic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
986958238 5:13182029-13182051 CTGTGTCCCTGCATGGCAGAAGG - Intergenic
986961006 5:13212679-13212701 ATGTGTACCTGGTGGTAAGCTGG - Intergenic
988950689 5:36256734-36256756 ATGTGTACCTGGCAGGAAAATGG - Intronic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
992485550 5:77191034-77191056 CTGTGTGCCAGCTGGGAAGAAGG - Intergenic
993467961 5:88270597-88270619 CAGAATACCTGGAGGGAAGGTGG + Intergenic
993917042 5:93756147-93756169 TTGTGTACCTAGAGGGATTATGG - Intronic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
997828650 5:137130082-137130104 CTGTGAAGCTAGAGGCAAGATGG + Intronic
999665202 5:153905573-153905595 TTGTTTCCCTGAAGGGAAGAAGG + Intergenic
999980283 5:156951504-156951526 CTGCGTACCTGCAGTGAGGATGG + Exonic
1000336782 5:160247170-160247192 CTTTGAACCTGGAGGGCAGAAGG + Intergenic
1001020416 5:168178102-168178124 CCTTGTCCCTGGGGGGAAGATGG - Intronic
1001922154 5:175609217-175609239 CTGAGTTCTAGGAGGGAAGATGG + Intergenic
1002814389 6:665765-665787 TTGGGTACTTGGGGGGAAGAGGG + Intronic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003459662 6:6318455-6318477 ATGTTTACCTGCAGGGAAGAGGG + Intronic
1003962523 6:11221955-11221977 CTGAGTACCTGGATGTTAGAGGG - Intronic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1005758616 6:28947788-28947810 CTGGGAACCTGGAGGGCAGGAGG - Intergenic
1005856312 6:29865632-29865654 CTGTACACTGGGAGGGAAGATGG + Intergenic
1006067508 6:31472686-31472708 CTCTGCACTAGGAGGGAAGATGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007187507 6:39984855-39984877 ATATGTGCCTGGAGTGAAGAAGG - Intergenic
1007231720 6:40352832-40352854 GTTTGTAGCTGGAGAGAAGAGGG - Intergenic
1007327627 6:41073727-41073749 CTGTCTCCCTGGTGGGGAGAGGG + Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007497392 6:42269405-42269427 CCGTGTATCTTGAGGGAAGTGGG + Exonic
1007921229 6:45611440-45611462 ATTATTACCTGGAGGGAAGAAGG + Intronic
1008036778 6:46753549-46753571 CTGAGTCCCTGGTGAGAAGAGGG + Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1008946363 6:57101374-57101396 CTGTGTCCCATGAAGGAAGAAGG - Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1012305903 6:97656823-97656845 CTATGTAACAGGAGGGAAGGAGG + Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1017013345 6:150080015-150080037 GTATGTACTTGGAGGGCAGATGG - Intergenic
1018339683 6:162838510-162838532 CTGTGTACCTCAAAGGAAAAGGG + Intronic
1018373825 6:163192753-163192775 GTGTGTATTTGCAGGGAAGATGG + Intronic
1018924079 6:168194517-168194539 CTGTGTTCTTGGAGGCTAGAGGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1023060051 7:36318089-36318111 CTGTGTACCTGGAGGAGGGTGGG + Intergenic
1023542616 7:41282615-41282637 CTGAGTATCTCGAGGGAACAAGG + Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024153817 7:46600072-46600094 CTGTGAACCAGGAAGGAAGTAGG + Intergenic
1026298811 7:69079344-69079366 CAGTCTACCCGGAGGGCAGAAGG - Intergenic
1026645964 7:72169124-72169146 ATGTGTAAATGTAGGGAAGAAGG - Intronic
1026879064 7:73897092-73897114 CTGTGTTCCTGTGGGGAAGCAGG - Intergenic
1029409074 7:100397503-100397525 CTGAGGACCTGGAGGGAATGGGG + Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1031580365 7:123467402-123467424 CTGTCTATCTGTAGGCAAGATGG - Intronic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1034192355 7:149222175-149222197 CTGTGCACTTGGAGGAAAGGGGG + Intronic
1034262694 7:149766530-149766552 ATGTGAACCTGGAGCGAAGCAGG - Intronic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1034830831 7:154305929-154305951 CTTTGTAACTTGGGGGAAGAGGG + Intronic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037946312 8:22991698-22991720 CTGTGTACCAAGAAGGCAGAGGG + Intronic
1038007401 8:23444403-23444425 GTGGGTTCCTGGAGGGGAGAGGG - Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038565269 8:28614940-28614962 CTTTATACCTGGTGGGAGGAGGG - Intronic
1039788769 8:40857094-40857116 CTGGTTACCTGGAGGGAGGGAGG + Intronic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1043380980 8:79701896-79701918 CTGTGTCCTTACAGGGAAGAAGG + Intergenic
1045259216 8:100557654-100557676 TTGAGCACCTGGAGGGAAGGAGG - Intronic
1045693426 8:104782557-104782579 TTGTTTAGCTGGTGGGAAGAGGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047228649 8:122977393-122977415 CTCTGTATCTGAAAGGAAGAAGG + Intergenic
1047789175 8:128185206-128185228 CCGTGTACGTGGAGGGGGGAGGG - Intergenic
1048098027 8:131315534-131315556 ATGTGTACCTGGAGGCCACAGGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1051698233 9:19791233-19791255 CTGTGTTCCAGGCAGGAAGAAGG + Intergenic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1054761476 9:69008145-69008167 CTGTGCACTTGGAGGGCAGGAGG + Intronic
1055270004 9:74547291-74547313 GTTTGAACTTGGAGGGAAGAAGG + Intronic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1057376475 9:94528594-94528616 CTTTGTAGCTGCAGGGCAGAGGG + Intergenic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1058852241 9:109024052-109024074 ATATTTACATGGAGGGAAGAGGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059454401 9:114390378-114390400 GTGTGTACCTGGGTGAAAGATGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060680459 9:125558433-125558455 CTGAGTACCTGGGGGTAAGCTGG - Intronic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1203662141 Un_KI270753v1:54740-54762 CTGAGAACCTGGAGGGCTGATGG - Intergenic
1186661253 X:11669511-11669533 GTGTGTACCTGGAGGGTTCATGG - Intergenic
1186924816 X:14321971-14321993 CAGTTGACCTGGAGGGGAGAAGG - Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1192447979 X:71224617-71224639 CTGTGCACCGGCAGGGGAGAAGG - Exonic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194826918 X:98575964-98575986 ATGTGGACTTGGAGGGAAGGGGG + Intergenic
1195004552 X:100672998-100673020 ATATTTCCCTGGAGGGAAGAGGG - Intergenic
1197613654 X:128667068-128667090 CTGTATTCCTGGAGGAATGAGGG - Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1202251527 Y:22878337-22878359 CTGTGTACATGGAGGCCACACGG - Intergenic
1202404515 Y:24512086-24512108 CTGTGTACATGGAGGCCACACGG - Intergenic
1202466264 Y:25157996-25158018 CTGTGTACATGGAGGCCACACGG + Intergenic