ID: 962349132

View in Genome Browser
Species Human (GRCh38)
Location 3:134644118-134644140
Sequence AAGAAGCAGGAGGCTCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 448}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962349132_962349140 -5 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349140 3:134644136-134644158 TTCTTAATGAGAAGAACAGGGGG 0: 1
1: 0
2: 0
3: 31
4: 250
962349132_962349139 -6 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349139 3:134644135-134644157 CTTCTTAATGAGAAGAACAGGGG 0: 1
1: 0
2: 0
3: 19
4: 275
962349132_962349147 29 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349147 3:134644170-134644192 CCTACCCCAGCCTAGGAGACGGG 0: 1
1: 0
2: 0
3: 41
4: 352
962349132_962349145 28 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349145 3:134644169-134644191 TCCTACCCCAGCCTAGGAGACGG 0: 1
1: 0
2: 2
3: 22
4: 227
962349132_962349143 22 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349143 3:134644163-134644185 CCTGCCTCCTACCCCAGCCTAGG 0: 1
1: 0
2: 10
3: 86
4: 654
962349132_962349138 -7 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349138 3:134644134-134644156 GCTTCTTAATGAGAAGAACAGGG 0: 1
1: 0
2: 1
3: 25
4: 265
962349132_962349137 -8 Left 962349132 3:134644118-134644140 CCCGGCCGAGCCTCCTGCTTCTT 0: 1
1: 0
2: 3
3: 43
4: 448
Right 962349137 3:134644133-134644155 TGCTTCTTAATGAGAAGAACAGG 0: 1
1: 0
2: 1
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962349132 Original CRISPR AAGAAGCAGGAGGCTCGGCC GGG (reversed) Intronic
900118996 1:1040721-1040743 CAGACGCAGGACGCCCGGCCCGG - Exonic
900140251 1:1136831-1136853 AGGCAGCAGGAGGGGCGGCCGGG + Intergenic
900558309 1:3291036-3291058 GAGATGCAGGAGGATCGCCCAGG + Intronic
900608161 1:3533019-3533041 GAGAAGGTGGAGGCTCTGCCGGG - Intronic
900700307 1:4044203-4044225 AAGAAGAAAGAGGCTGGGCACGG - Intergenic
901246398 1:7735205-7735227 AAGAAGCAAGAGGCTGGGCGCGG + Intronic
903649852 1:24915884-24915906 AAGAAGCAGGTTGCTGAGCCAGG - Intronic
904063065 1:27726193-27726215 GGGACGCAGGAGGCGCGGCCCGG + Intronic
904444800 1:30561588-30561610 AAAAAGAGGGAGGCTCGGCTTGG - Intergenic
904619079 1:31764549-31764571 AAGAAGCAGCGGGCTGGGCGGGG - Intronic
904626704 1:31810175-31810197 AACAAGGAGGGGGCTCGTCCAGG - Intronic
904687156 1:32268838-32268860 AAGAAACAGGAGTCTAGGGCTGG + Intronic
904687197 1:32269139-32269161 AAGAAACAGGAGTCTAGGCTGGG + Intronic
905847512 1:41244731-41244753 AAGAAGCAGGAGGCTGGGTGTGG - Intergenic
905872897 1:41415241-41415263 AGGAAGGTGGAGGCTGGGCCAGG - Intergenic
905898746 1:41566719-41566741 AGGAGGAAGGAGGCTCAGCCCGG - Intronic
906109463 1:43313200-43313222 AAGCACCCGGAGGCTCTGCCTGG + Exonic
908008804 1:59754711-59754733 AAGAAGCATGAGGTTGGGCCGGG - Intronic
909972406 1:82006617-82006639 AAGATGATGGAGGCTCGGCCAGG + Intergenic
910187267 1:84557563-84557585 AAAAAGAAGGAGGCTGGGCGCGG + Intronic
910966274 1:92811060-92811082 AAAAAAGAGGAGGGTCGGCCGGG - Intergenic
911143801 1:94533397-94533419 AAGAAGCAGGCGTGGCGGCCTGG + Intronic
912419525 1:109533566-109533588 AAAAGACAGGAGGCTGGGCCTGG + Intergenic
915004329 1:152622752-152622774 AAGAAGCACCAGGCTAGGGCTGG + Intergenic
915183051 1:154080067-154080089 AAGAAGGAAGAGGCTGGGCATGG + Intronic
915552997 1:156646093-156646115 AAGCTGCAGGAGCCTGGGCCAGG - Exonic
915615724 1:157036610-157036632 GAGAAGCAGGAGGCTGGGCGTGG - Intronic
916213083 1:162374139-162374161 AAGGAGCAGAAGGCCCGGCTGGG - Exonic
917964771 1:180171487-180171509 AAGAACCAGGAGTCTAGGACAGG + Intronic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918550220 1:185734000-185734022 GAGAGGCAGGAGGCTGGGCTGGG + Intergenic
919789268 1:201279772-201279794 GAGAAGGAGAAGGCTGGGCCAGG - Intergenic
919983407 1:202656734-202656756 ATGAAGCAGGAGGTTGGGCTGGG - Intronic
920664296 1:207949919-207949941 AAGAAACAGGAGGCTAGCCTGGG + Intergenic
920833410 1:209485613-209485635 AAGAGGCAGGACTCTGGGCCTGG + Intergenic
921543052 1:216442377-216442399 AAGAAACGGGAGGCTGGGCACGG + Intergenic
922100609 1:222474601-222474623 GGGAAGCAGGAGGCTGGGCATGG + Intergenic
922145324 1:222938442-222938464 AAGAAAAAGGAGGCTGGGCATGG + Intronic
922734018 1:227970075-227970097 GGGAAGCAGGAGGCTGGGCCTGG - Intergenic
922795701 1:228338434-228338456 AAGAAGCAGGCCGCTTGCCCTGG + Intronic
923670228 1:236034128-236034150 AAAAGGCATGAGGCTGGGCCTGG + Intronic
1062841128 10:672816-672838 TAGAATCAGGAGGCTGGGCAGGG - Intronic
1062879424 10:966162-966184 AAGAAGAAGGAGGCTGGGTGTGG + Intergenic
1063074607 10:2702056-2702078 AAAAACCAGGGGGCGCGGCCAGG - Intergenic
1063183971 10:3633900-3633922 AAGACTCAGGAGGCTTAGCCAGG - Intergenic
1064520946 10:16200190-16200212 AAGAAAAAGGAGGCTGGGCATGG + Intergenic
1064614769 10:17141448-17141470 AAGCAGCTGGAGGCTGGGCGCGG - Intergenic
1065352885 10:24811403-24811425 AAAAAACAGGAGGCTGGGCGTGG - Intergenic
1065525931 10:26621166-26621188 AAGATGCTGTAGGCTCGGCACGG - Intergenic
1067689742 10:48494090-48494112 AAGAAGCCAGAGGCTGGGCACGG + Intronic
1068869008 10:61923761-61923783 AAGGAGCAGGAGACTCTGCCTGG + Intronic
1069455392 10:68549930-68549952 AAGAAGAAGAAGGCTGGGCGTGG + Intergenic
1070338120 10:75472872-75472894 AGGAAGCAGGAGGGTGGGCGTGG + Intronic
1071972280 10:90920374-90920396 CAGAAGCAGCAGCCTCGTCCTGG + Intronic
1072590444 10:96824066-96824088 AAGACTCAGGAGGCTGGGCATGG + Intergenic
1073444185 10:103571132-103571154 AGGAAGCAGGAGGCGGGGGCGGG - Intronic
1075149456 10:119913859-119913881 TAAAAGCAGGTGGCTGGGCCTGG + Intronic
1075234208 10:120711837-120711859 AAGATGCAGGAGGCTGGGCCTGG + Intergenic
1075382662 10:122031696-122031718 AAGAAAAAGGAGGCTGGGCCAGG - Intronic
1075472793 10:122705441-122705463 AAGAGCCAATAGGCTCGGCCAGG + Intergenic
1075546089 10:123355897-123355919 AAGAAGCAGCAGCCTAGGACTGG - Intergenic
1075729143 10:124625917-124625939 AAGAAACAGGCTGCTCAGCCAGG - Intronic
1076055685 10:127370391-127370413 GCGCAGCAGGAGGCTGGGCCAGG - Intronic
1076308812 10:129487083-129487105 AACAAGCAGGAGGCTAGTGCTGG - Intronic
1077245942 11:1538325-1538347 AGGAAGCAGGAGACTGGGACAGG - Intergenic
1077372072 11:2187042-2187064 CAGGAGCAGGAGGCACGGCCGGG + Intergenic
1077474239 11:2778890-2778912 CAGGAGCAGGAGCCTGGGCCGGG - Intronic
1077547873 11:3183713-3183735 CAGAAGCTGCAGGCCCGGCCTGG - Intergenic
1077662784 11:4084407-4084429 AAGAACAAAGAGGCTTGGCCAGG - Intronic
1078755509 11:14204980-14205002 AAGAATAGGGAGGATCGGCCAGG - Intronic
1078921515 11:15835242-15835264 AAGAAGGAGAAGTCTGGGCCGGG - Intergenic
1079018840 11:16892599-16892621 AAGAAGCTGGAAGCTGGGCATGG - Intronic
1080662943 11:34312188-34312210 AACAAGCAGGTGGTTCTGCCTGG + Intronic
1080665474 11:34332278-34332300 AAGATGCAGGAGGCTGGGACAGG - Intronic
1081493511 11:43584037-43584059 GAGAGGCAGGTGGCTGGGCCAGG + Intronic
1081740085 11:45433036-45433058 GTCAAGCAGGAGGCGCGGCCTGG + Intergenic
1082260193 11:50072343-50072365 GGGAGGCAGGAGGCTAGGCCTGG + Intergenic
1082260592 11:50074070-50074092 GGGAGGCAGGAGGCTGGGCCTGG + Intergenic
1083482393 11:62957986-62958008 AAGAAGAAAGAGGCTGGGCGCGG - Intronic
1083575639 11:63789098-63789120 AAGAAGAAAGAGGCTGGGCACGG + Intergenic
1083583469 11:63839609-63839631 AAGAGGGAGGAGGCTCCGCAAGG - Intronic
1083596093 11:63918853-63918875 AATAAGCAGGATGCTGAGCCTGG - Intergenic
1083600254 11:63942903-63942925 AAGCAGCAGGAGGGCCAGCCGGG - Intronic
1084683074 11:70678422-70678444 AACAGGCAGGAGGCTGGGCGTGG - Intronic
1085393144 11:76192848-76192870 GAGAGGCAGGAGGGTAGGCCTGG - Intronic
1085517785 11:77121576-77121598 AGGAAGCAGCAGGCTCACCCAGG - Intronic
1088322837 11:108571067-108571089 AAGAAGCTGGAGCCTCAGCTCGG + Intronic
1089130929 11:116211281-116211303 TAGAGGCAGGCGGCTCGGACAGG + Intergenic
1089195524 11:116692178-116692200 AAGAAGCAGGATTCTGGCCCTGG + Intergenic
1089484678 11:118836257-118836279 AAGAAGAAAGGGGCTAGGCCGGG + Intergenic
1090956859 11:131521027-131521049 AAGAAGCAAGGTGCTTGGCCAGG + Intronic
1091751850 12:3027254-3027276 AAGGAGCAGGAGGCTGGGTGTGG - Intronic
1093262565 12:16957304-16957326 AAGAAAAAGGAGGCTGGGCATGG - Intergenic
1096227977 12:49881596-49881618 AGGAAGCACGAGGGTCGGGCGGG - Intronic
1096233556 12:49910775-49910797 AAGAAGCCGAAGCCTCGGGCAGG + Intergenic
1096773936 12:53952965-53952987 AATGAGCAGGAGACTCAGCCTGG - Intergenic
1096799269 12:54098626-54098648 AAGGAGCTGGAGGCTAGGCATGG - Intergenic
1097851232 12:64412313-64412335 AAAAAGGAGGAGGCTGGGCGCGG - Intronic
1100432400 12:94542337-94542359 AAGAGGCAGGAGGCCAGGCGTGG + Intergenic
1101743006 12:107515713-107515735 GAGAGGCAGGAGGCTGGGCTTGG + Intronic
1101998734 12:109543546-109543568 AGGATGCAGGAGGCTGGGCGTGG + Intergenic
1102882609 12:116497369-116497391 ACCAAGCAGGAGGCTGGCCCTGG + Intergenic
1103998461 12:124844967-124844989 CAGCAGCAGGAGGCAGGGCCGGG + Intronic
1104672141 12:130688268-130688290 AAACAGCAGGAGGGTCTGCCGGG - Intronic
1104865407 12:131950371-131950393 GAGAACCAGGAGGCGCGGGCCGG - Intronic
1106789138 13:33136959-33136981 AAGAAGCAGGGGCCCCTGCCAGG + Intronic
1106800154 13:33248107-33248129 AAGAAGAAGAAGGCTGGGCATGG + Intronic
1107555950 13:41516812-41516834 AAATAGCATGAGGCCCGGCCAGG - Intergenic
1108420537 13:50244724-50244746 AAGAAGAAGGAGGCTTCCCCTGG + Intronic
1110204964 13:72901396-72901418 AAAAAGCAGTAGGCTGGGCACGG + Intronic
1112326290 13:98444587-98444609 GGGGAGCGGGAGGCTCGGCCCGG + Intronic
1112362010 13:98726996-98727018 AAGAAGCATGAGTCTGGGGCCGG - Intronic
1112641002 13:101275100-101275122 CAGAAACAGGAGGCGTGGCCGGG - Intronic
1112724881 13:102291870-102291892 GACAAGCAGGAGGGTCGGCCTGG - Intronic
1113258312 13:108531914-108531936 CAAAAGCAGAAGGCCCGGCCTGG + Intergenic
1113931898 13:113973025-113973047 GGGAGGCAGGAGGCCCGGCCCGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114633335 14:24173287-24173309 AGGAAGCAGCAGGCTGGGTCTGG - Exonic
1116456257 14:45123906-45123928 AAGAATGAGGGGGCTGGGCCTGG - Intronic
1118289497 14:64506235-64506257 AAGAAACAGGAAACTGGGCCGGG + Intronic
1118457465 14:65957976-65957998 GAGTAGGAGGGGGCTCGGCCAGG - Intronic
1118750981 14:68807739-68807761 ATAAAGCAGGAGGCACTGCCTGG + Intergenic
1119393164 14:74305039-74305061 AAGAAGTAGCAGGCTGGGCACGG + Intronic
1119863297 14:77952796-77952818 AAGACACAGGAGGCTGGGCATGG + Intergenic
1120808422 14:88777679-88777701 AAAAAGCAGGAGGATGGGCCGGG + Intronic
1121113623 14:91329003-91329025 TAGCAGCAGGAGGCTGGCCCAGG + Intronic
1121569498 14:94936817-94936839 AATAGGCAGGAACCTCGGCCCGG + Intergenic
1121757124 14:96412521-96412543 AAGTACCAGGAGTCACGGCCGGG - Intronic
1122716756 14:103700752-103700774 AGGAAGCAGGCAGCTGGGCCAGG + Intronic
1126569963 15:50140324-50140346 AAGAGTCAGGAGTCTGGGCCTGG - Intronic
1126688391 15:51267614-51267636 AAGACGCAGGAGACGCGACCGGG + Intronic
1127395013 15:58537564-58537586 AAGAGGCAGGAGACAAGGCCAGG - Intronic
1127494168 15:59493876-59493898 AAGAAGGAGGAGGCCGGGCGCGG - Intronic
1127837213 15:62799621-62799643 AAGCTCCAGGAGGCTTGGCCTGG - Intronic
1128551499 15:68600776-68600798 AGGAAGCTGGAGGCTGGGCCAGG - Intronic
1128836706 15:70814675-70814697 AAGCAGCAGGATGCTGGGGCAGG + Intergenic
1131145905 15:90011914-90011936 AAGAAGCTGGGGGCTGGGCGTGG + Intronic
1131273514 15:90961144-90961166 AGGAAGCAGGGGCCTCGGCCAGG + Intronic
1132287348 15:100673056-100673078 AACAAGCAGATGGCTGGGCCTGG - Intergenic
1132624056 16:881752-881774 AGGAGGCAGCAGGCTTGGCCAGG + Intronic
1133155528 16:3872655-3872677 AAAAAGCAGACGGCACGGCCAGG + Intronic
1133442877 16:5835633-5835655 CTGAAGCAGGTGGCTCTGCCTGG + Intergenic
1133772497 16:8875459-8875481 TAGAATCAGGAGGCTGGGCACGG - Intergenic
1135016311 16:18927058-18927080 AAGAAGCTGGGGGCTAGGCGCGG + Intergenic
1135321934 16:21502878-21502900 AAGAAGCTGGGGGCTAGGCGCGG + Intergenic
1135808591 16:25566902-25566924 AAGACGCAGGAGCTTGGGCCCGG - Intergenic
1135877172 16:26213430-26213452 AAGAAGCTGGAGGGGCGGCAGGG + Intergenic
1135964988 16:27028219-27028241 GGGAAACAGGAGGCTCTGCCAGG - Intergenic
1136333404 16:29595994-29596016 AAGAAGCTGGGGGCTAGGCGCGG + Intergenic
1138308438 16:56001632-56001654 AAGAAGGAGGAGGCTGTGGCAGG + Intergenic
1139319862 16:66105676-66105698 CCGAAGCAGGAGGCTCTGCCAGG + Intergenic
1139533040 16:67552800-67552822 AAGAAGCAAGAGTCTGGGCCTGG + Intergenic
1139808345 16:69589282-69589304 AAGAAGTAGGAGGCTGGGCGTGG - Intronic
1140376489 16:74449181-74449203 AAGAAGAAGGAAGCTGGACCAGG - Intergenic
1140976271 16:80062906-80062928 AAGAAGGAAGAGGCTGGGCACGG - Intergenic
1141770980 16:86089515-86089537 AAAGAGCAGGAGGCACAGCCCGG - Intergenic
1142002235 16:87670522-87670544 AACCAACAGGAGGCTGGGCCTGG - Intronic
1142307104 16:89291933-89291955 AAGAGGCAGGAGGCAGGGGCGGG + Intronic
1142378731 16:89720472-89720494 ATGTAGCAGGAGGGTCCGCCAGG - Intronic
1142689087 17:1594113-1594135 CAGAAGCAGGAGGCCGGGCGCGG - Intronic
1142872724 17:2831365-2831387 AAGAAATAGGAGGCTGGGCATGG - Intronic
1143266544 17:5642284-5642306 AAGGAGGAAGAGGCACGGCCTGG - Intergenic
1143341631 17:6215781-6215803 GAGCAGCAGGTGGCACGGCCAGG + Intergenic
1143877475 17:10003109-10003131 ATGAAGCAGAAGGCTGGGGCTGG + Intronic
1143924786 17:10359970-10359992 AAGAAGAAGGAGACACAGCCAGG - Exonic
1143994690 17:10996527-10996549 ATGGGGAAGGAGGCTCGGCCTGG + Intergenic
1144204283 17:12968411-12968433 AGGGCGCAGGAGGCTCAGCCTGG - Intronic
1145035803 17:19539780-19539802 AAGACCCAGGAGGTTAGGCCAGG - Intronic
1148343922 17:46890803-46890825 CAGAAGCAAGAGGCACGGGCGGG + Intergenic
1148502301 17:48101129-48101151 GAGAAGCAGGACGCTGGACCCGG + Exonic
1148563837 17:48621580-48621602 ATGAAGCAGGAGGCCAAGCCCGG + Exonic
1148782498 17:50129748-50129770 TGGAAGCAGGAGGCGCGGGCGGG + Exonic
1149038348 17:52158803-52158825 GAGGAGAAGGAGGCTTGGCCAGG + Intronic
1149099566 17:52887547-52887569 AACAAGAAGGAGGCTGGGCTCGG + Intronic
1150374328 17:64667799-64667821 AAGAAGCAGCAGCCTCCCCCAGG - Intergenic
1150641201 17:66950965-66950987 GAGAAGCAGGTGGCCTGGCCAGG + Intergenic
1151331271 17:73410610-73410632 AAGAAGCAGCATTATCGGCCGGG - Intronic
1152162475 17:78677398-78677420 GAGAAGCAGCAGGCAGGGCCAGG - Intronic
1152444472 17:80333353-80333375 AAGAAGCAGAAGACTCAGCCGGG - Intronic
1152485868 17:80592427-80592449 AAGACGCTGGAGGCTTGCCCTGG + Intronic
1152690589 17:81716082-81716104 GAGGTGCAGGAGGCTCGGGCGGG + Intronic
1152733965 17:81987684-81987706 AAGAAACAACAGGCTTGGCCAGG + Intronic
1153440311 18:5110459-5110481 AAGAAGCAGGAGGATGGGGTGGG + Intergenic
1155372816 18:25121246-25121268 AAGAAGAAGAAGGCTGGGCGCGG - Intronic
1156546484 18:37968879-37968901 AAAAGGCAGGAGAGTCGGCCTGG + Intergenic
1156987107 18:43361418-43361440 AAGAATAAGGAGGGTAGGCCGGG + Intergenic
1157411828 18:47469508-47469530 AGGAAGGAGGAGGCCTGGCCTGG - Intergenic
1157572973 18:48725143-48725165 AGGGAGCAGATGGCTCGGCCTGG + Intronic
1157984161 18:52418548-52418570 CAGAAGCAGGAGGCAGGCCCAGG + Intronic
1158416944 18:57256971-57256993 AGGGAGCAGGAGGCTGGGCAGGG + Intergenic
1158696517 18:59708839-59708861 AAGAAGAAGGAAGGTGGGCCGGG - Intergenic
1158837373 18:61345358-61345380 AAGAGGCAGGAGGCTTTGCTGGG + Intronic
1159074422 18:63664401-63664423 CAGAAGCAAGAAGCTCAGCCTGG + Intronic
1159532261 18:69669674-69669696 AAGAGCCAGGAGGGTCGGCGGGG - Intronic
1160914268 19:1489427-1489449 AAAGAGTAGGAGGCTTGGCCCGG - Intronic
1161169397 19:2805412-2805434 CAGCAGCAGGAGGCTCAGCTTGG - Intronic
1161314009 19:3609416-3609438 AGGAAGCAGGATGCTGGGGCTGG + Intergenic
1161653193 19:5497771-5497793 AAGAAGGAGGAGCCATGGCCAGG - Intergenic
1162501097 19:11054361-11054383 AGGAGGCAGGAGGCCAGGCCAGG + Intronic
1162950038 19:14065845-14065867 AAGAAGAAGAAGGCTGGGCGCGG + Intergenic
1163825118 19:19519184-19519206 GAGAAGAATGAGACTCGGCCAGG - Intronic
1163989357 19:20984054-20984076 AAAAATCAGGATGTTCGGCCAGG + Intergenic
1164077725 19:21835648-21835670 TAGAAACAGGAGAGTCGGCCGGG - Intronic
1164774515 19:30842496-30842518 ATGAAGCAGGAGGTTCGTCCAGG - Intergenic
1165957752 19:39512339-39512361 AAGAAGCCAGAGGCTGGGCACGG + Intergenic
1167094194 19:47365183-47365205 AAGAGGCAGGGGGCAGGGCCTGG - Intronic
1167493193 19:49803390-49803412 GAGAGGCAGGAGGCTGGGCCGGG - Intronic
1167498011 19:49830568-49830590 AAGAACCAGAAGGCTGGGCTGGG + Exonic
1168054205 19:53852562-53852584 AAGAAGAAGAAGGCTGGGCACGG - Intergenic
1168273144 19:55261150-55261172 AAGAAAGAGGAGGATTGGCCGGG + Intergenic
925165489 2:1713373-1713395 AAGAAGCAGGTGGATCTGACAGG + Intronic
925283542 2:2701492-2701514 AAAAAGCAGGAGGCTGGCTCTGG - Intergenic
925297526 2:2787797-2787819 AAGAGACAGGCAGCTCGGCCAGG + Intergenic
925731599 2:6922912-6922934 AAAAAGCAGGAGGCCGGGCGCGG - Intronic
926161441 2:10492851-10492873 AAGAAGCTGCTGGCTCGGCACGG + Intergenic
926678971 2:15649707-15649729 CAGAAACAGGATACTCGGCCGGG + Intergenic
926748415 2:16179348-16179370 AAAAAGCAGGAGGCCGGGCGAGG - Intergenic
926765308 2:16318666-16318688 TAAAAGGAGGAGGCTGGGCCAGG + Intergenic
927715704 2:25350844-25350866 AAGAAGCATGTGGCTAGGCACGG - Intergenic
927842441 2:26454247-26454269 AAGCATCAGGAGGCTTGTCCAGG + Intronic
928655558 2:33447268-33447290 AAGGAACAGGAGGCTGGGCCAGG + Intronic
929239639 2:39640421-39640443 AAGAAGCAGGAGGCACAGTGGGG - Intergenic
929866173 2:45719225-45719247 AAGAAGCCGGAGGCTGGGGTAGG - Intronic
930175045 2:48292972-48292994 AAAAAGAAGGAGGCTGGGCAGGG + Intergenic
930203395 2:48565340-48565362 AAGAAGTCGGAGGCTGGGCGCGG - Intronic
931820660 2:65948719-65948741 AAGAGACATGGGGCTCGGCCGGG + Intergenic
931842570 2:66169775-66169797 AAGAAACAGCAGGCCAGGCCGGG - Intergenic
932300562 2:70664004-70664026 AAGTGGCAGGAGGCCCGGCTGGG + Intronic
932448644 2:71795785-71795807 GAGAAGCAGGTGGCAAGGCCAGG + Intergenic
933674395 2:85041053-85041075 AAAAATCAAGAGGCTAGGCCAGG - Intronic
934054042 2:88236794-88236816 AGGTAGCAGGAAGCTCTGCCTGG + Intergenic
937097312 2:119243803-119243825 GGGAACCAGGAGGCTGGGCCCGG - Intronic
937273353 2:120669323-120669345 GAGAAGCAGGAGGCGGGGACAGG + Intergenic
937346756 2:121130732-121130754 CAGAAGCAGGGGGCTCTGCCAGG - Intergenic
937680665 2:124640834-124640856 AAGGAGGAGCAGGCTGGGCCCGG + Intronic
937853172 2:126654369-126654391 AAGAAGCAGAAAGTTCTGCCAGG - Intergenic
937962045 2:127467569-127467591 GAGAGGCAGGAGGCTAGGCCTGG - Intronic
938012580 2:127840594-127840616 AAGAAGCATGAGGCCGGGCGCGG - Intergenic
938293816 2:130164313-130164335 AAGAAGCAGCAGGCTGAGCAGGG + Intronic
938462728 2:131508649-131508671 AAGAAGCAGCAGGCTGAGCAGGG - Intergenic
941071013 2:160954572-160954594 AAGAAGCAGGTGGCTTGGAAAGG + Intergenic
941119121 2:161507880-161507902 GAAAAGAAGGAGGCGCGGCCTGG - Intronic
941477281 2:165965654-165965676 AAAAAGCAAGAGCCTGGGCCGGG - Intergenic
942146835 2:173035211-173035233 AAAAAACAGGGGTCTCGGCCAGG + Intronic
942415566 2:175755439-175755461 AGGAAGTAAGAGGCTGGGCCTGG - Intergenic
942604076 2:177672077-177672099 AAGAGGTAGGAGGCTCTTCCAGG - Intronic
943639602 2:190343868-190343890 GAGGAGGAGGAGGCGCGGCCCGG - Exonic
943720954 2:191203143-191203165 AGGAAGCAGGGGACTTGGCCAGG - Intergenic
946330565 2:219006536-219006558 AAGATACAAGAGGCCCGGCCGGG + Intronic
946572902 2:221043713-221043735 AAGAGGGAGGAGGCTGGGCGCGG - Intergenic
947620196 2:231585101-231585123 AAAAAGCAGGAGGTTGGGCGTGG - Intergenic
948113582 2:235476962-235476984 AAGGAGCAGGAGGCTTGCCTTGG - Intergenic
948113621 2:235477149-235477171 CAGAAGGAAGATGCTCGGCCTGG + Intergenic
948229889 2:236342056-236342078 AAGAGGCAGGAAGCTCACCCGGG - Intronic
948979111 2:241483742-241483764 ATGAAGAAGGAGGCTGGCCCTGG - Intronic
1169000371 20:2163827-2163849 AAGAAGCAGGCAGATGGGCCAGG + Intronic
1169218676 20:3807991-3808013 AGGAAGCAGGAGCCTGGGCCTGG + Intergenic
1169979419 20:11366467-11366489 AAGAAACTGGAGGCTGGGCATGG - Intergenic
1170346935 20:15397590-15397612 AAAATGCAAGAGGCTAGGCCAGG - Intronic
1170431602 20:16281724-16281746 AAGAAGCAGTAAGCCAGGCCTGG + Intronic
1170827527 20:19809370-19809392 CAGATGCAGGACGCTGGGCCGGG - Intergenic
1171797151 20:29575715-29575737 AAGGAGCTGGAGGCTAGGCATGG + Intergenic
1171851097 20:30308448-30308470 AAGGAGCTGGAGGCTAGGCATGG - Intergenic
1172139709 20:32713823-32713845 AAGAAGGGGGAGGCTGGGCATGG + Intronic
1172885540 20:38228414-38228436 AGGAAGCAAAAGGCTCTGCCTGG - Intronic
1173298703 20:41781790-41781812 AAGAAACAGGATGCTCAGCCTGG - Intergenic
1173567942 20:44055210-44055232 TAGAAGCAGGAGGCTCAACTGGG + Intronic
1173704666 20:45101017-45101039 CTGCAGCAGGAGGCTCGGCGGGG - Exonic
1173719280 20:45239243-45239265 AAGACGCAGGAGGTCTGGCCAGG - Intergenic
1173820870 20:46019563-46019585 AAGAAACAAGAGGCTGGGCATGG + Intergenic
1174001027 20:47374821-47374843 AAGAAGAAGAAGGCTGGGCGCGG + Intergenic
1174067991 20:47879404-47879426 AAGAAAGAGAAGACTCGGCCAGG - Intergenic
1174265727 20:49330462-49330484 AAGAAGAATGAGGCTCAGACAGG + Intergenic
1174280773 20:49437530-49437552 GAGACGAAGGGGGCTCGGCCAGG + Intronic
1174572001 20:51508669-51508691 AAATAGCAGGAGTCTCGGCAGGG + Intronic
1174604490 20:51750997-51751019 AAGAGGCAGGAGGCTGGACGTGG + Intronic
1175611530 20:60355372-60355394 AAGAAGGAAGAGGCTAAGCCCGG + Intergenic
1175699348 20:61125729-61125751 GAGAAGCAGGCGGCCCGGCTTGG - Intergenic
1175962648 20:62644927-62644949 AGGAAGCAGGAGGGCTGGCCTGG - Intronic
1176291056 21:5044902-5044924 AGGAAGATGGAGGCTGGGCCGGG - Intergenic
1178558913 21:33619447-33619469 ATGAAGCAGGAGGATAGGCAAGG - Intronic
1179039820 21:37792664-37792686 AAGGAGCGGGAGTCTCAGCCAGG + Intronic
1179163217 21:38914857-38914879 CAGAAGCAGGTTCCTCGGCCGGG - Intergenic
1179866199 21:44218739-44218761 AGGAAGATGGAGGCTGGGCCGGG + Intergenic
1180821760 22:18833669-18833691 GAGGAGCAGGACGCCCGGCCGGG + Intergenic
1180976065 22:19849076-19849098 CAGAAGCATGGGGCTGGGCCAGG + Exonic
1181013706 22:20056554-20056576 ATGTAGCAGGAGGCACAGCCTGG - Intronic
1181113162 22:20613600-20613622 AAGAAGCAGCAGGCTGAGCATGG + Intergenic
1181670391 22:24423244-24423266 AAAAAGAGGGAGGCTGGGCCCGG + Intronic
1182706351 22:32283014-32283036 GAAAAGGAGGAGGCTCGGCAAGG - Intergenic
1183903191 22:41021690-41021712 GAGAAGCAGGAGGCCGGGCGGGG - Intergenic
1184023360 22:41835621-41835643 AAAAATTAGGTGGCTCGGCCAGG - Intronic
1184422125 22:44388213-44388235 AAGAAGCAGGAGGCCAGACACGG - Intergenic
1185311864 22:50160540-50160562 AAGAAACAGGAGGCCGGGCGCGG - Intronic
1203218940 22_KI270731v1_random:27282-27304 GAGGAGCAGGACGCCCGGCCGGG - Intergenic
950128046 3:10522777-10522799 AAGAAGCTGGAGGCTCAGAGAGG + Intronic
950538471 3:13595364-13595386 AAGAAACAGCAGGAGCGGCCAGG - Intronic
950776816 3:15357212-15357234 AATCAGCAGGAGGCTGGGCGCGG - Intergenic
955185219 3:56708828-56708850 AAAAAGCAAGAGGCTGGGCGTGG + Intergenic
955756301 3:62228230-62228252 AAGAAAAAGGAGGCTGGGCGCGG + Intronic
955927198 3:64019007-64019029 AAGAAGGAGGAGACTGGGACAGG - Exonic
956393472 3:68799623-68799645 AAGAGGCAGGAGGATCAGTCAGG + Intronic
960657992 3:120027077-120027099 AAAAAGCAGCAGGAACGGCCAGG + Intronic
961084798 3:124057631-124057653 AAGCAGAAGGAGCCTGGGCCTGG + Intergenic
962349082 3:134643809-134643831 AAGAAGCAGGAGACTCAACTGGG - Intronic
962349132 3:134644118-134644140 AAGAAGCAGGAGGCTCGGCCGGG - Intronic
962379867 3:134889214-134889236 GAGATGCAGGAGGCTCAGCTTGG + Intronic
964367530 3:155966052-155966074 CAGCAGCAGTAGGCTGGGCCAGG - Intergenic
964473869 3:157081776-157081798 AACAGGCAGGAGGAGCGGCCTGG + Intergenic
964717888 3:159741938-159741960 AAGAAAAAGGAGGCTGGGCACGG + Intronic
965730631 3:171768347-171768369 AAGAACCAGGAGGTTAGGCATGG + Intronic
966219939 3:177541295-177541317 AAAGAGCAGGGGGATCGGCCAGG - Intergenic
966576235 3:181505803-181505825 AAGAAGCAGGAGGCCAGGAAAGG - Intergenic
967463764 3:189778160-189778182 AAGAAGAATAAGACTCGGCCAGG - Intronic
967876337 3:194270727-194270749 AAGAAGCAGGATGATCCGGCAGG - Intergenic
967943772 3:194786342-194786364 AAGAAGCAGGGGGCAAGGCCAGG + Intergenic
968058666 3:195712179-195712201 AAGATCCAGGAGGCGCTGCCAGG + Intergenic
968075822 3:195815761-195815783 AAGAAGAAGGAGGCCGGGCTGGG - Intergenic
968075990 3:195816395-195816417 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076092 3:195816774-195816796 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076141 3:195816947-195816969 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076153 3:195816992-195817014 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076166 3:195817036-195817058 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076192 3:195817119-195817141 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076241 3:195817292-195817314 AAGGAGAAGGAGGCCAGGCCGGG - Intergenic
968076252 3:195817337-195817359 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968076277 3:195817425-195817447 AAGAAGAAGGAGGCTGGGCCGGG - Intergenic
968076302 3:195817514-195817536 AAGGAGAAGGAGGCCGGGCCGGG - Intergenic
968116675 3:196095706-196095728 AAGAAGCACTAGGCTAGGCTGGG - Intergenic
968762642 4:2450565-2450587 AAGCAGCTGGCGGCTGGGCCGGG + Intronic
969521503 4:7680432-7680454 AAGAAGCTGGACTCTGGGCCAGG + Intronic
969716733 4:8871556-8871578 AGGAAGGAGGAGGCGCGGGCCGG + Exonic
970010576 4:11454582-11454604 CAGAAGAAGGAGGCTGGGCACGG + Intergenic
971021705 4:22543532-22543554 AAGAAGCAGTAGGCTGAGGCAGG + Intergenic
973613741 4:52659499-52659521 GAAAAGCAGGAGGCCAGGCCTGG - Intergenic
973688391 4:53398859-53398881 AAGAGGGAGAAGGCTGGGCCTGG + Intronic
973700415 4:53532183-53532205 AAGCAGCAGGTGGCTAGGCACGG + Intronic
975984286 4:80188799-80188821 TAGGAGAAGGAGGCTCCGCCGGG + Intronic
976996917 4:91444738-91444760 AAGAAGCAAGAGGCTGGGTGTGG - Intronic
978031036 4:103939908-103939930 AGGAAGCAAGAGTCTCTGCCTGG + Intergenic
978773300 4:112480220-112480242 AAGTAGCAGGAAGCTCGAACTGG - Intergenic
979259186 4:118632975-118632997 GGGAAGCAGGAGGCTGGGCCTGG - Intergenic
979329163 4:119407584-119407606 GGGAAGCAGGAGGCTGGGCCTGG + Intergenic
980127987 4:128791556-128791578 AAGAAGCAGGAAAACCGGCCGGG + Intergenic
980170002 4:129277589-129277611 ATGAAGAAGGAGGCTTGGACAGG - Intergenic
981441336 4:144786131-144786153 AAGAAGCAGGAGGAGCTTCCAGG + Intergenic
982011409 4:151109327-151109349 AAGAAACAGAAGGCTGGGCGCGG - Intronic
983230819 4:165127028-165127050 AATAAGCAGGAGGCCAGGCATGG - Intronic
983555897 4:169059045-169059067 AAAAAAGAGGAGGCTCGGCACGG - Intergenic
984474188 4:180215944-180215966 CAGATGCAGGATGCTCGGCGGGG + Intergenic
986310364 5:6546660-6546682 AAGAAGCAGGATGGTCAGCTGGG - Intergenic
987134694 5:14889849-14889871 AAGAAGCAGGAGCCGTGGTCTGG + Intergenic
988516313 5:31907792-31907814 AAGGATCAGGTGGCTGGGCCCGG + Intronic
990095692 5:52109443-52109465 AAGAATCAGGAGGCTTCTCCAGG - Intergenic
991772417 5:70052245-70052267 AAAAAGTGGGAGGATCGGCCGGG + Intronic
991851710 5:70927664-70927686 AAAAAGTGGGAGGATCGGCCGGG + Intronic
992351931 5:75939138-75939160 AAAAACCAGGAGGCTGGGGCTGG - Intergenic
992654120 5:78891416-78891438 AAGAAGCATCAGTCTTGGCCTGG + Intronic
992906253 5:81348852-81348874 AAGAAGCAGAAAGCTAGGCGCGG - Intronic
993389247 5:87298117-87298139 AAGGAACAGGAGGCTGGGCACGG + Intronic
995686937 5:114782024-114782046 AAGAAGCAGGAGGAGAGGCATGG - Intergenic
996110784 5:119564031-119564053 CAGAAGCAGGAGTCTCCTCCTGG - Intronic
997409626 5:133681159-133681181 ACGAAGCAGGAGGCCAAGCCTGG - Intergenic
997461055 5:134052819-134052841 AAGAAGCAGAAGCCCTGGCCGGG + Intergenic
997659762 5:135580192-135580214 AGGAAGCAGGTGACTAGGCCAGG + Intergenic
997910984 5:137873232-137873254 AAAAAACAGTAGGCTAGGCCAGG + Intronic
998148622 5:139744698-139744720 AAATAGCAGGAGGCTGGGCTGGG - Intergenic
998228946 5:140346930-140346952 ATGAAGCAAGAGGCCAGGCCCGG - Intergenic
999448464 5:151660173-151660195 AAGAAGCATGAGGCAAGGCCAGG + Intergenic
1001853332 5:174988883-174988905 ATGTAGCAGGAGGTTCGGCGGGG + Intergenic
1002467844 5:179416651-179416673 GTGAAGCAGGAGGGTCTGCCAGG - Intergenic
1003540463 6:7013893-7013915 AGGAAAAAGGAGGCTCTGCCAGG + Intergenic
1005436874 6:25821456-25821478 ATGAAGCAGAATGCTCAGCCAGG + Intronic
1005476469 6:26212873-26212895 AAGAAATAGGAAACTCGGCCGGG - Intergenic
1005492459 6:26359402-26359424 AAGAAGAAAGAGGCTGGGCGTGG - Intergenic
1006132662 6:31878492-31878514 AAGGAGGAGGAGGTTCAGCCTGG - Intronic
1006412036 6:33879422-33879444 AAGAAGAAGGAGGCAAGTCCTGG - Intergenic
1006463301 6:34176602-34176624 CAGAGGCAGGGGGCTCTGCCAGG - Intergenic
1006469527 6:34219699-34219721 AAGAAGGAAGAGGCTGGGCACGG + Intergenic
1006725717 6:36197509-36197531 AAGGAGCAGGAGCCTTGGCTGGG + Intronic
1006812580 6:36829520-36829542 AAGAAACAGAAGGCTGGGCACGG + Intronic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1008052359 6:46913205-46913227 AAGAAGAAGGGGGCTGGGCCAGG + Intronic
1008271976 6:49501107-49501129 AAGAAGCTGGAGGCCAGGCAGGG + Intronic
1008482587 6:52001719-52001741 AAAAAGAAGGAGGCTGGGCGTGG - Intronic
1008564260 6:52751749-52751771 AAGAAGCAGGGGTCCCAGCCTGG - Intronic
1008573023 6:52833031-52833053 AAGAAGCAGGGGTCCCAGCCTGG - Intronic
1008602270 6:53107767-53107789 AAGAAGCAGTAGCTTGGGCCGGG + Intergenic
1008745111 6:54660274-54660296 AAGAATCAGGAGGCCAGGCATGG + Intergenic
1009284995 6:61804799-61804821 AAGAAGCAAGACCCTGGGCCTGG + Intronic
1011494527 6:87925345-87925367 AAGCAGCACCAGGCTCAGCCAGG + Intergenic
1011714991 6:90096247-90096269 GAGAAGCAGGTGGCAAGGCCAGG - Intronic
1013317470 6:108956404-108956426 AAGAGGCAAGAGGCTGGGCACGG + Intronic
1017939551 6:159039270-159039292 GAGTAGCAGGAGGTTGGGCCGGG + Exonic
1018736170 6:166688573-166688595 AAGAAGCAGGTGGCTAGGAGAGG + Intronic
1019147523 6:169984691-169984713 AGGGAGAAGGTGGCTCGGCCTGG + Intergenic
1020214855 7:6182338-6182360 AAGAAGCAGGAGGCTGGGTGCGG - Intronic
1020395925 7:7717345-7717367 AAGAAACAGGAGGCTGGGCGAGG - Intronic
1021986912 7:26106167-26106189 AAGAAGTTGGAGACTGGGCCGGG - Intergenic
1022061232 7:26797395-26797417 AGGAAACAGGAGTCTCTGCCTGG + Intronic
1022798936 7:33756725-33756747 AAGAAAGAGGAGGCTGGGCGTGG + Intergenic
1023317359 7:38952974-38952996 AAGAAGCAGGAGAATCGGCAGGG - Intergenic
1024074093 7:45810021-45810043 GGGAAGCAGGAGGCTGGGCCTGG - Intergenic
1024649040 7:51389338-51389360 AGGAGGCAGGAGGCCGGGCCTGG + Intergenic
1024649239 7:51390177-51390199 GGGAAGCAGGAGGCTGGGCCTGG + Intergenic
1025053318 7:55745507-55745529 GGGAAGCAGGAGGCTGGGCCTGG + Intergenic
1025131422 7:56375980-56376002 GGGAAGCAGGAGGCTGGGCCTGG + Intergenic
1025175810 7:56801900-56801922 AGGATGCAAGAGGCTGGGCCAGG + Intergenic
1025177900 7:56811168-56811190 AACAGGCAGGAGGCCAGGCCTGG + Intergenic
1025182229 7:56829049-56829071 GGGAAGCAGGAGGCTGGGCCTGG + Intergenic
1025689701 7:63747946-63747968 GGGAAGCAGGAGGCTGGGCCTGG - Intergenic
1025695982 7:63774522-63774544 AGGATGCAAGAGGCTGGGCCAGG - Intergenic
1025829389 7:65036695-65036717 AAGAAGCAGCAGGCTTACCCCGG - Intergenic
1026154189 7:67812904-67812926 TAGGAGCAGGAGGCTGGGCGCGG - Intergenic
1027171763 7:75877946-75877968 AAGGGGCAGGAGGCTGGGCACGG - Intronic
1027196236 7:76032413-76032435 AAGAAGGAGGAGGATCAGCTGGG + Intronic
1027392676 7:77721030-77721052 AAAAAGCAGTAGGCTGGGCACGG - Intronic
1028984909 7:97002140-97002162 AAGAAGCAGGAGCCAGGACCCGG + Intergenic
1029111421 7:98214708-98214730 CAGAAGACGGAGACTCGGCCCGG + Exonic
1029417685 7:100453581-100453603 CAGAAGCAGGAGGATTGACCAGG + Intergenic
1029912834 7:104173560-104173582 AAAAAGCAGGAGGCTCACCAGGG - Intronic
1030153528 7:106429044-106429066 AAGAAGCAGGAGTATGGACCAGG - Intergenic
1032669521 7:134070178-134070200 AAGAATCACTAGGCTCGGCAAGG + Intergenic
1032963762 7:137071688-137071710 ATGAAGCAAGAGGCTGGGCATGG + Intergenic
1033428916 7:141270893-141270915 AAGAACCAGGAGGCTTGGGAAGG - Intronic
1034123574 7:148650905-148650927 AAGAAAAAGGAGGCTGGGCACGG + Intergenic
1034269952 7:149798601-149798623 AGGAAGGAAGAGGCTCTGCCTGG + Intergenic
1034383752 7:150720817-150720839 CAGGAGCTGGAGGCTGGGCCTGG + Exonic
1035381381 7:158443548-158443570 AGGAAGCAGGAGGAGCGGCGTGG + Intronic
1037942622 8:22964069-22964091 AAAAAACAGGAGGCTGGGCATGG - Intronic
1038611580 8:29064245-29064267 AAGCAGCAGGTGGCTCTGCCTGG + Intronic
1040029588 8:42812672-42812694 AAGAATCAGGAGGCTGGGTGTGG + Intergenic
1045287368 8:100803767-100803789 AAGATGCAGGAGCCTCAGACAGG + Intergenic
1045288220 8:100810138-100810160 AGGAGGCAGGAGGGTAGGCCGGG - Intergenic
1046929337 8:119826874-119826896 AAGAAGGAGGAGGCTGGGTGTGG - Intronic
1047104965 8:121722022-121722044 AAAAAGCAGGAGGCAAGGCAAGG - Intergenic
1048062088 8:130930539-130930561 TAGAAGCAAGAGGCTGGGCGCGG - Intronic
1048085821 8:131178338-131178360 AAGTAGAAGGAGGCTGGGCACGG + Intergenic
1048329621 8:133463045-133463067 GAGAAGCAGGAGGTGCAGCCTGG + Intronic
1048650210 8:136467721-136467743 AAGAGGAAGGAGCCTTGGCCTGG + Intergenic
1049619266 8:143590607-143590629 CAAAAGAAGGAGCCTCGGCCAGG + Intronic
1049654019 8:143789857-143789879 CAGACGCAGGAGGGTGGGCCTGG + Intergenic
1049711657 8:144066790-144066812 CAAAAGAATGAGGCTCGGCCAGG + Intergenic
1049779555 8:144422581-144422603 AAGAAGCCGGAGGACTGGCCAGG - Intergenic
1050716027 9:8526697-8526719 GAGAAGAAGGAGGCTAGGGCTGG + Intronic
1051912587 9:22171462-22171484 AAGAGGCTGGAGACTCAGCCAGG + Intergenic
1053788870 9:41671729-41671751 AAGGAGCTGGAGGCTAGGCATGG - Intergenic
1054156269 9:61643038-61643060 AAGGAGCTGGAGGCTAGGCATGG + Intergenic
1054174469 9:61865840-61865862 AAGAAGGAGGAGGAACGGCTTGG - Intergenic
1054177150 9:61883074-61883096 AAGGAGCTGGAGGCTAGGCATGG - Intergenic
1054476043 9:65574038-65574060 AAGGAGCTGGAGGCTAGGCATGG + Intergenic
1054660383 9:67697731-67697753 AAGGAGCTGGAGGCTAGGCATGG + Intergenic
1054663069 9:67714951-67714973 AAGAAGGAGGAGGAACGGCTTGG + Intergenic
1054800889 9:69347207-69347229 CAGCAGAAGGAGGCTGGGCCTGG + Intronic
1056289430 9:85127852-85127874 AAGAATAAGGAGGCCAGGCCTGG + Intergenic
1056537799 9:87546257-87546279 AAGAAGCAGCAGGGTCCGTCAGG + Intronic
1057753983 9:97815736-97815758 AAGAAACAGGAGGCCAGGCACGG - Intergenic
1057925419 9:99142766-99142788 TAGAAGGTGGAGGCTGGGCCTGG + Intronic
1059121811 9:111646545-111646567 AAGAAGGAGGAGGCTCAGAGAGG + Intronic
1059283201 9:113151750-113151772 AAGATACAGGAAGCTCAGCCTGG + Intronic
1059337981 9:113581001-113581023 CAGAGGCAGGTGGCTGGGCCAGG + Intronic
1060108242 9:120888269-120888291 GTGAAGAAGGAGGCTGGGCCAGG - Intronic
1060218543 9:121752608-121752630 AGGAAGCAGGAGTCTCAGGCAGG - Intronic
1060264522 9:122102820-122102842 AACAAGCAGGAGGCTGGGCACGG + Intergenic
1060593627 9:124834901-124834923 GAGAATCTGGAGGCCCGGCCAGG + Intergenic
1061092170 9:128432850-128432872 AAATAGCAGGAGGCCAGGCCAGG + Intronic
1061151281 9:128829642-128829664 AGGCAGCAGGAGGCGCGGCCCGG + Intronic
1061513914 9:131077384-131077406 TAGAAGCTGGAGGCTGGGCACGG + Intronic
1061559663 9:131394311-131394333 AAGATGGAGGCGGCGCGGCCCGG + Intronic
1061740245 9:132698354-132698376 AAAAAGTGGGAGGCTCAGCCTGG - Intergenic
1062132391 9:134905777-134905799 AAGAAGCAGCAGCAGCGGCCAGG - Intergenic
1062421861 9:136486482-136486504 CTGAAGCTGGAGGCTTGGCCTGG + Intergenic
1062434297 9:136539888-136539910 AAGAGGAAGGAGGCTCAGGCGGG - Intronic
1186413260 X:9361984-9362006 GAGAAGCAGGAGGCTGGGTGTGG + Intergenic
1186548880 X:10481406-10481428 GAGAAGCACTAGGCTGGGCCAGG - Intronic
1187192296 X:17046469-17046491 CAGAAGGATGAGGCTTGGCCGGG - Intronic
1189126383 X:38451991-38452013 AAAAAGAAGGAGGCTAAGCCAGG + Intronic
1189789395 X:44588936-44588958 AAAAAGAAGAAGGCTCGGCATGG - Intergenic
1190043227 X:47088992-47089014 GAGAAGGAGGAGGCTTGGCATGG + Intronic
1190087687 X:47409937-47409959 ATGAAGAAGGAGGCTGGGCGCGG - Intronic
1190806760 X:53845026-53845048 AAGAATGAGCAGCCTCGGCCAGG - Intergenic
1191250266 X:58256853-58256875 ACGAGGCAGAAGGCTAGGCCTGG + Intergenic
1192130217 X:68542873-68542895 AAGAAGAAGAAGGCTGGGCATGG - Intergenic
1192551222 X:72055271-72055293 AAGATGCAGCAAGCCCGGCCTGG - Intergenic
1193825205 X:86216802-86216824 AACAAACAGGAGGCTGGGCATGG + Intronic
1195369720 X:104161557-104161579 AAGAAGAAAGAGGCTGGGCGTGG + Intergenic
1195709896 X:107765312-107765334 AAGGAGCAGGAGGCTGGACCAGG + Intronic
1195736514 X:108018080-108018102 AAGCAGCAGCAGGCACTGCCTGG - Intergenic
1196838049 X:119831607-119831629 AAGAAGGAGGAGGCCAGGCGTGG - Intergenic
1197440012 X:126476216-126476238 GAGAAGCAGGACCCTGGGCCTGG + Intergenic
1198303505 X:135354896-135354918 AAGGAGCAGGTGTCTGGGCCTGG + Intronic
1199850525 X:151722467-151722489 GAGAAGCAGGAGGCTGGGCCAGG - Intronic
1200150892 X:153950940-153950962 AAGAAGCAGGAGCTGCAGCCAGG - Exonic
1200915826 Y:8570345-8570367 GAGAAGCAGGAGGCTGTGTCTGG + Intergenic
1200935575 Y:8735403-8735425 AAGAAGCAGGAAGCAATGCCTGG - Intergenic