ID: 962351081

View in Genome Browser
Species Human (GRCh38)
Location 3:134656188-134656210
Sequence GTTTGGGGATGTAGCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962351081_962351083 -10 Left 962351081 3:134656188-134656210 CCAGGAAGGCTACATCCCCAAAC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 962351083 3:134656201-134656223 ATCCCCAAACAGTGTCCTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 178
962351081_962351090 11 Left 962351081 3:134656188-134656210 CCAGGAAGGCTACATCCCCAAAC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 962351090 3:134656222-134656244 GGATGAATGAGTAGGAGAGAGGG 0: 1
1: 0
2: 5
3: 68
4: 702
962351081_962351089 10 Left 962351081 3:134656188-134656210 CCAGGAAGGCTACATCCCCAAAC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 962351089 3:134656221-134656243 GGGATGAATGAGTAGGAGAGAGG 0: 1
1: 0
2: 3
3: 43
4: 595
962351081_962351091 16 Left 962351081 3:134656188-134656210 CCAGGAAGGCTACATCCCCAAAC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 962351091 3:134656227-134656249 AATGAGTAGGAGAGAGGGACAGG 0: 1
1: 0
2: 5
3: 48
4: 557
962351081_962351092 25 Left 962351081 3:134656188-134656210 CCAGGAAGGCTACATCCCCAAAC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 962351092 3:134656236-134656258 GAGAGAGGGACAGGCTTTCCAGG 0: 1
1: 0
2: 2
3: 41
4: 374
962351081_962351087 3 Left 962351081 3:134656188-134656210 CCAGGAAGGCTACATCCCCAAAC 0: 1
1: 0
2: 0
3: 3
4: 115
Right 962351087 3:134656214-134656236 GTCCTCAGGGATGAATGAGTAGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962351081 Original CRISPR GTTTGGGGATGTAGCCTTCC TGG (reversed) Intronic
900376509 1:2357259-2357281 GTCTGGGGATGTGGGCTGCCCGG + Intronic
900761437 1:4474224-4474246 GTGTGGGGATGGAGCCTGCAGGG + Intergenic
902284270 1:15396371-15396393 GTTTTGGGGTGCACCCTTCCAGG - Intronic
903425539 1:23251553-23251575 GTTTGGGGATGGAGCCCTCATGG - Intergenic
910591886 1:88934829-88934851 ATTTCAGGATGTAGCCCTCCAGG - Intergenic
910992012 1:93066480-93066502 ATTTGAGGATTAAGCCTTCCAGG + Intergenic
914339038 1:146742644-146742666 TTTTGGAAAAGTAGCCTTCCAGG + Intergenic
915164076 1:153939010-153939032 GTTTGTGGCTGGAGCGTTCCCGG + Exonic
917823238 1:178788572-178788594 GTTTGGGGAAATAGTATTCCAGG + Intronic
922526131 1:226305617-226305639 GTGTGGGGGGGTAGCATTCCAGG + Intronic
924807347 1:247372061-247372083 GTCTGGGAGTGCAGCCTTCCAGG + Intergenic
1062898062 10:1120043-1120065 TTTTGGGGAGGTAGCCATCAAGG + Intronic
1064141618 10:12795467-12795489 GTGTGGGGAGGTGGCCTCCCTGG - Intronic
1066470355 10:35691738-35691760 GATTGGAGTTGAAGCCTTCCAGG + Intergenic
1068120233 10:52777089-52777111 TTTTGGGGGTGTAGCCTGTCTGG - Intergenic
1069886599 10:71627733-71627755 GTGTGGGGAAGGAGCCTGCCAGG - Intronic
1070388537 10:75948826-75948848 GGTTGGTGATATAGCCTTGCTGG + Intronic
1072019364 10:91383026-91383048 GTTTGGAGATGCAGCCTCACAGG + Intergenic
1072278238 10:93843434-93843456 GTTTAGAGATTTAGTCTTCCTGG + Intergenic
1073074198 10:100813320-100813342 TTTTGGTGAGGTAGCCTGCCTGG - Intronic
1073774623 10:106771952-106771974 GTCTGGGGATGTGGCTATCCAGG - Intronic
1081751278 11:45512952-45512974 ATCTGGGGAAGTAGCCTTTCAGG - Intergenic
1083422912 11:62565743-62565765 GTGTCTGGATGGAGCCTTCCTGG + Intronic
1083796563 11:65020252-65020274 GTTTGTGGACGTAGCCATCAAGG - Intronic
1084410666 11:69004374-69004396 CTGTGGGCATGAAGCCTTCCTGG + Intronic
1087640342 11:100749399-100749421 GTTTGAGGGTTTAGTCTTCCGGG - Intronic
1087640354 11:100749445-100749467 GTTTGAGGGGTTAGCCTTCCGGG - Intronic
1089684127 11:120136004-120136026 GCTTGTGGATGTAGCATACCTGG - Intronic
1095987087 12:48005671-48005693 GTTTGGGGACGTTTCCTCCCTGG - Intergenic
1101130561 12:101686917-101686939 GGTTGGTGATGTTGCCTTACTGG + Intergenic
1102471706 12:113163160-113163182 GGTAGGGGATGTAGAATTCCTGG + Exonic
1106248980 13:27969804-27969826 GTTTGGGGCTGCAGTCGTCCGGG - Exonic
1117076141 14:52106709-52106731 GTTTGGGGAGGTGGGCTTGCTGG + Intergenic
1119599069 14:75962556-75962578 GTTTGGGGATGAAGGGATCCAGG - Intronic
1121933291 14:97993168-97993190 ATTTGGGGATCTGTCCTTCCTGG - Intergenic
1122109637 14:99488994-99489016 GTCTGGGGTTGGAGCCTGCCTGG - Intronic
1124632358 15:31345000-31345022 GTTTGGGGCAGGTGCCTTCCAGG + Intronic
1129429648 15:75490252-75490274 TTATGGGGATGTACCCTGCCTGG - Exonic
1133016657 16:2945615-2945637 TTTTTGAGATGTAGTCTTCCAGG - Intronic
1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG + Intronic
1133338209 16:5020345-5020367 GTTTTGGGATGCAGCTCTCCAGG - Intergenic
1134533959 16:15009674-15009696 GTTCCAGGATGTTGCCTTCCTGG + Exonic
1135245242 16:20850719-20850741 GTTTTGGCATATAGCCTTGCAGG - Intronic
1139203167 16:64999976-64999998 ATCTGGGGATGTGGCCTGCCTGG + Intronic
1139862079 16:70031051-70031073 GTTCCAGGATGTTGCCTTCCTGG - Intergenic
1139995242 16:70974708-70974730 TTTTGGAAAAGTAGCCTTCCAGG - Intronic
1141097735 16:81174872-81174894 TGTTGAGGATGTAGCATTCCAGG - Intergenic
1143520001 17:7439593-7439615 GTTTGGGGGTGTCTCCTCCCGGG + Exonic
1143963186 17:10737501-10737523 GTTTGGGGATGAATATTTCCTGG - Intergenic
1148633242 17:49128333-49128355 GTTTGGGGCTGAAGGCTTGCGGG + Intergenic
1151975548 17:77481902-77481924 GTCTGGGGATGGAGCTTTGCTGG + Intronic
1155254522 18:23983013-23983035 GGTTGGGGATTTAGGCTGCCAGG - Intergenic
1156330643 18:36118510-36118532 GGTTGGGGAGGCAGCATTCCAGG + Intronic
1158670077 18:59466787-59466809 CTTCCCGGATGTAGCCTTCCCGG + Exonic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1161440745 19:4290379-4290401 CTTTGGGGATGGTGCCTTTCTGG + Intronic
1167780183 19:51593920-51593942 GTTTTGGGATCTTGCCTTACGGG + Intergenic
932018911 2:68062828-68062850 GTTTGGCTGCGTAGCCTTCCAGG - Intronic
932076979 2:68673666-68673688 TTTTGGGGATTTAGCCTTCTTGG + Intergenic
933943626 2:87265997-87266019 ATTTGGAGATGAAGCCTTCGTGG - Intergenic
935465348 2:103389870-103389892 GTTTGGGGGTGTAGCCCTGGTGG + Intergenic
936336595 2:111595582-111595604 ATTTGGAGATGAAGCCTTCGTGG + Intergenic
937440548 2:121911843-121911865 ATTTGGGGATGAGGCTTTCCTGG + Intergenic
939376011 2:141368297-141368319 TTTTGGAGATGAGGCCTTCCTGG + Intronic
939378297 2:141399479-141399501 GTTTGGGGATGTAGCCGCTGGGG - Intronic
945513134 2:210727458-210727480 ATTTGGAGATGTGGCCTTTCAGG + Intergenic
948271326 2:236675463-236675485 GTTTGGGGCTATTTCCTTCCAGG + Intergenic
1170938031 20:20826580-20826602 GTCTGGGGATGTTCTCTTCCTGG - Intergenic
1177218807 21:18164063-18164085 GTTTTGGGTTGTAGTCATCCAGG + Intronic
1178112084 21:29378759-29378781 GATTTGGGATGTAGTTTTCCAGG - Intronic
1179547823 21:42124366-42124388 GGTTGGGGAAGTGGCCTTCTGGG + Intronic
1179707624 21:43191369-43191391 GATTGGGGCTGTGGCTTTCCAGG - Intergenic
1180625398 22:17190654-17190676 CTGTGGGGATAAAGCCTTCCTGG + Intronic
953134358 3:40169998-40170020 CTCTGGGGATGTGGCCATCCTGG - Exonic
956582853 3:70833431-70833453 ATTTGGGGATGTCAGCTTCCTGG - Intergenic
957238159 3:77621723-77621745 GTGTGGGGAGGAAGCCTTCTAGG + Intronic
957517926 3:81280042-81280064 TTTTGGGGATAAAGCCTTGCTGG - Intergenic
960474933 3:118112256-118112278 CTTTGGGGATGAAGCCTCCTAGG + Intergenic
962351081 3:134656188-134656210 GTTTGGGGATGTAGCCTTCCTGG - Intronic
965643214 3:170853590-170853612 GTTTGGTGATGTGGCTTTCTGGG + Intronic
965989623 3:174800660-174800682 GTTGGTGGATCTAGCATTCCAGG - Intronic
973199054 4:47479067-47479089 GTCTGGGGATGGAGCATTTCAGG - Intergenic
975851121 4:78573681-78573703 GTTTGGGGCTGTTGCCTTTATGG + Intronic
975870314 4:78773296-78773318 GTCTTGGAATGTATCCTTCCTGG + Intergenic
975926874 4:79466382-79466404 GTTTGATAATGTAGCCCTCCAGG - Intergenic
978162266 4:105563010-105563032 GTTTGGGGATGTGGCTATCTTGG + Intronic
979801400 4:124913691-124913713 GTTTGGGCATGTCTCCTTCTTGG + Intergenic
982921644 4:161281370-161281392 ATTTGGGAATGTAGCATTCAAGG + Intergenic
987110892 5:14685596-14685618 GTTCAGGGTTGTAGACTTCCAGG - Intronic
991095585 5:62736297-62736319 GTTTGCCCATGTAGCCATCCAGG - Intergenic
995620169 5:114017295-114017317 GCTTGGGGATGTAGCCATAGGGG - Intergenic
996488098 5:124060069-124060091 ATTTGGGGATGTGGCCTTTAAGG - Intergenic
999486087 5:151997783-151997805 GCTTGAGGATGTAGTGTTCCTGG + Intergenic
1008661013 6:53667937-53667959 ATTTGGGGATGTAACCTTAATGG + Intergenic
1010291281 6:74140987-74141009 ATTTGGAGATGTGGCCTTTCAGG + Intergenic
1011952122 6:92979635-92979657 ATTTGGGGATGAGGCCTACCAGG - Intergenic
1017794477 6:157831282-157831304 GATTGAGGTTGTATCCTTCCAGG + Intronic
1022475552 7:30707352-30707374 GGCTGGGGAAGAAGCCTTCCTGG - Intronic
1025482842 7:61005915-61005937 ATTTGGGGATGTAGTGTTCTAGG - Intergenic
1026812199 7:73477621-73477643 GTTTGGGGATGTGGCCATGGTGG - Exonic
1028300916 7:89199296-89199318 GTTTGGGAATGGAGTCTTGCAGG - Intronic
1029605415 7:101596310-101596332 GGTTGGGGATGCAGCCATCTGGG - Intergenic
1030419770 7:109293580-109293602 GCTTGGAGCTGTAGCTTTCCTGG + Intergenic
1032269614 7:130392426-130392448 ATTGGGGGATATATCCTTCCAGG - Intergenic
1034345293 7:150382006-150382028 GTGTGGGGATGGAGGCCTCCAGG + Intronic
1034984014 7:155496462-155496484 GTGTGGGGAAGTCCCCTTCCGGG + Intronic
1035672182 8:1426576-1426598 GGTTGGGGATTTTTCCTTCCAGG - Intergenic
1047800737 8:128307111-128307133 GTTCGGGGAAGGTGCCTTCCAGG + Intergenic
1048107464 8:131427381-131427403 GTTTGTGGATTTACCCTTCTGGG + Intergenic
1048786586 8:138056988-138057010 GATTGGGGAAGAAGCATTCCTGG - Intergenic
1049332843 8:142064405-142064427 ATTTGGGGATGGAGTCTTTCCGG - Intergenic
1051341888 9:16119759-16119781 GATTGGGAATGGAGCCTCCCGGG - Intergenic
1051370764 9:16357144-16357166 GTTTCGGTATATAGCCTTCTGGG + Intergenic
1052745073 9:32432647-32432669 GTTTTGGGAAGTGGCCTTCCAGG - Intronic
1054845042 9:69785833-69785855 CTTTGTGGATGTGGTCTTCCAGG + Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1190829715 X:54048735-54048757 GATGGGGGAGGTAGGCTTCCAGG - Intronic
1192568143 X:72180384-72180406 GTTTTTGGATGCAGCCTTGCTGG - Intergenic
1199185272 X:144909124-144909146 GTTTGAGGATCTAGCTTTTCAGG - Intergenic