ID: 962351494

View in Genome Browser
Species Human (GRCh38)
Location 3:134659795-134659817
Sequence TCCTCCCGCCAGGCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962351494_962351504 21 Left 962351494 3:134659795-134659817 CCCCCAGGGGCCTGGCGGGAGGA 0: 1
1: 0
2: 5
3: 38
4: 301
Right 962351504 3:134659839-134659861 GCAGGAGTTGCCCAGTGGCCTGG 0: 1
1: 0
2: 1
3: 26
4: 241
962351494_962351502 16 Left 962351494 3:134659795-134659817 CCCCCAGGGGCCTGGCGGGAGGA 0: 1
1: 0
2: 5
3: 38
4: 301
Right 962351502 3:134659834-134659856 CCCAAGCAGGAGTTGCCCAGTGG 0: 1
1: 0
2: 2
3: 20
4: 203
962351494_962351505 29 Left 962351494 3:134659795-134659817 CCCCCAGGGGCCTGGCGGGAGGA 0: 1
1: 0
2: 5
3: 38
4: 301
Right 962351505 3:134659847-134659869 TGCCCAGTGGCCTGGATCCCAGG 0: 1
1: 0
2: 3
3: 22
4: 310
962351494_962351500 3 Left 962351494 3:134659795-134659817 CCCCCAGGGGCCTGGCGGGAGGA 0: 1
1: 0
2: 5
3: 38
4: 301
Right 962351500 3:134659821-134659843 TGGTGTTCATCGTCCCAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 46
962351494_962351506 30 Left 962351494 3:134659795-134659817 CCCCCAGGGGCCTGGCGGGAGGA 0: 1
1: 0
2: 5
3: 38
4: 301
Right 962351506 3:134659848-134659870 GCCCAGTGGCCTGGATCCCAGGG 0: 1
1: 0
2: 2
3: 26
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962351494 Original CRISPR TCCTCCCGCCAGGCCCCTGG GGG (reversed) Intronic
900196815 1:1380822-1380844 TCCTCAGGCCCAGCCCCTGGGGG - Intergenic
900198628 1:1391373-1391395 GCCTGCCGCCAGCGCCCTGGAGG - Intronic
900999513 1:6141793-6141815 TCCTCCTTCCAGCCTCCTGGTGG - Intronic
902241850 1:15094943-15094965 TCCTCCCCCGGGGCCCCTCGTGG - Intronic
902808644 1:18875868-18875890 TCTTCCCCCCAGCCCCTTGGTGG - Intronic
902813839 1:18904803-18904825 CCCTCCCCCCAGGGCCCTGGGGG + Exonic
902813843 1:18904808-18904830 TGTTCCCCCCAGGGCCCTGGGGG - Exonic
902911024 1:19597248-19597270 ACCTCCCGCCGGGGCCCGGGCGG - Intronic
903326751 1:22573218-22573240 TCCTCCCGCATGGTCCCTGGAGG + Intronic
903548626 1:24142571-24142593 GCCTCCCTCCATGCCCCTGCAGG - Intronic
903822060 1:26110980-26111002 CCCCCCCGCGAGGCTCCTGGTGG - Intergenic
904035325 1:27555870-27555892 TCCTCCTGCCAGGCCTCCTGAGG + Intronic
905414132 1:37793523-37793545 TCCGCCCGCCAGGCCCCGGACGG + Intergenic
905627377 1:39497925-39497947 TCCTCCAGGCAGGGCCCTGTGGG - Intronic
905669052 1:39779186-39779208 TCCTCCAGGCAGGGCCCTGTGGG + Intronic
906149105 1:43577469-43577491 TCCAGCTGCCAGCCCCCTGGGGG + Intronic
906294117 1:44638578-44638600 GCTTCCCACCAGGCCCCTGGAGG + Intronic
906703354 1:47876053-47876075 TGCTCCCTCCAGCCCACTGGAGG + Intronic
907661250 1:56394521-56394543 TCCACCAGCCAGGCTCCTGGAGG + Intergenic
909078405 1:71080798-71080820 TCTTCCCGCCAGGGAACTGGCGG + Intronic
912745721 1:112243838-112243860 TCCACCCTTCAGGCCCCAGGAGG + Intergenic
913333115 1:117683640-117683662 TCCACCTGGCAGGCCCCTCGGGG + Intergenic
913962672 1:143352384-143352406 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
913963988 1:143359728-143359750 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914057027 1:144177969-144177991 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
914058352 1:144185332-144185354 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914120796 1:144781039-144781061 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
914122119 1:144788397-144788419 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
915143972 1:153783737-153783759 TCCGCCCGGCGGGCCCCTGCAGG + Intergenic
917797649 1:178543153-178543175 TTCTCCCGCCGGGTGCCTGGTGG + Intronic
919800947 1:201354325-201354347 TCCTCCTGTCAGGTCCCAGGTGG + Intergenic
920383261 1:205548312-205548334 TCCTCCAGCTAGACCTCTGGGGG + Intergenic
920401344 1:205678784-205678806 TCCTCCCACCAGGCCTGTCGTGG - Intronic
922765998 1:228157078-228157100 TCCTCCCTCCAGCCCCCGGCTGG - Intronic
923191909 1:231627408-231627430 TCCTCCCTCCAGGTCCCCGAAGG - Intronic
1063419513 10:5900434-5900456 CCCTCCCGCCAGGCCCTCGCCGG + Intronic
1064430053 10:15262957-15262979 TCCTCCCAGGAGGGCCCTGGTGG - Intronic
1066997214 10:42575359-42575381 TCCTTCTTCCAGGCTCCTGGTGG - Intronic
1067848683 10:49741386-49741408 TGCTCCAGCCAGGGCCCAGGTGG - Intronic
1069111142 10:64447900-64447922 TCCTTCTGCCAGGTACCTGGGGG - Intergenic
1069558712 10:69414929-69414951 TCCTCCTGTAAGGCCTCTGGGGG - Exonic
1069837653 10:71319377-71319399 ACCTCCCTCCCGGGCCCTGGGGG + Intronic
1070852437 10:79576826-79576848 TCATCCTGTCTGGCCCCTGGAGG - Intergenic
1072798094 10:98372001-98372023 TCCCCCCGCCACCCCCCAGGAGG - Intergenic
1072890116 10:99316220-99316242 GGCTCCCGCCAGGCCTCGGGTGG + Intergenic
1073290215 10:102409578-102409600 TCCTCCCTCGAGGCCCCTCTTGG - Intronic
1074043963 10:109819863-109819885 TGCTCCAGCCAGGCCCTTTGGGG + Intergenic
1075030472 10:119021326-119021348 TCCACCTTCCAGGACCCTGGTGG - Intergenic
1076482328 10:130792711-130792733 TGCTCCGGCCAGGCTCCTGTAGG + Intergenic
1076660506 10:132053118-132053140 TGCTCCTGCCAGGCAGCTGGAGG + Intergenic
1077416082 11:2424907-2424929 TCCTCCGGCCAGGCCTGTGGAGG + Intergenic
1081671143 11:44943351-44943373 TCCTGCAGCCTGGCTCCTGGGGG - Intronic
1081993009 11:47347665-47347687 ACCTCCAGCCAGGCTCCTGTGGG + Exonic
1083272543 11:61579724-61579746 CCCTCCTGCCAGCCTCCTGGGGG - Intronic
1083277597 11:61606003-61606025 TCCTTCCCCCAGGCCTCTGTAGG - Intergenic
1084275586 11:68049541-68049563 TCCTCCCTCCAGGGCCCCCGGGG - Intronic
1084381545 11:68816113-68816135 TCTTGCAGCCAGGCCCTTGGAGG + Intronic
1084413935 11:69019625-69019647 GCTTCCCGCCAGGCCCCTGAGGG - Intergenic
1084567522 11:69939923-69939945 TCCTCCAGCCAGGCCCTCTGGGG + Intergenic
1084963143 11:72727685-72727707 CCCTACCTCCATGCCCCTGGAGG + Intronic
1090235136 11:125141459-125141481 TCTTCCTGCCAGGCCCCGGCCGG + Intergenic
1090384368 11:126348038-126348060 TCGTAGCGCCTGGCCCCTGGAGG + Intergenic
1090667520 11:128924647-128924669 TCCTCCGGCAAGGGCTCTGGGGG + Intergenic
1096677100 12:53231907-53231929 TCCTCCGGCGAGGCGGCTGGGGG - Intronic
1097821750 12:64134903-64134925 ATATCCCGGCAGGCCCCTGGAGG - Intronic
1098038839 12:66334216-66334238 TCCTCCTGCCTGGCTCCTGAAGG - Intronic
1099956056 12:89353508-89353530 TCCTCACGCCTCGCCCATGGCGG - Intergenic
1101044920 12:100794920-100794942 TCCTCCCGACTGGAGCCTGGAGG + Intronic
1101946086 12:109138451-109138473 TCCTCCCTCCAGGGCCATGATGG + Intronic
1102220090 12:111188450-111188472 TCCTCTCCCTCGGCCCCTGGTGG - Intronic
1102968183 12:117144880-117144902 TGCTGCCGTCAGGACCCTGGCGG + Intronic
1103393245 12:120589263-120589285 GCCTCCCTCAAGGACCCTGGGGG + Intergenic
1103562725 12:121800651-121800673 TCCTCCCGCCCGGCGCGCGGCGG + Intronic
1104936533 12:132367506-132367528 TCCTCCGGCACAGCCCCTGGCGG + Intergenic
1105403849 13:20118342-20118364 CGCTCAGGCCAGGCCCCTGGCGG + Intergenic
1105450207 13:20492818-20492840 TGCTCCTGCCAGGCACTTGGGGG + Intronic
1105847728 13:24307984-24308006 TCCTCCCGCCAGGACCCTGCCGG - Intronic
1106476761 13:30105596-30105618 TCCTACCTCCAGGGCCCGGGAGG + Intergenic
1107940033 13:45375284-45375306 TTCTCCCACCAGGCCCTTGGTGG - Intergenic
1108508860 13:51136761-51136783 GCCTCGCGCCAGGCTCCTGGGGG - Intergenic
1108882413 13:55136958-55136980 TCCTCCCACCAGGCCCCAGGGGG - Intergenic
1109994601 13:70107595-70107617 TCCCCCCGCCGGGCCGCCGGTGG + Exonic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113441192 13:110329817-110329839 TCCTCCTGCCAGTGCCGTGGTGG - Intronic
1113608389 13:111626437-111626459 CCCTCCTGCCAGGGCCCAGGTGG - Intronic
1113633119 13:111901457-111901479 TACTCCCTCCAGTCCTCTGGTGG - Intergenic
1113802484 13:113093836-113093858 TCCTCCTGCCAGGCTCCCAGAGG - Intronic
1113825327 13:113248004-113248026 ACCTCCCGCCAGGATCCTGATGG - Intronic
1114614062 14:24059123-24059145 GCCTCCCTGCAGGACCCTGGAGG + Exonic
1115452696 14:33566373-33566395 TCCTCCCGGCAGGATCCTTGGGG + Intronic
1117140995 14:52791309-52791331 TGCCCCGGCCAGGCCCCCGGGGG - Intronic
1118376938 14:65185604-65185626 TCTTTCTGCCAGGCACCTGGAGG + Intergenic
1119738433 14:76998810-76998832 ACCTCAGGCCAGGCCTCTGGCGG - Intergenic
1122117179 14:99533675-99533697 TGCTCCCACCAGCTCCCTGGGGG - Intronic
1122825952 14:104370547-104370569 TGCTCCCTCCAGGCCCCAGCTGG + Intergenic
1122982824 14:105199301-105199323 TCCTGCGGCCAGGCCCCCGCTGG + Intergenic
1123986180 15:25648226-25648248 TCTCCCCTCGAGGCCCCTGGAGG + Intergenic
1126170721 15:45693224-45693246 TGCTGCCGCCTGGCTCCTGGTGG + Intergenic
1127972629 15:63973383-63973405 TCTGCCCTCCAGGCCCATGGGGG - Intronic
1128147124 15:65337858-65337880 TCCCCACCCCAGGTCCCTGGGGG - Intronic
1129231523 15:74199623-74199645 TCCCCCAGGCAGGGCCCTGGAGG - Intronic
1129709825 15:77815098-77815120 TCCTCTCGCCCTGACCCTGGTGG + Intronic
1131098859 15:89672701-89672723 GCCTCCAGCCAGGGCCCTAGAGG - Intronic
1131152151 15:90053912-90053934 TCCTCCCTCCTGGCCACTGTGGG + Intronic
1131259627 15:90881780-90881802 TCCTCCTGCCAGGCTTCAGGGGG - Exonic
1132153271 15:99477096-99477118 CGCTCCCGCCTGGGCCCTGGTGG + Intergenic
1132204093 15:99974705-99974727 GCCTCCTGCCAGGGCACTGGGGG + Intronic
1132728824 16:1350713-1350735 TCCTGCCGACAGACCCCAGGAGG - Intronic
1132785863 16:1656722-1656744 GCCTGCCGCCAGGCCCCCGAAGG + Exonic
1132932149 16:2464305-2464327 TCCACCCCCCAGGACCCAGGAGG + Intronic
1133217060 16:4299063-4299085 ACCTCCCTCCCAGCCCCTGGAGG + Intergenic
1133384297 16:5356212-5356234 GCCTCCCTCCTGGCTCCTGGTGG - Intergenic
1134871124 16:17653349-17653371 AGCTCCAGCCAAGCCCCTGGTGG - Intergenic
1135573566 16:23567761-23567783 TGCTCAGGCCAGGCCCCTGATGG - Intronic
1136576926 16:31130616-31130638 TCCTGCCCCCAGGGCCCGGGAGG - Intronic
1136779344 16:32886782-32886804 TGCACCCGCCAGGCACCAGGGGG - Intergenic
1136891273 16:33974736-33974758 TGCACCCGCCAGGCACCAGGGGG + Intergenic
1140863711 16:79041393-79041415 TCCACCCACCACGCCCCTTGCGG + Intronic
1140881279 16:79200177-79200199 GCTTCCCACCAGGCCTCTGGCGG - Intronic
1141083236 16:81072033-81072055 TCCTCCCACAATGACCCTGGGGG + Intronic
1141667272 16:85472306-85472328 TCCTCCCCCCAGGCCTCCAGAGG - Intergenic
1141897290 16:86966202-86966224 TCCTCTCCCCAAGCCTCTGGAGG - Intergenic
1142190804 16:88716468-88716490 TCCCTTCGCCAGGTCCCTGGGGG + Exonic
1142306645 16:89289684-89289706 ACCTCACTCCAGGCCCCTGGAGG - Intronic
1203081760 16_KI270728v1_random:1148870-1148892 TGCACCCGCCAGGCACCAGGGGG - Intergenic
1142622434 17:1173400-1173422 TGCCCCTGCCAGGCCCTTGGTGG - Intronic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1142734154 17:1884137-1884159 TCCTGCCTCCAGTCCCCTGAGGG - Intronic
1143078869 17:4366717-4366739 GCCTCCCGCCCCGCCCCCGGCGG + Intergenic
1143125637 17:4639657-4639679 CCCTCCCGCCAGGCCCCACCGGG - Intronic
1143402840 17:6657166-6657188 CCCTCCCGCCAGGCCCCACCGGG + Intergenic
1143478117 17:7214476-7214498 TCCCTCCGCCACGCCCCTGACGG + Intronic
1143950849 17:10631225-10631247 TTCTCCCGCCAGGCAGCAGGTGG + Intronic
1144759666 17:17700319-17700341 TCCTGTCGCCCGGCCCCAGGCGG + Intronic
1145124226 17:20286914-20286936 TCCTGCAGCCTGGGCCCTGGGGG - Intronic
1145193259 17:20866542-20866564 TCCTACCTCCAGGCCCCCGTGGG + Exonic
1145298756 17:21614542-21614564 TCCTACCACCAGGCCCCCGTGGG - Intergenic
1145351524 17:22088748-22088770 TCCTACCACCAGGCCCCCGTGGG + Intergenic
1146183281 17:30710074-30710096 TCCCCCCGCCAGGCACCCTGCGG - Intergenic
1146666731 17:34710147-34710169 TCTGACCGCCAGGCCCTTGGAGG + Intergenic
1146939931 17:36837295-36837317 TCCTGCTGCCAGGGCCCTGATGG - Intergenic
1147141185 17:38461426-38461448 TGCTCCCCAGAGGCCCCTGGTGG + Intronic
1147356650 17:39903643-39903665 TCTTCCCTGCAGTCCCCTGGGGG + Intergenic
1147684047 17:42276397-42276419 TCCTCCCGCCGGGGCCCGCGGGG + Exonic
1148090910 17:45022057-45022079 TCCTCCTCCCAGGCCGCGGGCGG - Intergenic
1148203015 17:45762523-45762545 TCCTCCTCCCTTGCCCCTGGGGG + Intergenic
1149512077 17:57250930-57250952 TCCTCTAGCCAGGGCCCTGGGGG - Intergenic
1150321631 17:64218957-64218979 TTCTTCTGCCAGGTCCCTGGAGG - Intronic
1151314347 17:73312307-73312329 GCCTCGCGCCAGGCCCCCGGAGG - Intergenic
1152015049 17:77744970-77744992 TCCAGCCACCAAGCCCCTGGAGG + Intergenic
1152540433 17:80971859-80971881 TCCTCCCTGGAGGGCCCTGGGGG - Intergenic
1155451181 18:25964164-25964186 CCTTCCTGCCATGCCCCTGGAGG - Intergenic
1156180270 18:34595800-34595822 TGCTTCTGCCAGGCACCTGGGGG + Intronic
1157105617 18:44771776-44771798 TCCTGCTCACAGGCCCCTGGAGG + Intronic
1157563476 18:48664316-48664338 GCTCCCCGCCTGGCCCCTGGCGG + Intronic
1157597298 18:48871505-48871527 TCCTCACGCCACGCCCGAGGTGG + Intergenic
1157614425 18:48978272-48978294 TCCTCACGCCAGGCCCGAGGTGG - Intergenic
1157794099 18:50559617-50559639 CCCTCCCACCGGGCCCCCGGCGG + Intergenic
1157840179 18:50950292-50950314 TCCTCCCTCCAGGCCCCCGGGGG + Exonic
1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG + Intronic
1160683673 19:423673-423695 TCCTCCAGCCCTGACCCTGGGGG + Intronic
1160753651 19:747121-747143 CCCACCCGCCAGGACCCCGGTGG - Exonic
1160793884 19:935037-935059 ACCTCCCGCCCGGCCCCTACTGG + Intronic
1160830387 19:1101955-1101977 TGCTCCCGCCCAGCCCCTAGAGG - Intergenic
1161114539 19:2489256-2489278 TCCCTCCTCCAAGCCCCTGGCGG + Intergenic
1161216978 19:3099507-3099529 TCCTGCCGCCAGGCCCTGTGTGG + Intronic
1161319956 19:3636562-3636584 TCCTCCCAGCAGGCCCCTCTGGG + Intronic
1161376126 19:3939888-3939910 CACTCCGCCCAGGCCCCTGGTGG + Exonic
1162133479 19:8541846-8541868 TCCTCCCTCCATCCCCTTGGGGG + Intronic
1162830578 19:13282012-13282034 TCCCCACGCCTGGCTCCTGGAGG + Intronic
1162975511 19:14205700-14205722 TCCCCCCGCCAGGCACCCTGCGG + Intronic
1163527475 19:17830449-17830471 TTCTCCCTCCACGCCCCTCGTGG - Intronic
1163650188 19:18512987-18513009 TCCTTCCCCCAGGCCCATCGGGG - Intronic
1163662640 19:18588010-18588032 TCCTCCGGCTGGGCCCCTGGAGG + Intronic
1164789958 19:30968394-30968416 GCCTCTCGCCTGGCCTCTGGTGG - Intergenic
1164952177 19:32345843-32345865 TCCTCCCCTCAGGCCTCTGCCGG + Intronic
1165734113 19:38164858-38164880 GCCCCCCGCCAGTCCCGTGGGGG - Exonic
1166312158 19:41969125-41969147 TCCTCCTCCCTGGCCCCTGGTGG - Intronic
1166367894 19:42286479-42286501 TCCTCTGGCCTGGTCCCTGGTGG + Intronic
1166502862 19:43354144-43354166 GTCTCCCTCCAGGACCCTGGAGG + Intronic
1166690866 19:44820693-44820715 TCCTCCCCCCAGGCCGCCAGGGG + Exonic
1166935431 19:46329585-46329607 TGCTCCAGCCAGGCCCTCGGTGG + Intronic
1167268179 19:48493610-48493632 GCCTCCCGCCAGGCCCTTCCCGG + Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
1167696059 19:51016146-51016168 TCCTTCCCCCAGGCCACTGTGGG - Exonic
1168117841 19:54234152-54234174 CCCTCCAGCCTGGCCCCTGGAGG - Intronic
1202696510 1_KI270712v1_random:130642-130664 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
1202697833 1_KI270712v1_random:137989-138011 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
925786301 2:7434374-7434396 TGATCCCGCAAGGGCCCTGGAGG - Intergenic
926146718 2:10400881-10400903 TTCCCCCGCCAGGCACCTGGCGG - Intronic
926205082 2:10830087-10830109 TCCTCACCCCAGGCCCTGGGAGG + Intronic
927472337 2:23385646-23385668 TCCTCCGGCCAGGACCCGAGCGG + Exonic
927554682 2:24023408-24023430 ACCCCCCGCCAGCCCCCTGCCGG - Intronic
927872973 2:26635301-26635323 TCCCCCCACCAGCCCCCAGGAGG + Intronic
928626655 2:33146837-33146859 ACCTCCCACCAGGCCCCTCCTGG + Intronic
934277672 2:91587667-91587689 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
934279004 2:91594985-91595007 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
935313253 2:101806274-101806296 TCTTCCCCCCAGGCCCCTTGGGG + Intronic
936068474 2:109349676-109349698 TCCTCCTGTGAGGCCCCTGGAGG - Intronic
937909555 2:127068820-127068842 TCCTCCTGCCTGGCCCCAGGTGG - Intronic
938071997 2:128313619-128313641 TCCTCCCTCCTGGGCCCTGGAGG + Intronic
938322825 2:130376584-130376606 GCCTCTCTCCTGGCCCCTGGTGG - Intergenic
938735973 2:134187041-134187063 TCCTGCCTCAAGGCCCCTGCAGG - Intronic
942047263 2:172106980-172107002 TCCTCTCGCCAGGTCCATGCAGG - Intergenic
944913146 2:204329572-204329594 TCCTCCTGCCAGTCCAGTGGAGG - Intergenic
947617921 2:231570109-231570131 GCCACCCTCCAGGCCTCTGGGGG + Intergenic
947972196 2:234333649-234333671 TCCTGACGCCAGACCCCAGGAGG - Intergenic
948159523 2:235812703-235812725 TCCTCTCTCCATGCCCCTGAAGG - Intronic
948438078 2:237967251-237967273 TCCTCACGCCGGGGGCCTGGCGG + Intronic
948514996 2:238498239-238498261 CCCTCCCGCGTGGCCCCTTGAGG - Intergenic
948899117 2:240947273-240947295 TGCTCCCTCCTGGGCCCTGGGGG + Intronic
1170571535 20:17635494-17635516 TCCTCGCTCCAGGGCCCTTGGGG + Intronic
1170588161 20:17750891-17750913 TTGTCCACCCAGGCCCCTGGGGG + Intergenic
1171232730 20:23500494-23500516 CCATTCCACCAGGCCCCTGGGGG - Intergenic
1172326685 20:34041258-34041280 CACTCCTGCCAGGTCCCTGGAGG - Intronic
1172614675 20:36275325-36275347 GCCTCCCTGCTGGCCCCTGGTGG - Intergenic
1173665913 20:44762725-44762747 TCCTTCCTCCAGCCCCCAGGAGG - Intronic
1173728215 20:45311616-45311638 CCCTCCAGCCAGGCCCCGAGAGG - Exonic
1174452106 20:50626626-50626648 TCCTCCTGCCAGGCCTGTGGGGG - Intronic
1174737978 20:52983925-52983947 TCATCCCCTCAGGCCCCAGGCGG + Intronic
1176099060 20:63356734-63356756 TGCTCCCTCCCGGCCCTTGGGGG + Intronic
1178027412 21:28483783-28483805 TCCTGACCTCAGGCCCCTGGAGG - Intergenic
1178453822 21:32728372-32728394 CTCTCCCGTCAGGCCCGTGGGGG - Intergenic
1179485289 21:41706105-41706127 TCCTGCAGCCAGGCCCCTAGAGG - Intergenic
1179655309 21:42841337-42841359 TCCCCATGCCAGGCTCCTGGAGG + Intergenic
1179714202 21:43279490-43279512 TCCTCACGCCAGCACACTGGGGG + Intergenic
1180188076 21:46150274-46150296 TTCTCCAGCCAGCCCCCAGGGGG - Intronic
1180869586 22:19138612-19138634 TGCTGACGCCAGGCCCCTGCAGG + Intronic
1182272750 22:29165811-29165833 TCCTCCTGCCGGGTCCCTAGGGG + Intronic
1182873987 22:33674257-33674279 TCCCTCCCCCAAGCCCCTGGTGG + Intronic
1183508682 22:38222851-38222873 CCCCCCTGCCAGGCCCCAGGAGG - Intronic
1183579847 22:38717455-38717477 TCCTCCTCCCAGGCTCCAGGAGG - Intronic
1184496904 22:44847207-44847229 CCCTCTGGCCAGGCCCCTGCTGG - Intronic
1184664720 22:45982199-45982221 TCCCTCCGCCAGGCCCATGGTGG + Intergenic
1185153403 22:49179347-49179369 TCCTCCCGCCAGGCCCTCGGCGG + Intergenic
950425937 3:12924783-12924805 GCCACCAGCCAGGCACCTGGAGG + Intronic
951709567 3:25574614-25574636 ACCTCCCGCCAGGCCCCACCTGG - Intronic
954693224 3:52406892-52406914 TCCTCCCCCCAGGGCCCTAGTGG + Exonic
954799260 3:53177761-53177783 TCCTCCTACCTGGGCCCTGGTGG - Intronic
960954366 3:123021340-123021362 TCTTCCCTCAAGGCGCCTGGGGG - Intronic
961719722 3:128885251-128885273 TCCTCCAGCCAGGGCCTTGGTGG + Intronic
962351494 3:134659795-134659817 TCCTCCCGCCAGGCCCCTGGGGG - Intronic
962444581 3:135453136-135453158 TCTTGCCGGCAGGCCCATGGAGG + Intergenic
962808478 3:138943255-138943277 TCCTACCGCCTGACCACTGGAGG + Intergenic
963503959 3:146161467-146161489 CCCTCCCGCCAGACTCCCGGCGG - Intronic
964719554 3:159757596-159757618 CTCACCCGCCTGGCCCCTGGAGG + Intronic
965292368 3:166899744-166899766 TCTTCTGGCCAGGCCCATGGAGG + Intergenic
966887933 3:184386947-184386969 TCCTCCCTCCACTCCCCTGCGGG - Intronic
968509756 4:990385-990407 GGCTCCCGCCAGGCGCCTGCTGG - Intronic
968704083 4:2069987-2070009 CCCTCCAGCCAGGACCCTGAAGG + Intergenic
968800891 4:2742748-2742770 TCCACCCCCCAGCCCCTTGGTGG + Intronic
969898895 4:10330181-10330203 TGGGCCTGCCAGGCCCCTGGGGG + Intergenic
971078033 4:23173017-23173039 ACTTCCCACCAGGCCCCTGTGGG + Intergenic
972957978 4:44415890-44415912 TCCACCTGACAGTCCCCTGGTGG - Intronic
974811752 4:66954810-66954832 TCCCCCCCCCATGCCTCTGGTGG - Intergenic
978761634 4:112359652-112359674 TCCTCCCCCAAGGCCCCTGCTGG - Intronic
978767425 4:112418545-112418567 TCCTCTGGCCAGGCCACTGCGGG - Intronic
982235752 4:153249620-153249642 TGCTCCCGCCCCGGCCCTGGGGG + Intronic
985676017 5:1231801-1231823 TGATTCCGCCAGGCCCCTGCAGG + Intronic
985757715 5:1729100-1729122 TCCTCCCTCCCGGCCTCCGGCGG - Intergenic
985977078 5:3428557-3428579 TCCTCGCTCCAGCCGCCTGGTGG + Intergenic
990051334 5:51505371-51505393 ACCTCCCACCAGGTTCCTGGGGG + Intergenic
992104450 5:73437787-73437809 TCCTTCGGCCAGGGGCCTGGCGG - Intergenic
997872813 5:137520180-137520202 TTCTCCCTCCAGGCCACAGGAGG + Intronic
998184582 5:139968558-139968580 TCCTCCTTCCAGTCCCCTGCAGG - Intronic
999133126 5:149299643-149299665 TCCTCCAGGCAGGCTGCTGGCGG - Intronic
999443716 5:151622207-151622229 TCCTCCCGCCATGCCCCTTGAGG + Intergenic
1002046218 5:176543135-176543157 TCTTCCCGCCAGGCCTCTGCCGG - Intronic
1002980109 6:2127725-2127747 TCCTTTCCCCAGGCCCCTGGGGG + Intronic
1003423833 6:5983268-5983290 TCCTCCCGTCAGCTTCCTGGGGG + Intergenic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1005940512 6:30556399-30556421 TCCTCTCGCCTCGCTCCTGGAGG - Exonic
1005989264 6:30893104-30893126 CCTTCCCGCCAGCCCCCTGGTGG + Exonic
1006263379 6:32895166-32895188 TCCTCCGGGCCGGCCCGTGGAGG + Intergenic
1007227818 6:40327259-40327281 TCCTCATGCCTGGCCCCTTGTGG - Intergenic
1007363822 6:41376088-41376110 GGCTCGCGCCAGGCTCCTGGCGG + Intergenic
1007596391 6:43053631-43053653 GCCTCGCGCCAGGACCCCGGTGG - Intronic
1007704288 6:43781467-43781489 TCCCCAGGCCAGGCCGCTGGTGG - Intronic
1015255036 6:131169587-131169609 CCCTCCACCCAGTCCCCTGGAGG + Intronic
1015372004 6:132464872-132464894 TTCCACCTCCAGGCCCCTGGAGG - Intronic
1015440422 6:133241224-133241246 GCCTCCCCCGAGGCCCCCGGCGG + Intronic
1015770429 6:136762801-136762823 TCCTCCTCCCAGTCTCCTGGAGG + Intronic
1015965387 6:138692398-138692420 TGCTCCCGCCCGCCCCCTGGCGG - Intronic
1017548112 6:155473128-155473150 TGCTTCTGCCAAGCCCCTGGAGG - Intergenic
1018906990 6:168081229-168081251 ACCTCCCGCCAGGGCACTGAGGG + Intronic
1019189822 6:170245449-170245471 TCCTCCTGCCAGGCCCTCGCAGG + Intergenic
1019292981 7:259261-259283 TCCTCCTGCCGGGCCCCTCTGGG + Intronic
1019452606 7:1107702-1107724 TCTTCCCTGCAGGCCACTGGTGG - Intronic
1019509621 7:1411251-1411273 CCCTCCCCACAGCCCCCTGGGGG + Intergenic
1019519280 7:1453419-1453441 TCCTCCCTCCTGCCCCCAGGAGG + Intronic
1020761186 7:12269685-12269707 CCCTGCCGCCAGGCCCCTTCTGG + Intergenic
1021916454 7:25438184-25438206 TCCTCCCCCCAGCCCCCAAGAGG + Intergenic
1022838610 7:34140961-34140983 TCCTCTCTCCTGGCCCATGGGGG - Intronic
1024059886 7:45689959-45689981 TGCTCCCTCCAGGCCCCCTGTGG + Intronic
1029656214 7:101926465-101926487 TCTTCCCTACAGGCCCCTGCTGG - Intronic
1034278966 7:149838557-149838579 TCCTCAGGCCAGGCCGCGGGGGG + Exonic
1035017942 7:155782624-155782646 GCCACCCGGCAGGACCCTGGGGG + Intergenic
1035179450 7:157078470-157078492 TCCTCCTCCCAGGCCCGCGGCGG + Intergenic
1035181131 7:157090468-157090490 TCCTCCAGCCAGGGCCCTGCAGG - Intergenic
1035395127 7:158529737-158529759 TGCTCCCGCCTGGCCCCTTCTGG - Intronic
1035476856 7:159149875-159149897 TCCTCCCACCAGGCCCCACCCGG - Intergenic
1035529254 8:338010-338032 TCCTCACGCCATCACCCTGGGGG - Intergenic
1035702132 8:1644182-1644204 AAGTCCTGCCAGGCCCCTGGAGG - Intronic
1036024353 8:4888294-4888316 TCCTCACATCAAGCCCCTGGAGG + Intronic
1036205846 8:6805332-6805354 TTCTCCTGCCAGGTCCCTGGGGG + Intergenic
1036562145 8:9906575-9906597 TCCTCCCGCCAGGGCCGAGGAGG - Intergenic
1036623761 8:10447284-10447306 TCGTCCCTCCTGTCCCCTGGGGG + Intergenic
1037571862 8:20164827-20164849 TCCTCCTGCCAGGCCCTGAGCGG + Intronic
1037813094 8:22098166-22098188 TGCTCCTGCCAGGCCCCAGCTGG + Exonic
1037821573 8:22137634-22137656 TCCTTCTTCCAGGCTCCTGGAGG + Intergenic
1038064915 8:23953916-23953938 CCCTCCTCCCAGGGCCCTGGTGG - Intergenic
1039885103 8:41650058-41650080 GGCACCCGCCAGGCCCCGGGGGG - Intronic
1040542587 8:48373166-48373188 TGCTTCCGGCAAGCCCCTGGAGG + Intergenic
1042216026 8:66430076-66430098 TCTTGCCCCCAGGCCCCTGCCGG - Exonic
1044924609 8:97199608-97199630 TCCTCCAGTCAGTCCCCAGGTGG - Intergenic
1045419246 8:101998066-101998088 CCATCCCTCCAGGCCCCTTGAGG + Intronic
1047782770 8:128123385-128123407 TCCCCAGGCCAGGCCCCGGGAGG + Intergenic
1049174990 8:141186792-141186814 TCATCCCTCCAGGCCCCCAGCGG + Intronic
1049388978 8:142358480-142358502 TGCTCCGGCCAGGCACATGGAGG + Intronic
1049427063 8:142542414-142542436 CCCTCCCGCCAGCCCCCCAGCGG + Exonic
1049805205 8:144535681-144535703 TCCTGTCCCCAGGCCCCTGGTGG + Intronic
1053414962 9:37941655-37941677 TTCCCCAGCCAGGCCCCTGCAGG - Intronic
1056789834 9:89618245-89618267 CCCTCCTTCCAGGCACCTGGGGG - Intergenic
1056951453 9:91043552-91043574 CCTTCCAGCCATGCCCCTGGTGG + Intergenic
1057368915 9:94451951-94451973 TCCCCATCCCAGGCCCCTGGGGG + Intronic
1057933600 9:99218012-99218034 TCTTCCAGCCAGGCCCATGGTGG + Exonic
1059119207 9:111627036-111627058 GCCTCTCCCCAGGCTCCTGGTGG + Intergenic
1059426128 9:114222132-114222154 TCCTCCACACAGGCACCTGGTGG - Intronic
1060508411 9:124215238-124215260 TCCTCCCCCCCAGTCCCTGGGGG + Intergenic
1060941481 9:127545400-127545422 AGCTCCCGCCAGGCCCAGGGGGG + Intronic
1061225398 9:129278344-129278366 TCCTCTCCGCAAGCCCCTGGGGG - Intergenic
1061278430 9:129583178-129583200 TCCACCTGTCAGGCCCCTGCAGG - Intergenic
1061502918 9:131013959-131013981 TCCTCCCTCCTGCTCCCTGGGGG + Intronic
1061928648 9:133820761-133820783 TCCTCCAGCCCAGCCCCTGAGGG - Intronic
1062036758 9:134385903-134385925 TCCTCTGCCCAGGCCCCTGCTGG + Intronic
1062042364 9:134409977-134409999 TCCTCCCCGCCAGCCCCTGGTGG + Intronic
1062176120 9:135164059-135164081 TCCTGCCGCCGGGACCTTGGGGG + Intergenic
1062395583 9:136351332-136351354 TCCTCCCTCCAGGCCCAGGGAGG - Intronic
1203769175 EBV:40343-40365 CACCCCCGCCGGGCCCCTGGTGG - Intergenic
1186483366 X:9913092-9913114 TCCTCCAGCCAGCTCCCTCGGGG - Intronic
1187504912 X:19871689-19871711 TCATCCAGCCTGGCTCCTGGGGG + Intronic
1192498744 X:71634595-71634617 TCCTCCTTCCAGGCCTGTGGCGG - Intergenic
1194024913 X:88739392-88739414 TCCACTAGCCAGGGCCCTGGTGG + Intergenic
1199627388 X:149753002-149753024 AAGTCCCGGCAGGCCCCTGGAGG - Intergenic
1199735390 X:150681180-150681202 TGCTTCCACCAGGCACCTGGGGG - Intergenic