ID: 962352011

View in Genome Browser
Species Human (GRCh38)
Location 3:134663305-134663327
Sequence GTATTCACAAATGTTTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962352011 Original CRISPR GTATTCACAAATGTTTAGGT AGG Intronic
901611343 1:10500874-10500896 TTCTTCAGAAATGTTTTGGTGGG - Intronic
901915228 1:12494297-12494319 GTATTCTCTGATGTTTTGGTGGG + Intronic
903302847 1:22391367-22391389 GTATGGAGAAATGTTTAGTTTGG - Intergenic
906751488 1:48266651-48266673 GTATTTTCAAGTGTTTATGTTGG - Intergenic
906835988 1:49083814-49083836 GTATTCACAAAGGTATAATTTGG - Intronic
908118752 1:60965956-60965978 GTATTCACAAATATATTGTTTGG - Intronic
911711350 1:101077376-101077398 GTATGCATAAATGTTCATGTGGG + Intergenic
913973026 1:143430479-143430501 ATTCTCACAAATGTTTAAGTTGG - Intergenic
914067410 1:144256086-144256108 ATTCTCACAAATGTTTAAGTTGG - Intergenic
914111743 1:144710268-144710290 ATTCTCACAAATGTTTAAGTTGG + Intergenic
917047879 1:170883381-170883403 GGATTCACAATTGCTGAGGTAGG - Intergenic
917106441 1:171497085-171497107 CTATTAACAAATGTATTGGTGGG - Intronic
917484287 1:175441455-175441477 TTATTAACAAATATTTAAGTTGG - Intronic
917924514 1:179778162-179778184 ATATTCACAACTGTTAAGATGGG - Intronic
919238443 1:194877903-194877925 TCATTCACAAATGTTTAATTTGG + Intergenic
921300244 1:213745036-213745058 GTGTTCACATCTGTGTAGGTAGG - Intergenic
923316244 1:232783306-232783328 GTATTCATAAAAGTTTTGATAGG + Intergenic
1063775014 10:9253084-9253106 ATACTCAGAAATGTTTAGATTGG + Intergenic
1064953137 10:20877007-20877029 ATGTTAAGAAATGTTTAGGTCGG - Intronic
1065352827 10:24811002-24811024 GTCTTGGCAACTGTTTAGGTGGG - Intergenic
1066747117 10:38611823-38611845 ATTGTCACAAATGTTTAAGTTGG + Intergenic
1070560508 10:77563332-77563354 GAATTCTCAAATGTTTAAGCAGG + Intronic
1073568169 10:104553470-104553492 GTATTCAAAAATGTTTTGAGTGG + Intergenic
1073630781 10:105146560-105146582 TGAATCACAAATGTTTAGCTTGG - Intronic
1074140017 10:110663895-110663917 GTATACTCATATGTTTATGTGGG - Intronic
1074176496 10:111010215-111010237 GTATTCCCAAATGTTAATATTGG - Intronic
1074296614 10:112195167-112195189 GCATTTTCAAATGTTTAGGCTGG - Intronic
1074377806 10:112952787-112952809 GTATTAACAAATGTCAGGGTTGG - Intronic
1075202080 10:120412818-120412840 TTAGACACAAATGTTGAGGTTGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079477366 11:20845247-20845269 GTAATCACAAATATATAGCTAGG - Intronic
1081816628 11:45947863-45947885 GTACTCAAAAATATTTAGATGGG - Intronic
1089880793 11:121771651-121771673 CTATTCACAAATGTGTTGGAAGG + Intergenic
1092807613 12:12240009-12240031 GTGTTCTCAAATGTTAATGTAGG - Intronic
1093670518 12:21869108-21869130 TTCTTCAAAAATGTTTAAGTTGG - Intronic
1094262498 12:28517213-28517235 TTTTTCCCAAATGTTTAGTTTGG + Intronic
1094808559 12:34115035-34115057 ATTGTCACAAATGTTTAAGTTGG + Intergenic
1095641135 12:44486294-44486316 GTATTCATAAATGTAGGGGTTGG + Intergenic
1095744770 12:45645348-45645370 GTAGTTGCAAATGTTTAGTTGGG - Intergenic
1098181726 12:67854325-67854347 GTCTTCAAAAAGGATTAGGTAGG + Intergenic
1099285682 12:80711623-80711645 ATATTCACACATGTTTTGGTTGG - Intergenic
1101605158 12:106242862-106242884 CTCTTCACAAATGGTTAGGAAGG + Intronic
1104016609 12:124965975-124965997 ATAGTCCCCAATGTTTAGGTGGG - Intronic
1105361202 13:19718124-19718146 GCATTCACTATTGATTAGGTTGG - Intronic
1109470423 13:62797539-62797561 GTATTCCAAAAAGTTTTGGTTGG + Intergenic
1110886926 13:80651015-80651037 GTTTTCACAATTATTTTGGTAGG - Intergenic
1111002416 13:82203143-82203165 GAACTCACAAACATTTAGGTTGG + Intergenic
1111270269 13:85872854-85872876 GCATTTAAAAATGTTTAGGATGG - Intergenic
1111441264 13:88285269-88285291 GTATTCACAAATATATAATTTGG + Intergenic
1111691542 13:91569265-91569287 TTTTTCATAAATGTTTAGATAGG - Intronic
1112327517 13:98452188-98452210 GCATTCAGACATTTTTAGGTGGG + Exonic
1113617380 13:111690363-111690385 GTATGCACAAGTGTTTGTGTGGG - Intergenic
1113622909 13:111775633-111775655 GTATGCACAAGTGTTTGTGTGGG - Intergenic
1114030771 14:18577976-18577998 ATTGTCACAAATGTTTAAGTTGG - Intergenic
1115514525 14:34172498-34172520 GTATTCATTAATGATTAGGTTGG + Intronic
1116739629 14:48737991-48738013 GTATTCAGAAGTGATTAGGGTGG - Intergenic
1125998219 15:44184358-44184380 GTTTTCAGGAATCTTTAGGTTGG + Intronic
1126514510 15:49519950-49519972 GTATTCACAAATATATGGTTTGG - Intronic
1126588371 15:50313763-50313785 ATATTAACAATTGTTTAGGATGG + Intronic
1129969561 15:79766252-79766274 GTATCCACAAATCTTAAGGGTGG + Intergenic
1130344145 15:83026322-83026344 GATTTCACAAAGGTTTAGGGGGG + Intronic
1136735949 16:32467821-32467843 ATTGTCACAAATGTTTAAGTTGG - Intergenic
1137258561 16:46800451-46800473 GTATTCCAAAATGTTTTTGTGGG - Intronic
1137999850 16:53265707-53265729 CTTTTCACAAATATTTGGGTGGG + Intronic
1141922089 16:87143124-87143146 GCATTTACAAATGTTTGGGCAGG - Intronic
1203017126 16_KI270728v1_random:361753-361775 ATTGTCACAAATGTTTAAGTTGG + Intergenic
1203035461 16_KI270728v1_random:634911-634933 ATTGTCACAAATGTTTAAGTTGG + Intergenic
1143833908 17:9674693-9674715 CTATTCACAATAGTTAAGGTGGG - Intronic
1143989020 17:10940978-10941000 GTATTGACAAAGGTTTATGTTGG - Intergenic
1144280741 17:13723970-13723992 ATATTCAAAAATGTTTAGGCAGG + Intergenic
1145015949 17:19398346-19398368 GTATTTACAAATGTGTACCTGGG + Intergenic
1146532127 17:33617056-33617078 GTATTCACAAATGTTAGGTTAGG - Intronic
1149090736 17:52775337-52775359 CTATTCACAAATGAATAGATTGG - Intergenic
1153377347 18:4395675-4395697 GTATTCAAAAATCATTAGGTTGG - Intronic
1153730455 18:8006228-8006250 GTATTTATAAATGTTTACTTGGG - Intronic
1154424507 18:14261778-14261800 GTAATCAGAAATGTTTAAATTGG + Intergenic
1158079248 18:53568811-53568833 TTATTCACAAATATTCTGGTGGG + Intergenic
1158124011 18:54082342-54082364 GTATTCACAAAGATATAGTTTGG + Intergenic
1159242793 18:65764384-65764406 GTATTTACATAAGCTTAGGTAGG - Intronic
1159541257 18:69780050-69780072 GTTTTCTCAAATGTGAAGGTAGG - Intronic
1167812744 19:51848710-51848732 GTATTGACAAATGTCTGGGTGGG - Intergenic
925711609 2:6746570-6746592 GAATTCACAGATGGTCAGGTGGG + Intergenic
925796005 2:7543478-7543500 GTGTTTACAAATGTTTTGTTGGG - Intergenic
927583438 2:24276820-24276842 GGATTCACATATGTTGAAGTGGG + Intronic
927765841 2:25807411-25807433 TTATTCACCAATGTTTTGGGGGG - Intronic
928041025 2:27877835-27877857 GTATTCACAAATGTTGATGATGG - Intronic
928606514 2:32948346-32948368 GTATTGATAAAAGTTTTGGTTGG + Intronic
929169268 2:38915208-38915230 GTAGTTACAAAATTTTAGGTAGG + Intronic
929786679 2:44998548-44998570 ATATTCACAATTATATAGGTAGG - Intergenic
933508183 2:83204769-83204791 GTATTCACAAATATATGGTTTGG - Intergenic
934177722 2:89591435-89591457 ATTCTCACAAATGTTTAAGTTGG - Intergenic
934187118 2:89756930-89756952 ATTGTCACAAATGTTTAAGTTGG - Intergenic
934288021 2:91665736-91665758 ATTCTCACAAATGTTTAAGTTGG - Intergenic
934309517 2:91850994-91851016 ATTGTCACAAATGTTTAAGTTGG + Intergenic
934536393 2:95137851-95137873 GTAATCACTAATGTTGAGGTTGG + Intronic
934974968 2:98795370-98795392 GTATTTAAAAATTTTTAGGCCGG - Intronic
936174401 2:110206739-110206761 ATATTCACACATATTTAGGGGGG - Intergenic
936499618 2:113055626-113055648 GTATTCACAAATATATGGTTTGG - Intergenic
936939525 2:117870059-117870081 GAATTCAAAAATGTATAGGCTGG - Intergenic
937171943 2:119881075-119881097 GTATTGACAAATCTTTGAGTGGG + Intronic
937810079 2:126189445-126189467 CTCTTCACAAATTTTTATGTGGG - Intergenic
938497434 2:131807791-131807813 ATTGTCACAAATGTTTAAGTTGG + Intergenic
941294120 2:163714876-163714898 GTATGCATAAATGTTTAATTTGG - Intronic
944403250 2:199352883-199352905 GTTTTCAGAAATGTTTTGTTTGG - Intronic
945250351 2:207760709-207760731 GTTTTAACAAATGTTAACGTTGG + Intronic
946483336 2:220077351-220077373 GTTTTCACAAAGGCTTAGGTCGG + Intergenic
947020331 2:225667425-225667447 GGATTAACAAATGTTGAGGTGGG + Intergenic
947975615 2:234363182-234363204 GCATTCACAAATGTTAAGCAGGG - Intergenic
1171046265 20:21811274-21811296 GTGTTCACAAAGGCTTAAGTTGG - Intergenic
1171449953 20:25228542-25228564 GTATTTAAAAATGTTAAGGTAGG - Intergenic
1174327118 20:49788200-49788222 GTATACACATATGTTGAGATGGG - Intergenic
1177084457 21:16685604-16685626 TTGTTAAGAAATGTTTAGGTGGG - Intergenic
1177122777 21:17158450-17158472 GTATTTACAAATGCTTTTGTGGG - Intergenic
1180454885 22:15505032-15505054 ATTGTCACAAATGTTTAAGTTGG - Intergenic
1180536612 22:16398131-16398153 ATTGTCACAAATGTTTAAGTTGG + Intergenic
1182224853 22:28789564-28789586 GTATTCAAAAATGTTAAAATGGG + Intergenic
1182844974 22:33422891-33422913 GTAATCCCCAGTGTTTAGGTGGG - Intronic
1184624076 22:45708932-45708954 GGATTAATAAAAGTTTAGGTGGG - Intronic
950894144 3:16432747-16432769 GAATTCACACATGTTTTGGTAGG - Intronic
951944119 3:28114882-28114904 TTGTTCACAAATGTATGGGTTGG + Intergenic
952311784 3:32197162-32197184 GTATTAAGAAATATTTAGGCTGG + Intergenic
953951191 3:47191548-47191570 GTATTCACAGATATTTAAGAAGG + Intergenic
954860005 3:53679970-53679992 GTATATATAAATGTTTAGCTAGG - Intronic
955314634 3:57926159-57926181 ATATTAACAACTGGTTAGGTTGG - Intronic
956391878 3:68782430-68782452 TTATACACAAATGTTTATGGAGG + Intronic
957173183 3:76766209-76766231 GTGTACGCAAATTTTTAGGTTGG - Intronic
957909845 3:86606982-86607004 GTAATCCCCAATGTTCAGGTGGG - Intergenic
958445616 3:94211081-94211103 GTAATCACAAATATTGAGATGGG + Intergenic
960743237 3:120857498-120857520 CTATTCACAAAGGTCTGGGTGGG - Intergenic
962352011 3:134663305-134663327 GTATTCACAAATGTTTAGGTAGG + Intronic
965213323 3:165825407-165825429 GTCTTCACAAATGTTGGTGTAGG + Intronic
965308999 3:167105061-167105083 GTATTTACAAAAATTTTGGTAGG - Intergenic
965878568 3:173359784-173359806 ATATTCACAAATGTTTTGGGAGG - Intergenic
967739757 3:192992058-192992080 GTCTTCACAATTGATTAAGTTGG + Intergenic
969892660 4:10274169-10274191 GTAATCACAAATTTTAAAGTTGG + Intergenic
970980284 4:22088147-22088169 ATATTCACATATGTTTAATTAGG - Intergenic
973236098 4:47907546-47907568 CAATTCACTAATGTTAAGGTGGG + Intronic
975796494 4:78011941-78011963 GTATTCACAAATATATGGTTTGG + Intergenic
975824059 4:78301259-78301281 GTATTAACAAAAGCATAGGTAGG + Intronic
976021256 4:80629940-80629962 GTATTCAGAAAAGTTTCAGTTGG - Intronic
976504399 4:85830452-85830474 GTATAAACAATTGTTGAGGTAGG - Intronic
976904108 4:90215128-90215150 TTATTTAAAAATGATTAGGTAGG + Intronic
977724450 4:100278993-100279015 TTATTCACAAATGTTGGGGTTGG + Intergenic
977798468 4:101196871-101196893 GTACTCACAAATGTAGAGGAAGG - Intronic
978479977 4:109177731-109177753 TTATTCAAAAATGTTTTTGTTGG - Intronic
979764460 4:124447256-124447278 GTATTCACAAATATATGGTTTGG - Intergenic
988475535 5:31581851-31581873 GTCTTGACAAATCTTTAAGTTGG + Intergenic
988780693 5:34518957-34518979 GTAAACACAAATGTTTTGGCTGG - Intergenic
989080150 5:37609992-37610014 GTATTCACAGATATATAGATTGG + Intronic
992810192 5:80379456-80379478 GCATTCAGACATTTTTAGGTGGG + Intergenic
993774044 5:91969014-91969036 ATAATCACAAATGTTTTGGTGGG + Intergenic
994777010 5:104048099-104048121 GTAATCTGAAATGTTTATGTAGG - Intergenic
995174820 5:109163737-109163759 TTATTCAAAAATTTTTAGGCCGG - Intronic
995691021 5:114825766-114825788 GTATTCACAAATATATGGTTTGG - Intergenic
997823990 5:137090311-137090333 GTATTCACAGATGTGTCTGTTGG - Intronic
997836875 5:137201617-137201639 GTATTTTCAAATGTTAACGTTGG - Intronic
999096755 5:148985657-148985679 CTATACACAAATGTTTAGAGTGG - Intronic
1001324104 5:170707634-170707656 GTCAGCACAAATGTTGAGGTGGG - Intronic
1007999315 6:46341983-46342005 ATATTCACAACTGCTTAGATTGG + Intronic
1008118896 6:47587398-47587420 ATTTTCTCAAATGTTTAGATAGG + Intronic
1008336376 6:50309437-50309459 GGAATTACAAATGTTAAGGTTGG - Intergenic
1009564588 6:65296436-65296458 GTATTCATATATTATTAGGTTGG + Intronic
1009983498 6:70754355-70754377 GAATTCACAGATTTTTAGGGAGG + Intronic
1010630265 6:78190170-78190192 GTATTCACAAATATATGGTTTGG - Intergenic
1011875196 6:91950818-91950840 GTATTTCCCAATGTTTAAGTAGG - Intergenic
1012582202 6:100882427-100882449 GTATTCACACATGCTAAGGTAGG - Intergenic
1013078316 6:106790495-106790517 CTGTTCACAAATGTTATGGTGGG - Intergenic
1013572404 6:111442115-111442137 GTATTCTGAAATTATTAGGTAGG + Intronic
1014270992 6:119335900-119335922 GAAGTCACAAATGTTTAGCTTGG - Intronic
1014872024 6:126608692-126608714 GTATTCACAATAGTTAAGATAGG - Intergenic
1014879371 6:126703847-126703869 TTATTCCAAAATGTTTTGGTTGG + Intergenic
1015206892 6:130650387-130650409 GTAATTACAAAGGTATAGGTGGG - Intergenic
1015351489 6:132225162-132225184 GTATTCACAAATATATGGATTGG + Intergenic
1022053873 7:26708532-26708554 CTTTTGAAAAATGTTTAGGTGGG - Intronic
1022143765 7:27516221-27516243 GTATCCACAAGTGTTTATGGAGG - Intergenic
1025595319 7:62916264-62916286 GAATTCACAAAGTTTTATGTGGG + Intergenic
1027530923 7:79331436-79331458 ATATTCCCAAATGTCTACGTTGG - Intronic
1027849618 7:83432839-83432861 GTATTGATCAATGTTTATGTTGG - Intronic
1028301505 7:89206432-89206454 GTATTCACAAATACATAGTTTGG - Intronic
1030226521 7:107157307-107157329 GGACTGTCAAATGTTTAGGTAGG + Exonic
1031132433 7:117848115-117848137 GTATTCAAATATGGTTAGGCAGG - Intronic
1031177908 7:118375806-118375828 CTACTCACAAATGCTGAGGTGGG - Intergenic
1036664018 8:10727055-10727077 GAATACACAAATGTTTAGAATGG - Intronic
1039391544 8:37184897-37184919 GTGTGCATAAATGTTTGGGTAGG - Intergenic
1040018087 8:42716596-42716618 TTATGCAGAAATGTCTAGGTGGG + Intronic
1041300373 8:56405159-56405181 GTAGTGCCAAATCTTTAGGTGGG + Intergenic
1042166859 8:65954257-65954279 CTATCAACAAATGTTTAGGAAGG + Intergenic
1042393439 8:68263171-68263193 GCATTCAGAAATTTTTAGGAAGG + Intergenic
1044188377 8:89283456-89283478 GTATTCACAAAGATGTAGTTTGG + Intergenic
1044922603 8:97181704-97181726 GTCTTTACAAATATTTAAGTTGG + Intergenic
1046586272 8:116151874-116151896 GAACTCACAAATGTTTCTGTGGG + Intergenic
1047321210 8:123785450-123785472 GTCTTCATAAATGTATAGGAGGG - Intronic
1048912258 8:139147172-139147194 CTATTCACAACTGCTCAGGTGGG + Intergenic
1050116282 9:2266797-2266819 GTATTCACACAAATCTAGGTAGG - Intergenic
1050940460 9:11451473-11451495 GTATTCACAAAGATATAGTTTGG + Intergenic
1052682535 9:31712056-31712078 GTATACACACATATTTATGTAGG - Intergenic
1055051894 9:71989700-71989722 GTATTGAAAAATTTTTATGTAGG - Intergenic
1056297966 9:85211952-85211974 GTTTTCACAGATCTTTAGGGAGG - Intergenic
1056480845 9:87004211-87004233 GTGTTCATAGATGTTTATGTTGG + Intergenic
1060134528 9:121139725-121139747 ATGTTGACAACTGTTTAGGTTGG - Intronic
1060294440 9:122333636-122333658 CTATTCAAAAATGTTCAGGGAGG + Intergenic
1185744260 X:2559179-2559201 GTGTTGACAAATGTTTGGATGGG - Intergenic
1186256138 X:7722236-7722258 TTATTTAAAAATGTTTATGTAGG - Intergenic
1187598346 X:20799728-20799750 GTATTCACAAAGATATAGTTTGG + Intergenic
1187754612 X:22508914-22508936 GTATTCACAAAAGGTGGGGTGGG - Intergenic
1188124568 X:26351787-26351809 GTATTCACAAATATATGGTTTGG - Intergenic
1188386574 X:29567318-29567340 TTCTTAACAATTGTTTAGGTAGG - Intronic
1189236828 X:39493580-39493602 ATACTCACAAATGTGGAGGTTGG - Intergenic
1191602753 X:63027457-63027479 GTATTCACAAATATATGGTTTGG - Intergenic
1191688604 X:63917763-63917785 GTATTCACCAATGTTCTTGTGGG + Intergenic
1193943983 X:87709376-87709398 GTATTCACAAAGATATAGTTTGG - Intergenic
1194906920 X:99589060-99589082 GCATTCACAAAAATTTGGGTCGG + Intergenic
1196012684 X:110905201-110905223 GCATTCACAAATATATAGTTTGG - Intergenic
1197163264 X:123347238-123347260 TAATTCACAAATGTTTGGTTTGG - Intronic
1199379825 X:147157305-147157327 CTATTCCAAAATGTTGAGGTGGG + Intergenic
1200568645 Y:4801155-4801177 GTATTTAAAAATGTATTGGTAGG - Intergenic
1201782551 Y:17739596-17739618 ACATGCACAAATGTTTAGATTGG - Intergenic
1201819002 Y:18166392-18166414 ACATGCACAAATGTTTAGATTGG + Intergenic