ID: 962353508

View in Genome Browser
Species Human (GRCh38)
Location 3:134673617-134673639
Sequence CAGGGTACACAAAAGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962353508_962353513 4 Left 962353508 3:134673617-134673639 CCTTTGTCCTTTTGTGTACCCTG 0: 1
1: 0
2: 0
3: 20
4: 245
Right 962353513 3:134673644-134673666 GTCTCATCTCCATTCTTCTCTGG 0: 1
1: 0
2: 2
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962353508 Original CRISPR CAGGGTACACAAAAGGACAA AGG (reversed) Intronic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902185372 1:14720982-14721004 CAGGGTACAAACAAGGGCAGGGG - Intronic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904978933 1:34480146-34480168 GAGGGGGAACAAAAGGACAAGGG + Intergenic
905133897 1:35783007-35783029 CAAGGGAGACCAAAGGACAATGG - Intergenic
905320192 1:37110617-37110639 CATGATACACAAGAGGACCATGG - Intergenic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
907084478 1:51657292-51657314 TAGGGTACATAAAAGGAGAATGG + Intronic
908958788 1:69670234-69670256 CAAGGTATTCAAAAGGACATGGG + Intronic
910507214 1:87963198-87963220 TAGGTTTCACAAATGGACAATGG - Intergenic
912651969 1:111448357-111448379 CAGGTTACACAGAAGAAAAATGG + Intronic
913483649 1:119314216-119314238 CAGGGTACCGAAAAGAAGAAGGG + Intergenic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
924132161 1:240921581-240921603 CAGGGTACAAAAAAAGTCAGCGG + Intronic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1065047853 10:21759862-21759884 CAGAGTAGAGAAAGGGACAAAGG - Intronic
1067789341 10:49276030-49276052 CAGTGTACGGTAAAGGACAAGGG + Intergenic
1068067224 10:52147202-52147224 AAGGGTAGACAAAAGAAAAATGG + Intronic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1072090498 10:92122209-92122231 CAGGGAACACCAAAGAGCAAAGG + Intronic
1073206886 10:101774371-101774393 CAGGGCCCACAAAAGGAGAGTGG - Intronic
1074273839 10:111982256-111982278 CAGTGTCTACAACAGGACAAAGG + Intergenic
1076031649 10:127164125-127164147 CAGGGAAGACAAAGGGCCAAGGG - Intronic
1080695937 11:34603043-34603065 CAGGGAAGACAAGAGGAGAAGGG - Intergenic
1082714834 11:56599644-56599666 CATTCTACACAAAAGGACATTGG + Intergenic
1085163270 11:74369278-74369300 CAGTGTACAAAAATGGATAATGG + Intronic
1088324487 11:108587564-108587586 CATTGTAAAGAAAAGGACAAGGG + Intronic
1088625959 11:111730971-111730993 CAGGCTGCAGAAAAGGACAGTGG + Intronic
1090262740 11:125333172-125333194 GAAGGTACAAAAAGGGACAAGGG + Intronic
1091010286 11:131995071-131995093 CAGGGTGCACTAGAGGACAGGGG - Intronic
1093227816 12:16506673-16506695 CATGGTACACAAAAGCACATAGG - Intronic
1093479921 12:19593708-19593730 CAGGGGAGAGAAAAGAACAAAGG + Intronic
1095282246 12:40367056-40367078 GAAGGTACACAAAAGCAGAAAGG + Exonic
1096378254 12:51132703-51132725 CAGGGTTCCCAAAAGTGCAAAGG - Intronic
1096716326 12:53493472-53493494 CAGGGCACAGAAAAGGCGAAAGG + Intronic
1096808915 12:54157490-54157512 CAGGGCACTATAAAGGACAAGGG + Intergenic
1101834108 12:108283010-108283032 CAGGGAAAAGAAAAGGCCAAGGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102658986 12:114508613-114508635 CCAGAAACACAAAAGGACAATGG - Intergenic
1104689442 12:130814324-130814346 CAGGGTTCACAAAATGCCATGGG + Intronic
1105461224 13:20590077-20590099 CAGGGTTTACAAATGGAAAAAGG - Intronic
1105953845 13:25260647-25260669 TGGGCTACACAAAAGGACATTGG - Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1110093670 13:71487256-71487278 AAGAGTAGATAAAAGGACAATGG - Intronic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1111951100 13:94710340-94710362 CAGTTTACAAAAAAGGAAAAAGG - Exonic
1112184327 13:97113647-97113669 CAGGCTGCACAAAAGGGGAAGGG - Intergenic
1112544957 13:100358693-100358715 GAAGAGACACAAAAGGACAAAGG + Intronic
1115660821 14:35492826-35492848 CAGGATCCACACTAGGACAAAGG + Intergenic
1115667502 14:35568697-35568719 CAGGGTTCACAAAAACTCAAGGG + Intronic
1115928703 14:38467012-38467034 AAGGGTGCAGAAATGGACAAAGG - Intergenic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1119084958 14:71731081-71731103 CAGAGTTCACCAAAGGAAAAAGG - Intronic
1120290071 14:82556929-82556951 CAGGATATACAAAAAGCCAATGG - Intergenic
1120424810 14:84333573-84333595 CAAAGTACAAAAAAGTACAAAGG + Intergenic
1121227003 14:92328453-92328475 CAGGCTACACAGAAGGACACCGG - Intronic
1122341746 14:101033095-101033117 CAGGGGCCAGGAAAGGACAACGG - Intergenic
1122474792 14:101999725-101999747 CAGGGTACTGAATAAGACAATGG + Intronic
1123137753 14:106045314-106045336 CAGGGGCCACAGAATGACAAGGG - Intergenic
1123811156 15:23927530-23927552 CAGGGGACAAAAAAGTAGAATGG + Intergenic
1124319275 15:28700977-28700999 CCCAGTACACAAAAGGACACTGG - Intergenic
1125680844 15:41529375-41529397 CAGGGCACACAGAAGGTCAAAGG + Intronic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1129015238 15:72462114-72462136 AAGGGTACAAGAAGGGACAATGG + Intergenic
1130176676 15:81579132-81579154 CAAGATACACAACAGGAAAATGG - Intergenic
1131717703 15:95131343-95131365 CAGGGTACACAAGAGCGGAAGGG + Intergenic
1132847448 16:2007036-2007058 ATGGGCACACAAAAGGACAGCGG + Intronic
1133773859 16:8883312-8883334 CAGGGGACAGAAAGCGACAAGGG - Intergenic
1133832817 16:9339873-9339895 CAGGGTCCACAAACGCTCAAAGG - Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1136345980 16:29676328-29676350 TAGGGTACCCAGAAGGAAAAGGG + Intronic
1138531714 16:57638002-57638024 CAGGGCACAGAAAAGAACCAGGG - Intronic
1138741331 16:59314145-59314167 CAAAGTACATAAAAGTACAAAGG - Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1145828508 17:27895980-27896002 AAGGGAACACAAGAGGAAAAAGG + Intergenic
1146053800 17:29571446-29571468 CAGGGCCCAGGAAAGGACAAAGG - Intronic
1146520928 17:33524968-33524990 CAGGGCACAGGAAAGGCCAAAGG + Intronic
1148810920 17:50290557-50290579 CAGGGGACACTAGAGGGCAACGG - Intergenic
1149179100 17:53912729-53912751 CTTGGTTCACAAATGGACAATGG + Intergenic
1149409982 17:56395211-56395233 GAGGGTTCATGAAAGGACAAGGG + Intronic
1152234417 17:79131039-79131061 CACGGTACACACAAGTACATGGG - Intronic
1152234429 17:79131136-79131158 CACGGTACACACAAGCACACGGG - Intronic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG + Intronic
1162687028 19:12395632-12395654 CAGGGTACTCAAAAGCACCCAGG + Intronic
1162691357 19:12435466-12435488 CAGGGTACTCAAAAGCACCCAGG + Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1164759816 19:30720235-30720257 CAGGGGGCACAAGAGGACACAGG - Intergenic
1166712145 19:44944596-44944618 CAGGGGACACATAAGGGTAAAGG + Intronic
926564654 2:14455973-14455995 CTTGTTACACACAAGGACAATGG + Intergenic
926764471 2:16312190-16312212 CAGGGTACAAATACGTACAAAGG - Intergenic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927730587 2:25467988-25468010 CATGGTACACACAAGGGCAGCGG - Intronic
928923168 2:36547602-36547624 GAGGGTATACAAAAGGCAAAAGG + Intronic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
931880325 2:66562275-66562297 GAGGATAAACTAAAGGACAAAGG + Intronic
934846020 2:97661837-97661859 GAAGGTAAACAAAAGGACTAAGG + Intronic
934862043 2:97772405-97772427 CAGGATACAGAAAAGCAAAAGGG - Exonic
935101790 2:100002897-100002919 CAGGGCACAAAATAGGACAGTGG - Intronic
937503457 2:122509428-122509450 CAGTGTACATAAAAGAACAGTGG - Intergenic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
943678345 2:190740445-190740467 AAGGGAACACAAAATAACAATGG + Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944149728 2:196544837-196544859 CAGGGAACAGCAAAGGAAAAAGG + Intronic
946936626 2:224728493-224728515 TAGTATACACAAAATGACAATGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1169089257 20:2848006-2848028 CAGGGGTAACCAAAGGACAAAGG - Intronic
1169736556 20:8844213-8844235 AACGGCAAACAAAAGGACAACGG - Intronic
1173152417 20:40578947-40578969 CAGGGCACCCAAAAGCATAATGG + Intergenic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1174315470 20:49697198-49697220 CAGGGGAGCCAAAAGGACACAGG + Intronic
1174572933 20:51515595-51515617 CAGGCAACACAACAGGAAAATGG + Intronic
1174843358 20:53920341-53920363 CAGGGTACAGAAATAGAGAAAGG + Intergenic
1177405691 21:20664650-20664672 CAGGGAACATAAAAGGTCAGGGG + Intergenic
1177607332 21:23398492-23398514 CAAGTCATACAAAAGGACAAAGG - Intergenic
1178128802 21:29546054-29546076 CATGGAAGACAAAAGGACAGAGG - Intronic
1178930689 21:36816051-36816073 CAGGGGACTCTAAAGTACAATGG + Intronic
1178935669 21:36859490-36859512 CAGGGTCCACAAGAGGAGAGGGG + Intronic
1178986218 21:37305416-37305438 GAGGGATTACAAAAGGACAAAGG - Intergenic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1181936536 22:26442891-26442913 CAGGGTGGACAAAAGGAAATGGG - Intronic
1182220007 22:28751082-28751104 CATGGTACACACAGAGACAAAGG + Intronic
1184327688 22:43802654-43802676 GAAGGTACACAAAGGGAAAAAGG + Intronic
1185131515 22:49041887-49041909 CAGAGGACAGAAAAGGGCAAAGG + Intergenic
952901132 3:38112364-38112386 AAGGGTACACAAGAGGGCAGTGG + Intronic
953957894 3:47245643-47245665 CAGACCAGACAAAAGGACAAAGG + Intronic
954369372 3:50162222-50162244 CAGGGTAGATAAAGGAACAAAGG + Intronic
955543988 3:60007900-60007922 GAGGGTAGACAAATGGAAAAAGG + Intronic
955673376 3:61425406-61425428 CAGGGTAAACCAAAGGGCAGGGG + Intergenic
956426097 3:69137044-69137066 CATGGAACACCAGAGGACAAAGG + Intergenic
956921224 3:73931608-73931630 CAGGGCTCCCAAAAGGACATGGG + Intergenic
959840369 3:110968023-110968045 AAGAGAACACAAAAGGAAAATGG - Intergenic
960419842 3:117430711-117430733 TAGGGTACAAGAAAGGAAAAAGG - Intergenic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962390300 3:134966069-134966091 CTGGGTACACAGAGGGGCAAGGG + Intronic
962842035 3:139242698-139242720 AAGGACACACAAATGGACAATGG - Intronic
963280247 3:143377527-143377549 CAGGTTACACACAAGAATAAAGG + Intronic
965700425 3:171455147-171455169 ATTGGTACACAAAAGGAAAAAGG + Intronic
967409147 3:189150003-189150025 CTGGGTACATCAAAGGACACTGG - Intronic
968071894 3:195789315-195789337 CAGGGGGCCCAGAAGGACAATGG - Exonic
970976724 4:22050136-22050158 GAGAGTAGAGAAAAGGACAAAGG + Intergenic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972224808 4:37000488-37000510 CAGGATACAGATAAGGAAAAGGG + Intergenic
975755548 4:77568103-77568125 CTGGTAACACAAAGGGACAATGG + Intronic
976297302 4:83485086-83485108 CAGGCTACACAAGAGGACGAGGG + Exonic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
980940109 4:139265558-139265580 AAGGGAACAGAAAAGGGCAAAGG - Intergenic
981153102 4:141401686-141401708 CAGGGGACACAAACTGACACAGG + Intergenic
981277693 4:142921118-142921140 CAGGGTACCCAACAGAACATTGG + Intergenic
981621417 4:146703936-146703958 CTTGGTATGCAAAAGGACAAAGG - Intergenic
982116567 4:152103377-152103399 CAGGGAACACCAAAGGCCAAGGG + Intergenic
982882719 4:160740641-160740663 AAGTGTACACAAATAGACAATGG + Intergenic
983804367 4:171975616-171975638 CTGGGTGGACAAAAGGGCAAGGG + Intronic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
984434832 4:179696147-179696169 AAGGGGGCATAAAAGGACAAAGG + Intergenic
985107317 4:186511623-186511645 CAGGGCACACTGAAGGGCAACGG - Intronic
985652762 5:1114585-1114607 CCGGGTACAGAAAAGGACAGAGG - Intergenic
986700613 5:10404668-10404690 AAGGGAACACAAAAGCACAAAGG + Intronic
988620828 5:32821764-32821786 CAGGCTACACCTAAGAACAAAGG - Intergenic
989405937 5:41060672-41060694 GAAGGTACACAAAGTGACAAGGG - Intronic
992832689 5:80610323-80610345 CAGGGAAGACAAAAGATCAAGGG + Intergenic
992973632 5:82088776-82088798 TAGGGTACTCAACAGGACAATGG - Intronic
993816031 5:92546626-92546648 AAGGGTAGTCAAATGGACAATGG - Intergenic
993866948 5:93207033-93207055 CAGGTTACCCACAAGGAAAAGGG + Intergenic
993954456 5:94215365-94215387 CAGGGCAAAGAAAAGGCCAATGG + Intronic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
994877940 5:105449422-105449444 CAGGGCACACTATAGGACCAGGG - Intergenic
994922334 5:106063702-106063724 GAGGGTATACAACATGACAATGG - Intergenic
995234484 5:109811663-109811685 CAGGGTAGGCAATAAGACAAAGG - Intronic
997362333 5:133303063-133303085 CAGGAGGCACAAAAGGACAAAGG - Intronic
999053936 5:148553605-148553627 CAGGGAACACAAAACAACACCGG - Intronic
999304237 5:150509416-150509438 CAGGGCACCGCAAAGGACAATGG - Intronic
1002718659 5:181244971-181244993 CAGCGTACACAAAAGCCCAGGGG + Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1009819639 6:68783497-68783519 CTAGGTAAACAAAAAGACAAGGG + Intronic
1010115935 6:72311071-72311093 CAGTGTACACTAAAGCATAAAGG - Intronic
1010155028 6:72782644-72782666 TAGGAGACACAAAGGGACAAGGG - Intronic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012242764 6:96892753-96892775 AAGGGTAAGCAAAAGGAAAAGGG - Intronic
1012763263 6:103330734-103330756 AAGGGTAGCCAAAAAGACAAAGG + Intergenic
1013740495 6:113278229-113278251 CTGGGTACAGTAAATGACAAGGG + Intergenic
1014405895 6:121050113-121050135 CATTGTATACAAAAGGACAACGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1020555917 7:9670191-9670213 CAGGGATCACACAAGCACAATGG + Intergenic
1022230303 7:28407721-28407743 CAAGGAACACTAAAGGGCAAGGG + Intronic
1024119358 7:46221465-46221487 CAGGTTGCAAAAAAGAACAAAGG - Intergenic
1024722701 7:52155763-52155785 CAGGGTACACACCAGAACAGAGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1028956581 7:96700312-96700334 CAGAGTACACAACCAGACAAAGG + Intronic
1029013554 7:97289522-97289544 GGGAGTACACAAAAGGAAAATGG - Intergenic
1029749882 7:102537282-102537304 TAGAGTACACAAAAGGCAAAAGG - Intergenic
1029767832 7:102636388-102636410 TAGAGTACACAAAAGGCAAAAGG - Intronic
1030434671 7:109501663-109501685 CACGGTAAACAAGAGGGCAAAGG - Intergenic
1030862753 7:114657275-114657297 CAGGGTAGAAAAAAGAAAAAAGG - Intronic
1032375183 7:131407721-131407743 CAGCATACACAAAGGCACAAAGG - Intronic
1032425333 7:131818270-131818292 CAGGTTTCAGAAAGGGACAATGG + Intergenic
1032967270 7:137113386-137113408 GAGACTACACAACAGGACAATGG + Intergenic
1033510374 7:142054967-142054989 CAGGATACATCCAAGGACAATGG - Intronic
1033513166 7:142081004-142081026 CAGGATACATCCAAGGACAATGG - Intronic
1033946222 7:146722293-146722315 CACAGGACACAAAAGGCCAATGG - Intronic
1034041759 7:147885261-147885283 GAGAGTCCAGAAAAGGACAAGGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1037103478 8:15076688-15076710 CAGGATACAGAAAAGTTCAAAGG - Intronic
1038521293 8:28234330-28234352 CAGTGTGCACAACAGGACACAGG + Intergenic
1038537604 8:28364990-28365012 CAGGGCACGCAAAGGGATAATGG + Intronic
1038836609 8:31131796-31131818 CAGGGTCCACAAAAAGCCCAAGG - Intronic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1042457911 8:69026994-69027016 CAGGGGCCATAAAGGGACAAGGG + Intergenic
1042770207 8:72372271-72372293 TAGGGAACACAAAAGTAAAATGG + Intergenic
1046225850 8:111279740-111279762 CAGGGGACAAGAAAGGTCAATGG - Intergenic
1047894189 8:129346940-129346962 AAAGGTACCCAAAAAGACAATGG + Intergenic
1047912596 8:129546564-129546586 CAGCATACAGAAAAGGACAGAGG + Intergenic
1049278565 8:141732262-141732284 CAGGGAGCCCAGAAGGACAATGG - Intergenic
1050119296 9:2292005-2292027 CAGGGAAAACAAAAGAACACAGG - Intergenic
1051175375 9:14354890-14354912 CAGTGTTCACAACAGGACAAGGG - Intronic
1055369756 9:75584623-75584645 AAGGGTACATCAAAGGAAAAAGG - Intergenic
1055621365 9:78128225-78128247 AATGGTACAAAAAAGGAAAAAGG - Intergenic
1055717052 9:79129213-79129235 CAGGACACACAGAAGGACACAGG + Intergenic
1055870548 9:80873435-80873457 AAGTGTACAAAAAAGGAGAAGGG - Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1057821525 9:98334961-98334983 CAGGGAAGAAAAAAGGACAAGGG - Intronic
1060046088 9:120342265-120342287 CAGAGTACACCAAAATACAATGG + Intergenic
1060764397 9:126283033-126283055 CAGAGAAGACAACAGGACAATGG + Intergenic
1062333598 9:136055294-136055316 CAGGATTCACACAAGGACACAGG + Intronic
1187946652 X:24432694-24432716 AAGCGTAAACAAAAAGACAATGG + Intergenic
1189133079 X:38520464-38520486 CAGGGTAAAGAAGAGGGCAAGGG + Intronic
1190417228 X:50191954-50191976 GAGGGAACAAAAAAGGAAAATGG - Intronic
1192012119 X:67285684-67285706 CAGAGGAGACAAAAGGAAAAGGG - Intergenic
1196710343 X:118755662-118755684 CAGGGTACAGAAATGAAAAAGGG + Intronic
1197345574 X:125322921-125322943 CAAGGAACAAAAAAGGAAAAAGG + Intergenic
1197470145 X:126857054-126857076 CAGAGGACACAAAAGAAAAAAGG + Intergenic
1197630463 X:128852469-128852491 CAGGGAACAAAGAAGGACAGGGG + Intergenic
1198844165 X:140891905-140891927 GAGTGTACACAAATGGGCAAGGG + Intergenic
1199000051 X:142624997-142625019 CATGGTCCACATAAGCACAAGGG - Intergenic
1199621361 X:149704626-149704648 CAGGGTACCCTAAAGGTCAATGG - Intronic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200326183 X:155242121-155242143 CAGACTGCACAAAAGGACATAGG + Intergenic
1200827557 Y:7659906-7659928 CAAGGTACACAAAGGTACACAGG - Intergenic
1200909025 Y:8514689-8514711 CAAGGTACACAAAGGTACATAGG + Intergenic
1200986309 Y:9305921-9305943 CAAGGTACACAAAGGGACACAGG - Intergenic
1201783423 Y:17746754-17746776 CAAGGTAGATAAAAGCACAAAGG + Intergenic
1201818130 Y:18159233-18159255 CAAGGTAGATAAAAGCACAAAGG - Intergenic
1201854338 Y:18524590-18524612 CACAGTAAAAAAAAGGACAATGG + Intergenic
1201878983 Y:18795795-18795817 CACAGTAAAAAAAAGGACAATGG - Intronic
1202107197 Y:21384067-21384089 CAAGGTACACAAAGGCACACAGG - Intronic
1202107323 Y:21384930-21384952 CAAGGTACACAAAGGTACACAGG - Intronic
1202124269 Y:21554981-21555003 CAAGGTACACAAAGGTACACAGG + Intergenic
1202154739 Y:21874399-21874421 CAAGGTACACAAAGGTACACAGG - Intergenic
1202199623 Y:22332196-22332218 CAAGGTACACAAAGGTACACAGG + Intronic
1202232299 Y:22669734-22669756 CAAGGTACACAAAGGTACACAGG + Intergenic
1202310857 Y:23526424-23526446 CAAGGTACACAAAGGTACACAGG - Intergenic
1202559945 Y:26144170-26144192 CAAGGTACACAAAGGTACACAGG + Intergenic