ID: 962354086

View in Genome Browser
Species Human (GRCh38)
Location 3:134678756-134678778
Sequence TAGCAGCAGCACAGTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962354086_962354092 30 Left 962354086 3:134678756-134678778 CCCACCTCACTGTGCTGCTGCTA 0: 1
1: 0
2: 5
3: 35
4: 338
Right 962354092 3:134678809-134678831 GCTCATGCACCCCCTCCACTTGG 0: 1
1: 0
2: 3
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962354086 Original CRISPR TAGCAGCAGCACAGTGAGGT GGG (reversed) Intronic
900367533 1:2317379-2317401 TAGGAGGGGCACAGGGAGGTGGG + Intergenic
900384993 1:2406474-2406496 GTGCAGCAGCAAGGTGAGGTGGG - Exonic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
900909632 1:5585939-5585961 TAGCAGCAGAACAGTCAGCAAGG + Intergenic
900910641 1:5594725-5594747 CAGCAACAGCCCTGTGAGGTGGG + Intergenic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901853579 1:12030530-12030552 CAGCAGCAGCACAGAGACCTAGG - Intronic
902558371 1:17260504-17260526 TCACAGCAGCCCAGAGAGGTGGG + Intronic
903076510 1:20772373-20772395 GAGCAGCATCATAGTGAGGATGG - Intronic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903142582 1:21347895-21347917 TTACAACAGTACAGTGAGGTGGG - Intergenic
903888922 1:26556981-26557003 TAGCTTCTGCACAGTGGGGTGGG - Exonic
904174653 1:28618160-28618182 TTACAGCAGCATAGTCAGGTAGG - Intronic
905248920 1:36635694-36635716 TACCAGCAGCAGGTTGAGGTCGG - Intergenic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906539479 1:46574167-46574189 TCACAGCAACCCAGTGAGGTAGG + Intronic
906608975 1:47189318-47189340 TGGCAGCAGCCCTGGGAGGTGGG + Intronic
907403261 1:54238676-54238698 TGGCAGCAGCACAGGCAGGCGGG + Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907763524 1:57386090-57386112 CAACAGCAACCCAGTGAGGTGGG - Intronic
907916377 1:58873554-58873576 CAGCAGCAGAATAGGGAGGTTGG - Intergenic
908141565 1:61190299-61190321 CCGCAGCAGCACCATGAGGTTGG + Intronic
909398564 1:75198469-75198491 TTTCAGCAGCACTGTGAGGAGGG + Intergenic
911157290 1:94648999-94649021 TCACAGCAGCACTGGGAGGTGGG - Intergenic
912265841 1:108156905-108156927 TTGCAGCAGCCCAGTGAAGTAGG - Intronic
913596055 1:120378333-120378355 TGGCGGCAGCAAAGAGAGGTGGG + Intergenic
914091224 1:144500643-144500665 TGGCGGCAGCAAAGAGAGGTGGG - Intergenic
914307380 1:146433552-146433574 TGGCGGCAGCAAAGAGAGGTGGG + Intergenic
914594727 1:149139579-149139601 TGGCGGCAGCAAAGAGAGGTGGG - Intergenic
915492216 1:156257263-156257285 TTGCAGCAGCCCAGTGAGGTAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917379291 1:174386244-174386266 TTGCAGCAGCTCTCTGAGGTAGG + Intronic
919435416 1:197553531-197553553 TTGCAGCAACACCGTGAGGCAGG - Intronic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922021601 1:221710410-221710432 TTACAACAGTACAGTGAGGTAGG - Intronic
922244023 1:223777325-223777347 AAGCAGCAGCAAAGAGAGGTAGG - Intergenic
922600357 1:226846769-226846791 TAACAGCAGCACTGTCAGCTTGG + Intergenic
922633954 1:227144883-227144905 TAGCAGCAACACACTGGGCTTGG + Intronic
923207503 1:231773216-231773238 TAGGAGCTCCACAGTGTGGTTGG + Intronic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
1068797303 10:61097728-61097750 AAGCTGCAGCACAGTGCTGTTGG - Intergenic
1069916755 10:71791297-71791319 TAGCAGATGGACAGTGAGGGTGG - Intronic
1072271315 10:93779820-93779842 CAGCACCAGCTCAGAGAGGTGGG - Intronic
1072712416 10:97724697-97724719 TTTCAACAGCCCAGTGAGGTAGG - Intergenic
1073765031 10:106672863-106672885 TGGCAGCTGCACAGCCAGGTAGG - Exonic
1074841395 10:117355646-117355668 TTGTAACAGCACTGTGAGGTAGG - Intronic
1076537273 10:131187691-131187713 TAGTTGCAGCTCAGTTAGGTCGG - Intronic
1077930298 11:6724277-6724299 TAGCAGCAGCACATTGTAGGAGG + Intergenic
1078694980 11:13622132-13622154 TCTCAGCAACCCAGTGAGGTAGG + Intergenic
1079241967 11:18727831-18727853 CAGCATGAGCACAGTGAGCTTGG - Intergenic
1080097721 11:28429026-28429048 TAGCAGCAGTCCAGTCAGGCAGG - Intergenic
1081418224 11:42841002-42841024 TAGCAGCAGCATGGAGAAGTGGG - Intergenic
1082057930 11:47835096-47835118 TAATAACAGCCCAGTGAGGTAGG - Intronic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1082904542 11:58292012-58292034 CAGCAGGACCACGGTGAGGTGGG + Intergenic
1083252979 11:61480426-61480448 TGCCAGCAGCCCTGTGAGGTGGG + Intronic
1085707873 11:78802690-78802712 CAACAGCAGCCCTGTGAGGTTGG - Intronic
1085763515 11:79262226-79262248 TCACAGCAGCCCAGTGAGGCAGG - Intronic
1085852862 11:80141893-80141915 TCACAGCAACTCAGTGAGGTAGG + Intergenic
1087182480 11:95153581-95153603 TGGCAACAACACAGCGAGGTGGG + Intergenic
1088652902 11:111974147-111974169 CAGCAGTGGCACAGTGTGGTCGG - Exonic
1088815794 11:113419947-113419969 GCGCAGCAGCACAGGGAGCTGGG - Intronic
1089620062 11:119717121-119717143 CTGCAGCAGCACTGAGAGGTGGG + Intronic
1089702936 11:120256299-120256321 TCACAGCAGCACTATGAGGTAGG - Intronic
1089786763 11:120913069-120913091 TTACAGCAGCACTGTGAAGTAGG + Intronic
1090072968 11:123560364-123560386 TAACAGCAGCAGAGGGAGGTGGG + Intronic
1090927036 11:131258544-131258566 TAGGAGCAGCCCAGGGAGGAGGG + Intergenic
1091102015 11:132883478-132883500 GAGGAACAGCTCAGTGAGGTTGG + Intronic
1091454074 12:592207-592229 TCGCAGCAGCCCAGTGAGGTAGG - Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1091885977 12:4017337-4017359 TAGCAGAAGAAAAGAGAGGTGGG - Intergenic
1092174530 12:6394102-6394124 GAGCAGTAGCACAGGGAGATGGG + Intergenic
1092870840 12:12804503-12804525 TAGGAGCAGCACAGAGGGGCTGG - Intronic
1093889162 12:24498848-24498870 TACCTGCAGCACAGTGAGCCAGG - Intergenic
1094534771 12:31311292-31311314 TAGAAAAAGCACAGTGTGGTTGG - Intronic
1097056371 12:56252290-56252312 TAGCAGCTGCATAGTGCAGTGGG + Exonic
1097229507 12:57501223-57501245 TAGCACTAGCACAGTGAGTGAGG + Intronic
1097811451 12:64023798-64023820 CCGCAGCAGCACTGTGAGGCAGG + Intronic
1097883318 12:64705483-64705505 TCACAGCAGCCCTGTGAGGTAGG - Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100267866 12:92995505-92995527 TAGAAGCAACACAGTGTGGTTGG - Intergenic
1100403694 12:94254094-94254116 TCCCAGCATCACAGTGAGATAGG + Intronic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1101731333 12:107428863-107428885 TCACAGCATCCCAGTGAGGTGGG + Intronic
1102863961 12:116359780-116359802 TACCACCAGCACATTGAGGGCGG - Intergenic
1104597785 12:130131818-130131840 TAGCAGCCAGACAGTGAGGGAGG - Intergenic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1108315371 13:49231773-49231795 TAGCAACAGAACAGTGATGTTGG + Intergenic
1108602428 13:52006379-52006401 TAGCAGCAACAGAGTGCAGTTGG - Intronic
1109285108 13:60399347-60399369 CAGAAGCAGCACAGACAGGTGGG - Intronic
1110732220 13:78892060-78892082 TGCCAACAGTACAGTGAGGTAGG + Intergenic
1111279680 13:86004926-86004948 CAGCTGCATCTCAGTGAGGTGGG - Intergenic
1111577755 13:90180410-90180432 CAGCAACAGGACAGCGAGGTGGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111835613 13:93385230-93385252 TGGTAGCAGGACAGTGAGGCTGG + Intronic
1112722852 13:102264833-102264855 TAGCAGGAGAAGAGTGAGATTGG - Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116785548 14:49284447-49284469 TAGCTGCAGCCCAGTGACGGAGG - Intergenic
1116982968 14:51190657-51190679 TATCAGCAGAATAGGGAGGTGGG - Intergenic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1121021584 14:90583534-90583556 GAACAGCAGCACAGTGAAATGGG + Intronic
1122357836 14:101134637-101134659 GTGCAGGAGCACAGTGAGGTGGG + Intergenic
1124509576 15:30311898-30311920 CAGCAGCTGCACAGTAATGTAGG - Intergenic
1124733984 15:32226764-32226786 CAGCAGCTGCACAGTAATGTAGG + Intergenic
1126543924 15:49852174-49852196 TCACAGCAACCCAGTGAGGTAGG - Intergenic
1126886383 15:53155573-53155595 TAGAAGCACCACAGTGAAGACGG - Intergenic
1128603352 15:69016116-69016138 TTGGTGCAGCCCAGTGAGGTAGG - Intronic
1128878632 15:71222988-71223010 TCACAGCAACTCAGTGAGGTAGG - Intronic
1129151429 15:73690759-73690781 TTGCAGCAACACTGTGAGGTAGG + Intronic
1129987556 15:79931736-79931758 TATCAGTAGGACAGTGAAGTTGG + Intergenic
1130576689 15:85099187-85099209 TAACTGCAGCCCTGTGAGGTTGG + Intronic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1133575942 16:7089988-7090010 TAGCATTAACACTGTGAGGTTGG + Intronic
1134679253 16:16112530-16112552 TTGCAGCAGTCCTGTGAGGTAGG + Intronic
1134886642 16:17799069-17799091 CAGCAGCAGCACAGTCACCTGGG - Intergenic
1135053125 16:19208452-19208474 TGGCAGCAGGAGAGTGAGGGGGG + Intronic
1136611059 16:31365519-31365541 CAGCAGCAGCTCAATAAGGTTGG - Intronic
1137597854 16:49736819-49736841 GGGCAGTAGCTCAGTGAGGTGGG - Intronic
1138341877 16:56295378-56295400 TCCCAGCAGCACAAGGAGGTAGG - Intronic
1138409116 16:56823853-56823875 CAGCAGTAGCACAGTGGGGCTGG + Intronic
1140797791 16:78456204-78456226 TAGCAGCAACACAGTAAGTTGGG + Intronic
1141009964 16:80387998-80388020 TCCCAGCAGCGCAGTGAGGCAGG + Intergenic
1141694548 16:85613444-85613466 TTGCAGGAGGACAGTGCGGTGGG - Intronic
1141770155 16:86085099-86085121 TGGCAGCAGCCCAAAGAGGTGGG - Intergenic
1142424347 16:89993044-89993066 TTGCTGCAACACAGAGAGGTGGG + Intergenic
1142714260 17:1739332-1739354 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714281 17:1739422-1739444 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714331 17:1739645-1739667 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714395 17:1739915-1739937 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714438 17:1740095-1740117 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714522 17:1740455-1740477 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714791 17:1741580-1741602 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714811 17:1741670-1741692 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714834 17:1741760-1741782 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714887 17:1741983-1742005 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714899 17:1742028-1742050 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142930239 17:3278312-3278334 GAGCAGCAGCTCATTGAGTTGGG + Exonic
1142931844 17:3291977-3291999 AAGCAGCAGCTCATTGAGTTGGG + Exonic
1142945268 17:3421169-3421191 GAGCAGCAGCTCATTGAGTTGGG - Exonic
1143095815 17:4477767-4477789 TTGGAGCAGCACAGGGAGGTGGG - Intronic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1144061148 17:11583896-11583918 TAGCAGGGGAACAGTGCGGTTGG - Intergenic
1144244015 17:13345474-13345496 AAGCAACAGCACTGGGAGGTGGG - Intergenic
1144244028 17:13345567-13345589 AAGCAACAGCACTGGGAGGTGGG - Intergenic
1144589966 17:16515476-16515498 AGGAAGCAGCACAGTGTGGTAGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1147010417 17:37442036-37442058 TAACAGCAACCCAGTGAGATAGG + Intronic
1147901186 17:43785930-43785952 TACCAGCATCCCAGTGAGGTGGG - Exonic
1148553270 17:48563519-48563541 TTGCAGGCGCACAGTGTGGTGGG - Intronic
1148939675 17:51197469-51197491 TAGCAGAGACTCAGTGAGGTTGG - Intronic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149375090 17:56035806-56035828 TAGCAGCAGCACTTTGACCTAGG + Intergenic
1149613341 17:57975178-57975200 TCTCAGCATCACTGTGAGGTAGG - Intronic
1149957874 17:61073490-61073512 TAGCAAGAGCTCAGTGAGGTTGG + Intronic
1150268467 17:63846861-63846883 TAGCACCATCACAGTGAGGGTGG - Intergenic
1151158094 17:72141414-72141436 TCGCAGCAGCCCTATGAGGTAGG + Intergenic
1151523549 17:74648190-74648212 TAGCAGCTGCACCCTGAGGCTGG + Intergenic
1152413967 17:80147018-80147040 CGGCAGCGGCACAGCGAGGTCGG - Exonic
1152413973 17:80147056-80147078 CGGCAGCGGCACAGCGAGGTCGG - Exonic
1152413976 17:80147076-80147098 CGGCAGCGGCACAGCGAGGTCGG - Exonic
1152413979 17:80147096-80147118 CGGCAGCGGCACAGCGAGGTCGG - Exonic
1152413982 17:80147116-80147138 CGGCAGCGGCACAGCGAGGTCGG - Exonic
1152437176 17:80283556-80283578 CAGCAGCAGCACACGGAGGTTGG - Intronic
1153135673 18:1914691-1914713 CAGCAGCTGCACAAGGAGGTGGG + Intergenic
1155495496 18:26438087-26438109 TCGCAGGAGCTCTGTGAGGTAGG + Intergenic
1156043138 18:32846612-32846634 TCTCAGCAACACAGTGAGGTAGG - Intergenic
1156709151 18:39920614-39920636 AAGCTGCAGCACAGTGTGATCGG + Intergenic
1156856642 18:41790174-41790196 TACCTGCAGCAGTGTGAGGTTGG + Intergenic
1157099347 18:44715341-44715363 TGGCAGCAGCACAGGGCTGTGGG + Intronic
1157329304 18:46691921-46691943 TTGCAGCAGCCTTGTGAGGTTGG - Intronic
1158465988 18:57690271-57690293 TGGCAGAAGCCCAGGGAGGTGGG + Intronic
1160370387 18:78368312-78368334 AAGCAGCAGCACACGGAGGCAGG - Intergenic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161668916 19:5593724-5593746 CTGCAGCAGCGCAGTGAGATCGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161879577 19:6938730-6938752 TTGCAGAAGTCCAGTGAGGTAGG + Intronic
1162371640 19:10283580-10283602 GAGCAGCACCACGGTGAGGTTGG - Exonic
1162381847 19:10335855-10335877 AAGCAGCACCACCGTGAGGCTGG + Exonic
1163044985 19:14634615-14634637 TCACACCAGCACTGTGAGGTTGG + Intronic
1164478960 19:28596972-28596994 TAGCAGCACGGCAGTGAGGGTGG + Intergenic
1164664723 19:30020407-30020429 TCACAGCATCCCAGTGAGGTAGG + Intergenic
1165977029 19:39685195-39685217 TAGCAGCAGCAAAGCAGGGTCGG - Intergenic
1166054854 19:40282349-40282371 TAGCAGCAGGACGGTGAAGTCGG - Intronic
1167918137 19:52759216-52759238 TAGCGGCTCCCCAGTGAGGTTGG + Intergenic
925604738 2:5647678-5647700 TGGCGGCAGCAAAGAGAGGTGGG + Intergenic
925635487 2:5937904-5937926 TCTCATCAGCACAGTGAGGGAGG + Intergenic
927944764 2:27129031-27129053 AAGCAGCAGCACAATGGGCTGGG - Exonic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
929547083 2:42862815-42862837 AGGCAGCAGCTCAGTGGGGTTGG + Intergenic
931186974 2:59962584-59962606 TAACAACACCCCAGTGAGGTAGG + Intergenic
931891856 2:66682091-66682113 TGGCAGCAGGACAGTGAGTAGGG + Intergenic
933833124 2:86226203-86226225 TCACAACAGCACAGTGAGGCCGG + Intronic
934073695 2:88409265-88409287 TCACAGCAGCACTGTGAGGTGGG + Intergenic
935101213 2:99997859-99997881 GAGCAGGAGAACAGTGAGGCTGG - Intronic
936073465 2:109386575-109386597 AAGCAGAAACACAGAGAGGTGGG - Intronic
936473825 2:112822705-112822727 GCACACCAGCACAGTGAGGTTGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
939550033 2:143603753-143603775 GAGCAGCAGCACAGATAGGTGGG - Intronic
940201349 2:151154492-151154514 TAGCAACAGCTCAATGAGGTTGG + Intergenic
940672361 2:156686336-156686358 TAGCAACAGCAAGGTGAGGATGG + Intergenic
940685900 2:156850338-156850360 AAGCAGCAGCACAGTGTGAGAGG + Intergenic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941494681 2:166185054-166185076 GAGCAGCAGCACAGTCAAGCAGG + Intergenic
943992443 2:194713832-194713854 TAAAAGCAGCACATTGAGGTAGG - Intergenic
944165901 2:196720651-196720673 GACCAGCACAACAGTGAGGTTGG + Exonic
945709890 2:213282830-213282852 TTGCAACAGCACTTTGAGGTAGG + Intergenic
947114371 2:226752920-226752942 TCACAACAGCACAGTGAGTTAGG - Intronic
948028864 2:234800355-234800377 TAGCAGCAGCACTGGGACATTGG + Intergenic
948151653 2:235749421-235749443 GAGCAGCTGCACAGGGATGTCGG - Intronic
948445917 2:238032849-238032871 CAGAAGTAGAACAGTGAGGTGGG + Intronic
948703139 2:239773213-239773235 TAGCAGTGGCAGAGTGGGGTTGG - Intronic
948893248 2:240917011-240917033 GAGCAGCAGCCCAGTGGGGGAGG - Intergenic
1168986193 20:2050945-2050967 CAGCAGCAACCCTGTGAGGTAGG - Intergenic
1169798254 20:9488670-9488692 TCACAGCAGCACCATGAGGTAGG - Intergenic
1170896101 20:20415938-20415960 TAGCAGCATGACAGTCAGGAAGG + Intronic
1171449143 20:25224055-25224077 CTGCAGGAGCACTGTGAGGTTGG - Intronic
1173310422 20:41892040-41892062 CAGCAGCGGCACAGTGAGCCAGG - Intergenic
1173427158 20:42953275-42953297 TAGCAGGTGCATAGTGAGGCAGG + Intronic
1173458516 20:43223094-43223116 TCTCACCAGCCCAGTGAGGTAGG + Intergenic
1174442020 20:50563311-50563333 CACCAGCAGCACTGTGAGCTGGG - Intronic
1175546291 20:59780162-59780184 GAGCAGCAGCACAGGCAGCTGGG - Intronic
1176195452 20:63834775-63834797 TAGAAGCCACACAGTGAGGGTGG - Intergenic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1181573056 22:23778263-23778285 AAGCAGAAGCTCAGAGAGGTTGG - Intronic
1182425129 22:30267656-30267678 TGGCAGCAACCCTGTGAGGTGGG - Intergenic
1184299682 22:43550112-43550134 AAGCAGCAGCAAGCTGAGGTGGG + Intronic
1185126800 22:49015645-49015667 TATCAGCAGCAAAGCCAGGTTGG - Intergenic
1185363019 22:50420443-50420465 CAGCAGCAGAAGAGTGAGTTCGG + Intronic
1185406320 22:50653794-50653816 TCCCACCAACACAGTGAGGTGGG - Intergenic
949412998 3:3786081-3786103 TAGCAGCTGAACAGTGATTTGGG - Intronic
952206648 3:31187014-31187036 TCACAGCAGCCCTGTGAGGTAGG - Intergenic
953026774 3:39149868-39149890 TAGCAGGAGCACAGAAAGGCAGG - Intronic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953073226 3:39544503-39544525 TCACAGCAATACAGTGAGGTAGG + Intergenic
953213980 3:40900781-40900803 TAGCATGAGGAGAGTGAGGTAGG + Intergenic
953604506 3:44402707-44402729 TAGCTGGAGCACAGTCAAGTGGG + Intronic
956349393 3:68318011-68318033 TGGCAGCACCACAGTGAGTTTGG - Intronic
959452070 3:106516911-106516933 GAGCACCATCCCAGTGAGGTTGG - Intergenic
961376386 3:126468858-126468880 CAGCAACAGCACAGTGGGGGTGG - Intronic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
966261702 3:177985940-177985962 TCACAGCAACACTGTGAGGTAGG + Intergenic
966863552 3:184243814-184243836 CAGCAGGAGCAGGGTGAGGTGGG + Exonic
966964084 3:184971735-184971757 AACCAGCAGCAACGTGAGGTAGG + Exonic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
969158336 4:5232865-5232887 TACCAGCAGGATATTGAGGTGGG + Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
970749990 4:19347409-19347431 TGGCAGCTGGTCAGTGAGGTAGG + Intergenic
971351490 4:25860141-25860163 TAGCAACAGCCCTCTGAGGTAGG - Intronic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972978279 4:44663909-44663931 AAGCAGCAGCCCAGTGTGGGAGG - Intronic
973077258 4:45945009-45945031 TATCAGCGGCACAGTTATGTGGG - Intergenic
973278706 4:48337000-48337022 TATCAGTAGGACAGTGAAGTTGG - Intergenic
975044774 4:69787993-69788015 TAGCAGAAGCACCCTGATGTGGG + Intergenic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
976091104 4:81458634-81458656 TAGCTGCAGCACAGGGAAGGGGG + Intronic
978602168 4:110440217-110440239 TAACAGCAACACTGAGAGGTAGG + Intronic
979383672 4:120038298-120038320 TAGCAGAAGCACCATCAGGTTGG + Intergenic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
984872425 4:184338468-184338490 TATCATCACAACAGTGAGGTTGG + Intergenic
984919113 4:184748392-184748414 TGGCAGCAGCACAGCAGGGTGGG + Intergenic
985091183 4:186364056-186364078 TCCCAGCTGCTCAGTGAGGTGGG + Intergenic
985128678 4:186720585-186720607 TAGCAGCACCTCAGTGAGCTGGG - Intronic
986200270 5:5573063-5573085 GAGCAGCATCACAGTGACGTTGG + Intergenic
986441501 5:7786706-7786728 AAACAGCAGCACATTGAGGTGGG + Intronic
986965232 5:13262279-13262301 GAGCAGTAACACTGTGAGGTAGG + Intergenic
989743311 5:44797563-44797585 GACCAGCAGCACAATGATGTTGG - Intergenic
990317925 5:54601625-54601647 CAGCAGCAGCACAGGAAAGTGGG + Intergenic
990533203 5:56694330-56694352 GAGGATCAGCACAGTAAGGTAGG - Intergenic
990842569 5:60100145-60100167 TAGGAGCAGGACAGTGAGAAAGG + Intronic
990857781 5:60290039-60290061 TTGCTGCATCACAGAGAGGTTGG + Intronic
991941905 5:71861534-71861556 CAGCAGCAGCTCTGTGGGGTTGG + Intergenic
992134948 5:73735040-73735062 TCAAAACAGCACAGTGAGGTCGG - Intronic
992392075 5:76338539-76338561 TAGCAGCAGCAGACTGCAGTGGG - Intronic
996363945 5:122680190-122680212 GAGCAACAGCACTGAGAGGTGGG + Intergenic
996785301 5:127230661-127230683 TCCCAGCAGCACAGTGAGGCAGG + Intergenic
997468859 5:134105458-134105480 TCACAGCAGCCCAGAGAGGTAGG - Intergenic
997596708 5:135111957-135111979 TCACAGCAACTCAGTGAGGTGGG - Intronic
999247545 5:150163236-150163258 TCACAGCAGCACAACGAGGTGGG - Intergenic
999307729 5:150531258-150531280 TTACAGCAGCCCTGTGAGGTGGG + Intronic
999369594 5:151045856-151045878 GAGCAGCAGCGCAGTGAGGTAGG - Exonic
1000029428 5:157389460-157389482 TTGCAGGAGCACAGGCAGGTTGG - Intronic
1000186617 5:158864821-158864843 TGGCTGCAGCACAGTGAGCGAGG + Intronic
1000396130 5:160776468-160776490 TCACAGCAGCCCTGTGAGGTAGG + Intronic
1000721156 5:164709078-164709100 TAGCAGCAGCAAGCTGAGGCCGG - Intergenic
1001486150 5:172120958-172120980 TCGCAGTAACCCAGTGAGGTGGG + Intronic
1001573415 5:172745778-172745800 TAGCAGAAGCTCTGTGAGGTGGG - Intergenic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1002320808 5:178374583-178374605 TTACAGCAGCCCAGTGAGGTAGG - Intronic
1003168885 6:3704746-3704768 CAGTAGCAGCCCAGTGAGGCTGG + Intergenic
1003254556 6:4463371-4463393 TAGCAAAAGCCCAGTGAGGTAGG - Intergenic
1004205696 6:13589775-13589797 TAGCAGCAGCAGAGGGTGGGAGG + Intronic
1006887995 6:37398236-37398258 TAGCAGCAGCACAATAACTTTGG + Intergenic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007963541 6:45983209-45983231 ATGCAGCAGCACAGGGAGGGAGG + Intronic
1008486947 6:52046806-52046828 TCCCAGCAGCCCTGTGAGGTGGG + Intronic
1009041567 6:58185594-58185616 TAGAAGTAGCACAGTAAGATTGG + Intergenic
1009766529 6:68084176-68084198 CAACAGCACCACTGTGAGGTAGG + Intergenic
1009834054 6:68974564-68974586 TTGCGGCTGCACAGTGAGCTAGG + Intronic
1010657633 6:78530490-78530512 TAGGAACAGCACAGAGAGGATGG - Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1014136269 6:117893767-117893789 TGGCAGCATAGCAGTGAGGTTGG + Intergenic
1017926328 6:158914402-158914424 TTGCAGCAGGACAGAGAGATAGG - Intergenic
1019499027 7:1355257-1355279 TAGCTGCGGCATGGTGAGGTGGG + Intergenic
1021388691 7:20065458-20065480 TAGCAGCTGCACAATGCGGCAGG - Intergenic
1021941105 7:25679701-25679723 TAGCAGTAGTACATTGAGTTGGG - Intergenic
1022888919 7:34676004-34676026 CACCATCAGCACAGTGTGGTGGG + Intronic
1023714024 7:43024880-43024902 CAGCAGCAACACAGTGAGTAGGG - Intergenic
1023939939 7:44762882-44762904 TAGCTGCAGCACGAAGAGGTGGG - Exonic
1024308120 7:47945121-47945143 TGGCAGCAGCCCCGTGAAGTAGG - Intronic
1028007539 7:85593882-85593904 TATAACCAGCACAGTGAAGTGGG + Intergenic
1029248420 7:99219038-99219060 TAGAATCAGCCCTGTGAGGTGGG - Intergenic
1029482802 7:100823371-100823393 TGGCTGGAGCACAGTGGGGTAGG + Intronic
1029689198 7:102169614-102169636 AGGCAGCAGCTCAGTGAGTTTGG + Intronic
1035101416 7:156400551-156400573 TAGCCTCAGCCCAGTGAGGCAGG - Intergenic
1035744210 8:1950119-1950141 ATGCAGCTGCACAGTGAGGTTGG - Intronic
1037536476 8:19828929-19828951 ATGCAGCAGAACAGTGGGGTAGG + Intronic
1039537926 8:38335830-38335852 TAGCAGCAACACAGTGAAGTAGG - Intronic
1040598070 8:48859444-48859466 GTGCAGCAGCACTGGGAGGTGGG - Intergenic
1040827983 8:51644792-51644814 TAGCAGCAGCAGCGTGAAGGGGG + Intronic
1041939065 8:63366842-63366864 TAGCAGAAAGACAGGGAGGTAGG + Intergenic
1043891146 8:85654193-85654215 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043892222 8:85661030-85661052 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043893341 8:85716310-85716332 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896024 8:85737759-85737781 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896655 8:85744049-85744071 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043898978 8:85762416-85762438 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043900589 8:85774610-85774632 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043902553 8:85789885-85789907 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043904163 8:85802078-85802100 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043905775 8:85814272-85814294 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043907383 8:85826459-85826481 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1045518405 8:102881275-102881297 TAGCAGTAGCACTGTGAAGCTGG - Intronic
1045640174 8:104241102-104241124 TAGAAGCAGCTTAGTGGGGTGGG - Intronic
1046970206 8:120215047-120215069 TAGCAGCAGGCCACTGATGTAGG + Intronic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047285600 8:123484865-123484887 AAGCAGCAGCAAGGGGAGGTGGG + Intergenic
1048216940 8:132504871-132504893 CAGCAGCAGCCCTGTGAGGAAGG - Intergenic
1048912867 8:139152848-139152870 CAGCAGCAGCACAGAGGGGTGGG - Intergenic
1048937041 8:139366027-139366049 AAGGAGCAGCACCGTGAGGGAGG + Intergenic
1050001532 9:1082609-1082631 TAGAACCAGCACACTGTGGTAGG - Intergenic
1050251257 9:3747308-3747330 TAGCCCCAGCACAATGAGGCTGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050886551 9:10773709-10773731 TACCAGCAGAAGACTGAGGTTGG - Intergenic
1052213482 9:25935914-25935936 AAGCAGCAGCACAGGGAAGCAGG + Intergenic
1052503433 9:29322670-29322692 TAGGAGCAGAACATTGAGTTGGG - Intergenic
1053569322 9:39288023-39288045 AAGCAGCAGCACCTTGAGGACGG + Exonic
1053835279 9:42129053-42129075 AAGCAGCAGCACCTTGAGGACGG + Exonic
1054090954 9:60847007-60847029 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054112365 9:61122563-61122585 AAGCAGCAGCACCTTGAGGACGG + Intergenic
1054127820 9:61330987-61331009 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1054595345 9:67059578-67059600 AAGCAGCAGCACCTTGAGGACGG - Intergenic
1056573464 9:87836069-87836091 TCACAGCAGCCCTGTGAGGTAGG - Intergenic
1057421288 9:94915001-94915023 TATCAGAAGCACCGGGAGGTAGG - Intronic
1058574210 9:106382581-106382603 TCACAACAGCCCAGTGAGGTAGG + Intergenic
1059620054 9:115994136-115994158 TCGCAGCAGCACTGTTATGTAGG + Intergenic
1060214884 9:121732779-121732801 AAGCAGAAGCACAGAAAGGTTGG - Intronic
1061159967 9:128888066-128888088 TTACAGCAGCAGAGGGAGGTCGG + Intronic
1061546988 9:131310055-131310077 AGGAGGCAGCACAGTGAGGTGGG + Intergenic
1187472380 X:19580561-19580583 CAGCAGCAGCACTGGGAGCTTGG + Intronic
1187990424 X:24864965-24864987 TTGCAGCAACCCTGTGAGGTGGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1190075390 X:47313281-47313303 AAGCAGCAGCACAGTAAAGTTGG + Intergenic
1190369354 X:49726681-49726703 CAGCTGCAGAACAGTGTGGTCGG + Intergenic
1191853448 X:65603371-65603393 TAACAGCAGCCCTGTAAGGTCGG + Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1193488901 X:82122915-82122937 CAGCAGTAGCACTGTGGGGTGGG + Intergenic
1193790245 X:85808327-85808349 ACGCAGCAGCAAAGTGATGTGGG + Intergenic
1195085235 X:101407581-101407603 AAGCAGCAGCAGAGTCGGGTGGG + Intronic
1196130141 X:112146625-112146647 AAGCAGGAGGTCAGTGAGGTAGG + Intergenic
1199701644 X:150382244-150382266 TAAAAGCAGTTCAGTGAGGTGGG - Intronic
1200085243 X:153601038-153601060 TGTCAGCAGCACAGGGAGCTGGG - Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic