ID: 962358477

View in Genome Browser
Species Human (GRCh38)
Location 3:134715180-134715202
Sequence GGCTCTGTATGGAGGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962358477_962358480 -8 Left 962358477 3:134715180-134715202 CCATCTCTCCTCCATACAGAGCC 0: 1
1: 0
2: 3
3: 49
4: 350
Right 962358480 3:134715195-134715217 ACAGAGCCCGAATCCAGCTGTGG 0: 1
1: 0
2: 2
3: 10
4: 154
962358477_962358487 24 Left 962358477 3:134715180-134715202 CCATCTCTCCTCCATACAGAGCC 0: 1
1: 0
2: 3
3: 49
4: 350
Right 962358487 3:134715227-134715249 TTATGAGCCCATGTGGAGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 153
962358477_962358486 23 Left 962358477 3:134715180-134715202 CCATCTCTCCTCCATACAGAGCC 0: 1
1: 0
2: 3
3: 49
4: 350
Right 962358486 3:134715226-134715248 TTTATGAGCCCATGTGGAGTAGG 0: 1
1: 0
2: 0
3: 17
4: 119
962358477_962358485 17 Left 962358477 3:134715180-134715202 CCATCTCTCCTCCATACAGAGCC 0: 1
1: 0
2: 3
3: 49
4: 350
Right 962358485 3:134715220-134715242 TTCTGTTTTATGAGCCCATGTGG 0: 1
1: 0
2: 1
3: 17
4: 211
962358477_962358488 25 Left 962358477 3:134715180-134715202 CCATCTCTCCTCCATACAGAGCC 0: 1
1: 0
2: 3
3: 49
4: 350
Right 962358488 3:134715228-134715250 TATGAGCCCATGTGGAGTAGGGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962358477 Original CRISPR GGCTCTGTATGGAGGAGAGA TGG (reversed) Intronic
900346854 1:2214311-2214333 GGCCCTGCCTTGAGGAGAGAGGG + Intergenic
901617755 1:10555346-10555368 GACTCTGTATGTAGGGAAGAAGG - Intronic
902512870 1:16975680-16975702 GCCTGTGTATGGAGTAGAGGCGG + Exonic
902926131 1:19696916-19696938 GGCTCTGTATGGTCCAGAGCCGG - Intronic
903014500 1:20353307-20353329 CCCTCTGTATGTAGGACAGATGG + Intronic
903646954 1:24901745-24901767 GCCTCTCTCTGGAAGAGAGATGG + Exonic
906228157 1:44138985-44139007 GGCCCTCTATGGAGGCCAGATGG - Intergenic
906715386 1:47964964-47964986 TGCCCTGAATGGAGGAGAAAAGG - Intronic
906725243 1:48039807-48039829 GGCTCTGCAGGGAGGAAACAGGG + Intergenic
907053612 1:51345452-51345474 GGCTCTGTATGTAGGGAGGAGGG - Intergenic
907432365 1:54420580-54420602 GGCTCTGGAAGGGAGAGAGAAGG - Intergenic
907674841 1:56508849-56508871 GACCCTGGATTGAGGAGAGATGG - Intronic
908111932 1:60906349-60906371 GGCACTAAATGGAGGCGAGAGGG + Intronic
912402426 1:109406292-109406314 GGTTCTGTTTGGAGGAGACTTGG + Intronic
912423945 1:109569256-109569278 GACTCTGTATGCAGAAGGGATGG - Intronic
912450984 1:109767642-109767664 GCCACTGTCTAGAGGAGAGAAGG + Intronic
912786261 1:112606833-112606855 GGCTTTGTAAGAAGAAGAGAGGG - Intronic
913139170 1:115923255-115923277 TGGTCTGTATGGAGCAGGGAGGG - Intergenic
915108129 1:153546914-153546936 TGCTCTGTATGGAGGGGTAAGGG - Intronic
915518676 1:156428932-156428954 GGCCATGTCTGGTGGAGAGAAGG + Intronic
916058408 1:161083391-161083413 GACACTGGGTGGAGGAGAGAAGG - Intronic
916198137 1:162244148-162244170 GGCATGGGATGGAGGAGAGAAGG + Intronic
917333009 1:173901793-173901815 GCCTCTGAAAGGAGGAGAAAAGG + Exonic
919907407 1:202087278-202087300 GGGTGTGTATGGGGGAGGGAGGG + Intergenic
920984801 1:210876766-210876788 AGCTCTGTATGGGGCAGTGAAGG + Intronic
921346110 1:214187234-214187256 GCCTCTGTTTGCAGGAGAGGTGG + Intergenic
921579119 1:216874534-216874556 GCCTCTGTATGGAAGGAAGAAGG - Intronic
922228447 1:223665654-223665676 GGCTCTGTAGGGTGGACAGAAGG + Exonic
922230640 1:223682584-223682606 AGTTCTGCATGGAGGAGATATGG - Intergenic
922599770 1:226841071-226841093 GAATTTGTTTGGAGGAGAGAAGG - Intergenic
924263614 1:242257323-242257345 AGGTCTGTGTGCAGGAGAGAAGG + Intronic
924593000 1:245421288-245421310 GGTTCAGTTTGGAGAAGAGAAGG + Intronic
924799462 1:247317168-247317190 GACTCTGAAAGGTGGAGAGAGGG + Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1062996917 10:1874723-1874745 GGTACCGGATGGAGGAGAGAGGG + Intergenic
1063158437 10:3401030-3401052 GACTCTGTCTGGAGAAGGGAAGG + Intergenic
1064450111 10:15434522-15434544 AGCGATGTATGGAGGAGAGAAGG - Intergenic
1066721180 10:38341150-38341172 AGGTCTGTGTGCAGGAGAGAAGG - Intergenic
1067439341 10:46299890-46299912 AGCTCTGCATGGGGGAGAGGCGG - Intronic
1067576086 10:47409530-47409552 AGCTCTGCATGGGGGAGAGGCGG - Intergenic
1069187074 10:65437282-65437304 GGGTGTGAATGGAGCAGAGAGGG - Intergenic
1069440378 10:68423307-68423329 GACTCTGAAAGGTGGAGAGAAGG + Intronic
1069958759 10:72067577-72067599 TGCTCTGCCTGGAGGAGGGAGGG - Intronic
1070097565 10:73352608-73352630 GACTCTGAAAGGTGGAGAGAAGG - Intronic
1070160571 10:73864418-73864440 GGTTGTGTATGGGGGAGGGATGG + Intronic
1071137029 10:82465209-82465231 GGCTCTGGCTGAAGCAGAGATGG + Intronic
1071284227 10:84129525-84129547 GGGTCAGAATGGAGGGGAGAAGG - Intergenic
1071784290 10:88881045-88881067 GGCGCGGTGTGGAGGAGGGAGGG + Intronic
1072666093 10:97393632-97393654 GGCTTTTTGTGGAGGGGAGAAGG - Intronic
1072740170 10:97904370-97904392 GGTGCTGTAGGGAGGAGTGAGGG + Intronic
1074414609 10:113256432-113256454 GGTGGAGTATGGAGGAGAGATGG - Intergenic
1074957870 10:118410340-118410362 GGCTCAGGAGGGAGGTGAGATGG - Intergenic
1075448000 10:122527014-122527036 GGCGATGAATGGGGGAGAGATGG + Intergenic
1075520330 10:123139859-123139881 GGCTCTGGTTGGAGGGAAGAAGG + Intergenic
1075731066 10:124637180-124637202 TGCTCAGAATGGAGGAGAGATGG - Intronic
1075985555 10:126782405-126782427 TGCTCTGTATGGGGGAGTCAAGG + Intergenic
1076710503 10:132331451-132331473 GCCTCTGGACGGAGGAGTGAGGG - Intronic
1077040701 11:520719-520741 GACCCTGGATGGAGGGGAGAGGG - Intergenic
1077142968 11:1032947-1032969 GGCCCGGTGTGCAGGAGAGAGGG - Intronic
1077488428 11:2849728-2849750 GGCTCTGGAAAGAGGACAGAAGG - Intergenic
1077917135 11:6618771-6618793 GGCACCGTATTGAGGAGAGCTGG + Exonic
1078339484 11:10488701-10488723 GGCTTTGCTTGGAGGAGGGATGG + Intronic
1079302227 11:19288110-19288132 GACTCTGCATGGAGGTGACAGGG + Intergenic
1079334122 11:19556013-19556035 GGCTTTGAAAGGAGGAGGGAAGG - Intronic
1079798698 11:24841451-24841473 GTCTTTGTATGGAGCAGATATGG + Intronic
1080057304 11:27919679-27919701 GGCTGGGTTTGGGGGAGAGATGG - Intergenic
1081687801 11:45054887-45054909 GGCTCTGGAAGGAGGAGGGGAGG - Intergenic
1082005876 11:47418725-47418747 GGCTCTGGCTGGAGGAGTGGGGG - Intergenic
1083106236 11:60361003-60361025 GGCTCAGAATGGAGGAGTGCAGG + Intronic
1083945724 11:65921481-65921503 TGCTCTGGGGGGAGGAGAGAAGG + Exonic
1084531575 11:69730782-69730804 GGCTCTCTTTGGAGGAGAGGAGG + Intergenic
1084913673 11:72411617-72411639 GGCTCTGTTTGTGGGAGGGAGGG + Intronic
1084956988 11:72696825-72696847 GGCTCTGTATGGAGCGGCGATGG + Intronic
1085863623 11:80262390-80262412 GGCTCTGAAAGGTGGAGAGAAGG - Intergenic
1086291416 11:85314866-85314888 GGTTCTGTATGAAGGTGAAATGG - Intronic
1086518075 11:87637246-87637268 GGCTCTGTATGGATAAGATAGGG + Intergenic
1088902581 11:114129261-114129283 TGCTCTGTTTAGAGGTGAGAGGG + Intronic
1088924114 11:114283199-114283221 GTCTCTATATGAAGGAGACATGG + Intronic
1089300209 11:117494048-117494070 GGCTGTGTTTGGAGAAGTGAGGG - Intronic
1089313159 11:117573430-117573452 GGTTCTGAATGGAAGAGAGATGG - Intronic
1090422384 11:126584447-126584469 GGCTTTGTATGGGGAAGAAAGGG - Intronic
1091008683 11:131978040-131978062 GGCTCTGTGGTCAGGAGAGAAGG + Intronic
1091312317 11:134583407-134583429 GGCTTTGTGTGGGGGCGAGATGG + Intergenic
1091328854 11:134714505-134714527 GGCTCTGAATGCTGGAGAGAAGG + Intergenic
1092122242 12:6052632-6052654 GGCTCTACATGGATGAGAGGGGG - Exonic
1092880902 12:12887179-12887201 AGCTCAGTCTGGTGGAGAGATGG - Intergenic
1094297961 12:28928896-28928918 GCCTGTGTATGGAGTGGAGAGGG + Intergenic
1094408495 12:30145146-30145168 GGCTCTGTATTGAGGGGGAAGGG - Intergenic
1096464394 12:51840292-51840314 GGCCCTGCATGGGCGAGAGATGG + Intergenic
1098003202 12:65967779-65967801 GGCTGAGGATGGAGGAGAGAGGG - Intergenic
1099413836 12:82362708-82362730 GTTTCTGTGTGGAGAAGAGAAGG + Intronic
1100140046 12:91606682-91606704 GGCTTAGAATAGAGGAGAGATGG + Intergenic
1100183712 12:92113495-92113517 GGCTCTCTATTGAGGAGGGGGGG - Intronic
1100636179 12:96436646-96436668 GGCTCTGTTAGCAGGAAAGAAGG + Intergenic
1100870375 12:98904604-98904626 GGCACTGGCAGGAGGAGAGAAGG - Intronic
1102016906 12:109654231-109654253 GGCTGTGACTGGGGGAGAGAGGG - Intergenic
1102851463 12:116249898-116249920 GTCTCAGAATGTAGGAGAGAAGG + Intronic
1103866382 12:124055218-124055240 GGCTCTGTGTGGAAGAGAAAGGG - Intronic
1103979376 12:124726643-124726665 GGAGCTGTATGGAGAGGAGAGGG - Intergenic
1103993954 12:124817209-124817231 GGTTCTTTATGGAGCAGGGAGGG - Intronic
1105699132 13:22922810-22922832 AGCTCTCTATGGAGGAGGGCTGG - Intergenic
1106580553 13:31014471-31014493 GGCTCAGCATGGGTGAGAGATGG + Intergenic
1108000446 13:45901131-45901153 GGCTCTGAAGGGTGGTGAGACGG + Intergenic
1108196469 13:48000881-48000903 GGCTCTGAGTGGAGGTGAGGGGG - Intronic
1108317428 13:49250447-49250469 GGCTCTATATGGGGAAGTGAAGG + Intronic
1108576583 13:51796443-51796465 GTATCTGTATGGAGGTGAGGGGG + Intronic
1109046976 13:57425483-57425505 GGATCTGCATGAAGCAGAGATGG - Intergenic
1109083643 13:57941678-57941700 GTCTCTGAAAGTAGGAGAGAAGG + Intergenic
1109309204 13:60672293-60672315 GCCTCCGTGTGGAGCAGAGAGGG + Intergenic
1109960834 13:69627871-69627893 GGGTCTGTATGGAGCAAAAATGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1112574116 13:100620250-100620272 GGCACTGGATGGTGGGGAGAGGG + Intronic
1113640388 13:111953025-111953047 GACTCAGGAGGGAGGAGAGATGG + Intergenic
1113954988 13:114095394-114095416 GGGACTGTAGGGAGGGGAGATGG - Intronic
1114319280 14:21533577-21533599 GACTCTGTAGGGGAGAGAGAAGG + Intronic
1114323918 14:21570078-21570100 TGATCTGTATGTAGGAGAGGAGG + Exonic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114559957 14:23582468-23582490 GGCTCTGTGTGGAGAAGGAAAGG - Intergenic
1116635185 14:47385722-47385744 TGCTCTCTTTGGAGGAAAGAAGG + Intronic
1117619380 14:57568868-57568890 GGATTTCTATGGAGAAGAGAGGG + Intronic
1118129332 14:62945070-62945092 GGCTATTCATGAAGGAGAGAAGG + Intronic
1118306790 14:64661757-64661779 CGCTGTGTGTGGAGGAGAAAGGG + Intergenic
1119187116 14:72650840-72650862 GGGTGTCTGTGGAGGAGAGATGG - Intronic
1121329265 14:93039908-93039930 GGCCCTGTGGGGAGGACAGAGGG - Intronic
1121512433 14:94522371-94522393 GGCACTGTGGGGAAGAGAGAAGG - Intergenic
1122593641 14:102873240-102873262 CGCTCTGGAAGGGGGAGAGATGG + Intronic
1122857393 14:104566386-104566408 GGCTCTCTGGGAAGGAGAGAAGG + Intronic
1123139325 14:106060087-106060109 GTCCCTGACTGGAGGAGAGAGGG - Intergenic
1123758382 15:23414547-23414569 GGCTCTAGATGCCGGAGAGAAGG - Intergenic
1124636838 15:31371021-31371043 GGGTCTGTATGGGGGTGAGAGGG + Intronic
1124793348 15:32751091-32751113 GACTCTGTGTGCAGGAGAGATGG + Intergenic
1127092597 15:55481574-55481596 TGCTCTGTCTAGTGGAGAGAGGG - Intronic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1129985826 15:79919259-79919281 GGCTCTGTGTGGAAGAGGGCAGG - Intronic
1130088767 15:80801639-80801661 GGATCTGAGGGGAGGAGAGAAGG + Intronic
1130124948 15:81085375-81085397 GTCTCTGTATTAAGGAGATAAGG - Intronic
1130871625 15:87976536-87976558 GGCCCTGTATGCAGGAGAGATGG - Intronic
1131585093 15:93684435-93684457 GCCTGGGTATGGAGCAGAGAGGG - Intergenic
1132310566 15:100854468-100854490 GGCTGTGTGTGCAGGAGAGCAGG + Intergenic
1133088832 16:3387620-3387642 GGCTCAGTGTGGAGAAGAGGGGG - Intronic
1133619743 16:7514767-7514789 ATCTCTGTATTGAAGAGAGAAGG - Intronic
1134076568 16:11296182-11296204 CGCCCTGTCTGGAGGTGAGAGGG - Intronic
1134395470 16:13858590-13858612 TGCTCTGGATGAAGGAGTGAGGG - Intergenic
1137019980 16:35415076-35415098 GGGTCAGTATGGAGGAGAGGGGG - Intergenic
1138656193 16:58492905-58492927 GGCTCTGCAGGGAGGAGGGAAGG - Intronic
1140141291 16:72260469-72260491 GGCTCTGGAAGGAAAAGAGATGG + Intergenic
1140421383 16:74822091-74822113 GGCAGTGAAAGGAGGAGAGATGG - Intergenic
1142307059 16:89291592-89291614 TGCACTGTTTGGAGGAGGGACGG - Intronic
1142906036 17:3042494-3042516 GACCCTGCACGGAGGAGAGATGG + Intergenic
1143920049 17:10323949-10323971 CTCTCTGTAAGGAGGAGAAAGGG - Intronic
1143976157 17:10831486-10831508 GGCTATGTGCAGAGGAGAGATGG + Intronic
1144347088 17:14359270-14359292 TGCTCTGCATGGAGAACAGATGG - Intergenic
1146273568 17:31500029-31500051 GGCTCTGTTTGCAGGGCAGAGGG + Intronic
1146645984 17:34578040-34578062 GGCTCTGTGTGGGGGAGAAAGGG - Intronic
1146667178 17:34712967-34712989 GGCCCTGTAGGGAGGACAGGAGG + Intergenic
1146745110 17:35321816-35321838 TGCTCTGTCTGGTGGGGAGAGGG - Intergenic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147318333 17:39631699-39631721 GGCTGGGAAGGGAGGAGAGAAGG + Intronic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148349740 17:46931980-46932002 GGCTTTGTACTGAGGAAAGACGG - Intronic
1149613192 17:57973525-57973547 GGCTCTGATTGGGAGAGAGAGGG + Intronic
1149979353 17:61297284-61297306 GGCTGGGGATGGAGGAGAGAAGG + Intronic
1151381296 17:73727471-73727493 GGGTGTGTGTGGAGGAGAAAGGG + Intergenic
1152048007 17:77951241-77951263 GGCTCTGGAGGGAGGACAGGAGG + Intergenic
1152336579 17:79702531-79702553 GGGTCAGGAGGGAGGAGAGAGGG + Intergenic
1152397548 17:80043561-80043583 GACTCCTTATGGAGGTGAGATGG - Intronic
1152561052 17:81078979-81079001 GGCTCAGCCTGCAGGAGAGATGG + Intronic
1153313693 18:3701886-3701908 GGCTCTGTGTGTGTGAGAGACGG + Intronic
1153746587 18:8185896-8185918 GACTGTGTATGGAGGAGGTAAGG - Intronic
1156084250 18:33379950-33379972 GGCTGGGTGTGGAGCAGAGAGGG + Intronic
1156084395 18:33381254-33381276 AGCTGGGTATGGAGCAGAGAGGG + Intronic
1156566308 18:38195213-38195235 GGATCTCTTTGGAAGAGAGATGG + Intergenic
1157469964 18:47981649-47981671 GGCCCTGGAGAGAGGAGAGAGGG + Intergenic
1157537482 18:48470640-48470662 GGATCTGGGTGGAGCAGAGAGGG + Intergenic
1158349623 18:56551626-56551648 AGCTCTGTGTGGTGGTGAGATGG + Intergenic
1158461348 18:57648709-57648731 GGATCTGCAAGGGGGAGAGATGG + Exonic
1160306052 18:77738019-77738041 GGCTCAGGAAGGTGGAGAGAAGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1161037490 19:2093515-2093537 GGCTGTGTATTTAGTAGAGATGG + Intronic
1161411912 19:4122199-4122221 GGGTCCCTATGGGGGAGAGATGG - Intronic
1161411925 19:4122229-4122251 GGGTCCCTATGGGGGAGAGATGG - Intronic
1161411938 19:4122259-4122281 GGGTCCCTATGGGGGAGAGATGG - Intronic
1161411964 19:4122319-4122341 GGGTCCCTATGGGGGAGAGATGG - Intronic
1161411977 19:4122349-4122371 GGGTCCCTATGGGGGAGAGATGG - Intronic
1161411990 19:4122379-4122401 GGGTCCCTATGGGGGAGAGATGG - Intronic
1162287623 19:9751322-9751344 GGGGCTGTATGGAGGAGTGATGG - Intergenic
1162349164 19:10138405-10138427 GGCAGTGTGTGGAGGAGCGACGG + Intronic
1163509304 19:17725810-17725832 GGATCTGTATGGAGGAGGAGTGG - Exonic
1164713285 19:30374733-30374755 CGCCCTCTCTGGAGGAGAGAGGG - Intronic
1164749597 19:30642760-30642782 GGCTCTGTCTGAGGGTGAGATGG + Intronic
1164870741 19:31640701-31640723 GGCTCTGGAAGGAGGGAAGATGG + Intergenic
1165068555 19:33242207-33242229 GCCTCAGGATGGAGGAGGGAAGG + Intergenic
1165317798 19:35067149-35067171 GGCCCTGTAAGGTGGAGATAGGG + Intergenic
1166127653 19:40725321-40725343 TGCTCTGTAGGGAGCAGAGCAGG - Exonic
1166798867 19:45443999-45444021 GGCCCGGTATGGATGAGTGAAGG - Intronic
1166959365 19:46488503-46488525 GGCTCTGTAGAGAGGAGGGCAGG - Intronic
1167266498 19:48485507-48485529 GGCTCTCTATGGAGGGGCGGGGG + Exonic
1167488947 19:49780924-49780946 GGTTCTGTTTGGAGGAGAAGAGG + Intronic
1167618496 19:50548872-50548894 GGCTGTGGGTGGGGGAGAGAAGG + Exonic
925832165 2:7906573-7906595 GGCTGTGGATGGAGAAGAAAGGG + Intergenic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927080721 2:19627191-19627213 GGTTCTGGAAGGAGAAGAGATGG + Intergenic
927252320 2:21007825-21007847 GGCACTGTTTGGAGAAGGGAAGG - Exonic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928871021 2:35979683-35979705 GGCTGTGTGAGGATGAGAGATGG - Intergenic
929902614 2:46018497-46018519 GGCACTGTATAGAGGCCAGAAGG - Intronic
932636027 2:73388432-73388454 GGCTCCAGAAGGAGGAGAGAAGG - Intronic
932954898 2:76339700-76339722 GGCAGTCTATGGAGGAGAGGTGG - Intergenic
933086231 2:78058064-78058086 TTCTCTGTATGGAGTTGAGATGG + Intergenic
933200697 2:79444767-79444789 GTCTCTGCAAGGAGGAGAAAGGG + Intronic
933428239 2:82140923-82140945 GGATGTCTATAGAGGAGAGAGGG + Intergenic
933645650 2:84810724-84810746 GGTTCTGTCTGGAGGAGAGTGGG - Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
934935679 2:98463660-98463682 GGGTCTGTCTGTAGGAGAGCAGG + Intronic
936271828 2:111054917-111054939 GACTGTGCATGGAGGAGAAAGGG + Intronic
937298846 2:120826181-120826203 AGTTCAGCATGGAGGAGAGAGGG + Intronic
940004904 2:149001526-149001548 GGCTTTGGGTGGAGGAGTGATGG + Intronic
940568792 2:155404359-155404381 GCCACTGTATGGAGCAGAAAGGG - Intergenic
941867352 2:170348776-170348798 GGCTCTAGATGTAGGAGAGCTGG + Intronic
942198262 2:173544394-173544416 AGTTCTGTGAGGAGGAGAGATGG - Intergenic
943055579 2:182974282-182974304 GGGTCTGTATGCAGTAGAAAGGG + Intronic
943782325 2:191838044-191838066 GGCTCTGGTTGCAGGAGAGGTGG - Intronic
944527435 2:200634334-200634356 GACTCTGAAAGGTGGAGAGAAGG - Intronic
944607308 2:201363641-201363663 GCCTGAGCATGGAGGAGAGAGGG - Intergenic
946039984 2:216774992-216775014 GGCTCTACCTGGAGAAGAGAGGG + Intergenic
946854088 2:223935865-223935887 GGGTCTGAATACAGGAGAGAGGG + Intronic
948829079 2:240588841-240588863 GGCTCTGAGGGCAGGAGAGAGGG + Intronic
1173089888 20:39960463-39960485 GTCTCTATATGGAGCAAAGAGGG - Intergenic
1173133346 20:40415421-40415443 AGCACTGCATAGAGGAGAGAAGG + Intergenic
1173565072 20:44032655-44032677 GGCTCTGAGCAGAGGAGAGAGGG + Intronic
1174117551 20:48237737-48237759 GGCTCTGAATGGAGAACACAGGG - Intergenic
1175205304 20:57306712-57306734 GGCTGTGTACTGGGGAGAGAAGG - Intergenic
1177678716 21:24336652-24336674 GTCTCTATATGGAGGCAAGATGG - Intergenic
1178122243 21:29481066-29481088 GGCTCTGTAGAGTGAAGAGAAGG + Intronic
1179340863 21:40507893-40507915 GGGTCTGTATGCAGGAGTGGAGG - Intronic
1179603910 21:42499652-42499674 GGCTCTGCAGGGAGGAGGGAGGG + Intronic
1180029146 21:45191077-45191099 GGGTCTCTATGGGGGAAAGAGGG + Intronic
1180747835 22:18103697-18103719 GGCTCTGTATGGGACAGAGACGG - Exonic
1180956133 22:19742179-19742201 GCCTCAGTCTGGAGGAGGGACGG + Intergenic
1181033814 22:20160497-20160519 GGCTCTGCAGGGAATAGAGAGGG + Intergenic
1181109009 22:20590580-20590602 AGCTCTGCTTGGAGGAGGGAAGG + Intergenic
1181981597 22:26770712-26770734 GGCTGTGTAGGGAGCAGACAGGG + Intergenic
1182735973 22:32532566-32532588 GCCTCTCTGGGGAGGAGAGAGGG + Intronic
1183218033 22:36493800-36493822 TGTTCTGTGGGGAGGAGAGAGGG + Exonic
1183653427 22:39171782-39171804 GGCGCCGGATGGAGGATAGAGGG + Intergenic
1183661436 22:39223903-39223925 GGCTGGGAATGGGGGAGAGAAGG - Exonic
1183749468 22:39711659-39711681 GGCTCTGTGTGCAGCAGAAAAGG + Intergenic
1184101709 22:42344386-42344408 AGCTCGGTTTGGAGAAGAGAAGG + Intergenic
950314247 3:11986550-11986572 GCCTCTGTGGGGAGCAGAGAGGG + Intergenic
954145551 3:48632663-48632685 GGCTCTCTGTGGAGTAGGGAAGG + Intronic
954428944 3:50458995-50459017 GGCTCTGTGTGCAGGGGACAGGG + Intronic
954665262 3:52248134-52248156 GGCCCTGGATTGAGGAGAGAAGG - Exonic
956272796 3:67465642-67465664 GACTCTGAGTGAAGGAGAGAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957612562 3:82487015-82487037 GCCTCTGGATGTAGGAGAAAAGG + Intergenic
957987644 3:87591616-87591638 GTCTCTGTCAGGAGGGGAGAGGG - Intergenic
958156472 3:89761843-89761865 GCTTCAGTATGGAGCAGAGAGGG + Intergenic
959498137 3:107074754-107074776 GGCACTTTGTGGTGGAGAGATGG + Intergenic
959516072 3:107268640-107268662 AGCTTTCTATGAAGGAGAGAAGG + Intergenic
960509118 3:118526817-118526839 GACTCTGTAGATAGGAGAGAAGG - Intergenic
960952725 3:123010108-123010130 GGCTCTGGATGGGTGAGAGGCGG + Intronic
961039123 3:123664414-123664436 GACTCTGGATGTAGGAGAGAAGG - Intronic
961325463 3:126106730-126106752 GACACTGCATGGAGCAGAGATGG + Intronic
961449992 3:126998340-126998362 GTCACAGGATGGAGGAGAGAGGG + Intronic
961486007 3:127217003-127217025 GGCCCGGGATGGTGGAGAGAAGG - Intergenic
961657059 3:128448794-128448816 GGCTATGTGTGGTAGAGAGAAGG - Intergenic
962358477 3:134715180-134715202 GGCTCTGTATGGAGGAGAGATGG - Intronic
962417837 3:135200063-135200085 TGCTCTGACTGGAGGAGAGATGG - Intronic
965516784 3:169630108-169630130 TGCTGTGTGTTGAGGAGAGAAGG - Intronic
965626864 3:170690456-170690478 GGCTCTGTGGGCAGGAGAGTGGG + Intronic
965800499 3:172488410-172488432 GGCTCTGTTTTCTGGAGAGATGG - Intergenic
966611564 3:181872985-181873007 GGATCTGGATGGAGGAGATGTGG + Intergenic
967785060 3:193483935-193483957 GTCTCTGTATGTGGGAGAAAAGG - Exonic
968760887 4:2442400-2442422 TCCTCTGCATGGAGAAGAGAAGG + Intronic
970067527 4:12116073-12116095 GGCTGGGTGTGGAGCAGAGAGGG + Intergenic
970651404 4:18182411-18182433 GGAACGGTATGGGGGAGAGAGGG + Intergenic
970705958 4:18802817-18802839 TGCTCTGAATGGAGGAAAGATGG + Intergenic
972430286 4:38975216-38975238 GGATGTGTGTGGAGGAGAGCAGG - Intronic
974929912 4:68349995-68350017 GGCTAGGTATGGGGGAGGGAAGG + Exonic
975251216 4:72180357-72180379 GGCTCTTTATGGTAGTGAGATGG + Intergenic
975869089 4:78758310-78758332 GACTCTGAAAGGTGGAGAGAGGG - Intergenic
976133843 4:81913632-81913654 GGCTCTGTAGGAAGAAGAAAAGG - Intronic
977550886 4:98442157-98442179 GCCGCTGGATGGAGGACAGAGGG - Exonic
978161440 4:105552839-105552861 GACTCTATATGCTGGAGAGAAGG + Exonic
978604023 4:110459583-110459605 GGCTCTGAATGGAACAGAAAGGG + Intronic
980242508 4:130195111-130195133 GTCTCTGGGTGGAGGAGAAAGGG - Intergenic
983737385 4:171078932-171078954 GGGCCTGGGTGGAGGAGAGAGGG - Intergenic
986751381 5:10790905-10790927 GGCTTTGTTGGGAGGTGAGATGG + Intergenic
992135022 5:73735938-73735960 GTCTCTGTATGGATGGGAGAGGG - Intronic
993002368 5:82394330-82394352 GGTTCAGTTTGGAGGACAGAGGG - Intergenic
994973151 5:106769266-106769288 TGGTCTGTCTAGAGGAGAGATGG - Intergenic
995388685 5:111615622-111615644 GCCTCGGTATGGAGCAAAGAGGG + Intergenic
997362061 5:133301462-133301484 GGCTCTGTCTGAAGGGGATAAGG + Intronic
997792451 5:136772873-136772895 GGCTATGTGTGGAGTAGAGGTGG - Intergenic
998418642 5:141963956-141963978 GGCTCTGTAAGGAGGAAAGAGGG - Intronic
998903041 5:146876625-146876647 TGCTCTGTATAGGGGAGGGATGG + Intronic
999242551 5:150136290-150136312 GGCTCTGGGTGGGAGAGAGATGG + Intronic
1000075338 5:157779319-157779341 GGCGGGGAATGGAGGAGAGAGGG + Intergenic
1001098417 5:168794386-168794408 GGCTCTGCAGGGAGGACAGTAGG - Intronic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1002307359 5:178291659-178291681 GGCTCTGCAAGGAGGAGCGATGG + Intronic
1002388144 5:178886474-178886496 GGCCCTGTATGTAGGAGAAAAGG + Intronic
1002581052 5:180209506-180209528 GGCCCAGTCTTGAGGAGAGAGGG - Intergenic
1003089421 6:3089028-3089050 GTCTCTGAAAGGAGAAGAGAAGG - Intronic
1005147835 6:22711753-22711775 GGCCCTGGATGGATGAGGGAGGG + Intergenic
1005838187 6:29723554-29723576 GCCTCTGTGGGGAGGAGTGAGGG + Intronic
1006798314 6:36744519-36744541 GGCTGCGCCTGGAGGAGAGAGGG + Intronic
1007278515 6:40693088-40693110 GGCTGTGTGTGGGGGCGAGAGGG - Intergenic
1007561046 6:42808670-42808692 GGGTGTGTGTGGGGGAGAGATGG + Intronic
1007690158 6:43695659-43695681 GGCTCTGTCTGGATGAAGGAAGG + Intergenic
1008086351 6:47248837-47248859 GGCTCTGGAGGCAAGAGAGATGG - Intronic
1009414017 6:63396165-63396187 GGCTGGGTAGGGTGGAGAGACGG + Intergenic
1009702642 6:67202769-67202791 GGGCCTTCATGGAGGAGAGAGGG - Intergenic
1011634917 6:89362723-89362745 GGGTCTGTATGAAGGATGGATGG + Intergenic
1013066347 6:106687730-106687752 AGATATGTATGGAGAAGAGAGGG + Intergenic
1013180637 6:107714333-107714355 GGGTCAGTAGGGAGGAGGGATGG - Intronic
1016460777 6:144278596-144278618 CTCTCTGTATTGAGGAGAGATGG - Intergenic
1018943666 6:168329384-168329406 GGCACAGCATGGAGGTGAGAGGG - Intergenic
1018943670 6:168329405-168329427 GGCACATTATGGAGGTGAGAGGG - Intergenic
1018943692 6:168329487-168329509 GGCACAGCATGGAGGTGAGAGGG - Intergenic
1018943713 6:168329568-168329590 GGCACAGCATGGAGGTGAGAGGG - Intergenic
1019062633 6:169266957-169266979 GGTTCTGCATGGAAAAGAGATGG - Intergenic
1019952487 7:4384836-4384858 GGTTCTGTATGGAGGGTGGAGGG - Intergenic
1020401980 7:7789614-7789636 GGGTCTGTGGGGAGGGGAGAAGG - Intronic
1020566021 7:9796550-9796572 GAATCTGTATTGAAGAGAGAGGG - Intergenic
1021683874 7:23162557-23162579 GGCTCTGTATGGAGGAGCTATGG - Intronic
1022537403 7:31106701-31106723 GCCTGTGGATGGAGGAGAGGAGG - Exonic
1023475884 7:40577283-40577305 TACTCTGAGTGGAGGAGAGAGGG + Intronic
1023870079 7:44258607-44258629 TGTTCTGTGTGGAGGAGAGGGGG + Intronic
1024022928 7:45387573-45387595 GGCTCTGTCTGCAGGTGAGAGGG + Intergenic
1024356322 7:48416828-48416850 AGCTCTGTAGGGAAGAGAGTGGG - Intronic
1024479368 7:49848271-49848293 GGCTCTGAGTGGAGGTGGGAGGG - Intronic
1024635003 7:51280042-51280064 TGCTCTATGTGGAGGAGAGAGGG - Intronic
1024738833 7:52334265-52334287 TGGTCTGTATAGAGGTGAGAAGG + Intergenic
1026026523 7:66749099-66749121 ATCTCTGTATGGAGGTGAGGTGG - Intronic
1026800699 7:73398024-73398046 GGCTGTGCGTGGAGCAGAGATGG - Intergenic
1028220007 7:88186038-88186060 GGCTCTGCAAGGAGCAGATAGGG - Intronic
1028304544 7:89246788-89246810 GCCTAAGTATGGAGTAGAGAGGG - Intronic
1030408642 7:109146438-109146460 AGCTCTTTATGGGGGAGAAATGG - Intergenic
1032068820 7:128791601-128791623 GGGTCTGGAAGGAGGAGGGATGG - Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032374278 7:131394363-131394385 GGCAGGGTATGGTGGAGAGATGG + Intronic
1033417732 7:141178893-141178915 GGCTCTGAATGGAGGCCCGAGGG + Intronic
1033514682 7:142094345-142094367 GGCTCTGGTTGGAGGGGAAAAGG - Intronic
1033720493 7:144054064-144054086 GGATCTGTACACAGGAGAGATGG - Intergenic
1034431821 7:151044960-151044982 GGCTCTGTAAGGGGGACAGAGGG + Intronic
1035598920 8:883309-883331 GGCACTGTATGGCGGATAGAAGG + Intergenic
1038090590 8:24248651-24248673 TGGTCTGTCTGGGGGAGAGATGG - Intergenic
1040384147 8:46901966-46901988 GGCTCTGAAAGCCGGAGAGAAGG + Intergenic
1040570522 8:48605389-48605411 GACTGTGAATGGAGGAGAGAAGG + Intergenic
1041720871 8:60974204-60974226 GCCTCTGTGGGGAGGTGAGATGG + Intergenic
1041738251 8:61133472-61133494 GGCTGTTTATGGAGGTGAGCTGG + Intronic
1043213115 8:77550655-77550677 GTCTAGGTATGGAGCAGAGAGGG + Intergenic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1044755712 8:95458989-95459011 GCCTATGTATGGAGGAGACAAGG - Intergenic
1045376643 8:101581029-101581051 GGCAGTATATGGTGGAGAGAGGG - Intronic
1047015303 8:120717863-120717885 GGCTCTTTTTTGAGGAAAGAGGG - Intronic
1047775873 8:128069984-128070006 GGCTGCCTATGGAGGAGGGAAGG - Intergenic
1048061072 8:130919765-130919787 CCCTCTGTATGGAACAGAGAGGG + Intronic
1048146757 8:131852666-131852688 GGGTCTATATAGAGGAGAGAAGG - Intergenic
1048290662 8:133178981-133179003 GGAGATGGATGGAGGAGAGAAGG - Intergenic
1049471344 8:142776339-142776361 AGCGCTGGATGGAGGAGAGATGG + Intronic
1050131202 9:2414570-2414592 GACTCTGGATGGAGCAGAGTTGG - Intergenic
1050131801 9:2420598-2420620 GGCTCTGGATGGTGGAGACTTGG + Intergenic
1050997930 9:12243217-12243239 GGCCCTGTGGGGAGAAGAGAAGG + Intergenic
1053170113 9:35872199-35872221 GGCTGGGTATGGAAGAGTGAGGG - Intergenic
1053458810 9:38252621-38252643 GGCTCAGTAGGAAAGAGAGAGGG - Intergenic
1055068222 9:72140346-72140368 GAGTCTGTGTGGAAGAGAGAAGG + Intronic
1055279698 9:74660121-74660143 GGCTATGTATAGAGGAAATAGGG - Intronic
1055471627 9:76617684-76617706 GGCTGGGCATGGAGGAGGGAGGG - Intronic
1055893045 9:81143481-81143503 GTGTCTGGATGGAGAAGAGATGG + Intergenic
1056330221 9:85515052-85515074 GGCTCTATATGCTGGTGAGATGG - Intergenic
1058319921 9:103616028-103616050 GAGTCTGTATGAAGGAGAAAAGG + Intergenic
1059653633 9:116337603-116337625 GGTTGTGGAGGGAGGAGAGAAGG - Intronic
1059721012 9:116960106-116960128 GGCTCACTTTGGAGGAGAGGAGG + Intronic
1059957600 9:119534478-119534500 GGCTCTGTAAGGAGGACAGTGGG - Intergenic
1060883504 9:127134939-127134961 GGCACTGTGGGGAAGAGAGAGGG + Intronic
1061395694 9:130342331-130342353 GGCTCTGTAGGGAGGCAACATGG - Intronic
1061513750 9:131076565-131076587 GGCTCTCTAAGGAGGAGTAAGGG + Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1186538043 X:10370084-10370106 GGGTCTGAATGGAGGACAGCAGG - Intergenic
1188582752 X:31735217-31735239 GACTCTGCAAGGAAGAGAGAGGG - Intronic
1188973105 X:36640998-36641020 GGCTCTGGAGGGAGGGTAGAAGG - Intergenic
1189422822 X:40871698-40871720 AGCACAGTAGGGAGGAGAGAAGG + Intergenic
1189428797 X:40929110-40929132 GACTCTGAAAGGTGGAGAGAAGG - Intergenic
1190259208 X:48787494-48787516 GGGTTTTTCTGGAGGAGAGATGG - Intronic
1192208642 X:69112729-69112751 GTCTGTGTATGCAGGAGGGAGGG - Intergenic
1193779759 X:85686841-85686863 GGGTGTGTGTGCAGGAGAGAAGG + Intergenic
1194899962 X:99497882-99497904 GGCTCTGTCTGGTGAAGAGCAGG - Intergenic
1195019911 X:100816984-100817006 GGCTTTGAATGGAGGAGAAAGGG - Intergenic
1195619783 X:106941629-106941651 AGCCCTGTATGAAGGAGTGAGGG + Exonic
1196771799 X:119301695-119301717 GGCTCTGAAAGGTGAAGAGAAGG - Intergenic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1198330421 X:135617711-135617733 GTTTCTGTGTGGAGGAGAGATGG - Intergenic
1198336506 X:135671288-135671310 GTTTCTGTGTGGAGGAGAGATGG + Intergenic
1198363133 X:135915359-135915381 GCTCCTGTGTGGAGGAGAGATGG - Intergenic
1198510827 X:137349828-137349850 GGCTCTGAAAGGTGGACAGAAGG - Intergenic
1199951071 X:152706564-152706586 GGGGCTGCATGGAGGAGAAATGG + Intergenic
1199953376 X:152723188-152723210 GGGGCTGCATGGAGGAGAAATGG + Intergenic
1199956306 X:152745262-152745284 GGGGCTGCATGGAGGAGAAATGG - Intergenic
1199958613 X:152761897-152761919 GGGGCTGCATGGAGGAGAAATGG - Intergenic
1200973096 Y:9177435-9177457 GGTGCAGGATGGAGGAGAGAAGG + Intergenic
1201291061 Y:12421151-12421173 GCCTCAGTATGGAGGACAGACGG - Intergenic