ID: 962363447

View in Genome Browser
Species Human (GRCh38)
Location 3:134760825-134760847
Sequence CTGCTGTCCTGGGGCACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 370}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962363443_962363447 2 Left 962363443 3:134760800-134760822 CCACTACTTGCAGATCTTAGGGA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG 0: 1
1: 0
2: 2
3: 30
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962363447 Original CRISPR CTGCTGTCCTGGGGCACCTC CGG Intronic
900104512 1:976614-976636 CTTCTGTCCTAGGGGAGCTCCGG - Exonic
900252533 1:1678563-1678585 CAGCTGTCCTGGTGCACCGAGGG - Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900482595 1:2906412-2906434 CTGCTGTCCAGAGGCCCCTGAGG - Intergenic
900595007 1:3476647-3476669 CTGTTGTCCTGGGACAGCCCAGG + Intronic
900619525 1:3580468-3580490 CGGCTGCCCTGGGGCTCCCCAGG + Intronic
901170829 1:7255988-7256010 CGTCTGTTCAGGGGCACCTCAGG + Intronic
901314379 1:8296029-8296051 CAGCAGCCCTGGGGCTCCTCAGG + Intergenic
902379683 1:16046842-16046864 CTGCTTTCCAGGGGCTCCGCTGG + Intronic
902605903 1:17569250-17569272 CAGCTGTTCTGGGGCACCTCTGG - Intronic
903058923 1:20655909-20655931 CTGCTGTCCAGGGGTCCATCTGG - Intronic
903173756 1:21568931-21568953 CTGCGGGCCTGGGGCAGCTGGGG + Intronic
903187807 1:21639180-21639202 CTGCCAGCCTGGGGCAGCTCAGG - Intronic
903948578 1:26980206-26980228 CTTCACTCCTGGTGCACCTCAGG - Intergenic
904365186 1:30006287-30006309 CTGCTGTCCTGGGTGACCCAGGG - Intergenic
905017240 1:34786147-34786169 GTGATGACCTGGGGGACCTCTGG - Exonic
905108105 1:35576054-35576076 GTGCCTGCCTGGGGCACCTCAGG - Intronic
905301866 1:36991050-36991072 GTGCTTTCCTTAGGCACCTCAGG - Intronic
905522649 1:38612318-38612340 CTTCTGGCCAGGGGCAGCTCAGG - Intergenic
907247384 1:53116753-53116775 CTGCTGTCCTGTGTGACCTCAGG - Intronic
907837008 1:58119685-58119707 CTCCCGACCTGGGGCAGCTCTGG - Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
911179127 1:94845567-94845589 CTGCTGTCATCAGACACCTCTGG - Intronic
912810457 1:112790271-112790293 ATGCTGTCATGAGGCAACTCAGG + Intergenic
913349289 1:117840548-117840570 CTGCTGGCCTGAGGCAACTCAGG - Intergenic
914676059 1:149908395-149908417 CTGCGCTCCTGGGGGACTTCAGG + Intronic
917975265 1:180233935-180233957 TTCCTCTCCTGGGGCTCCTCCGG + Intronic
918852427 1:189709082-189709104 CTGCTGTCCTGGAGGAGCTGAGG - Intergenic
920049945 1:203157832-203157854 CTGCTGCCCAGGGCCACCTCAGG - Intronic
920049953 1:203157858-203157880 TTGCTGCCCAGGGCCACCTCAGG - Intronic
920061057 1:203227236-203227258 CTGCACTCCTGGGTGACCTCTGG - Intronic
921755894 1:218855470-218855492 TTGCTGTCCAGAGGCACCTTGGG + Intergenic
922221579 1:223612350-223612372 GTGCAGTCCTGGGGCAACTGAGG + Intronic
1064466282 10:15585443-15585465 CTGCTGTCCTGGTGCCGCTGGGG - Intronic
1067012199 10:42724759-42724781 CTGGCCTCCTGGGGCACCCCTGG + Intergenic
1067311396 10:45117134-45117156 CTGGCCTCCTGGGGCACCCCTGG - Intergenic
1067343355 10:45421379-45421401 GTCCTGTGCTGGGGCACCTGAGG - Intronic
1067556698 10:47277985-47278007 CTCCTGGCCTGGGGGAGCTCTGG - Intergenic
1073061292 10:100735376-100735398 CTGCGGTCCGTGGGCGCCTCAGG + Intergenic
1073124440 10:101140807-101140829 CTGGGTTCCTGGGGCCCCTCAGG - Intergenic
1075021185 10:118953689-118953711 CTGCTGACCTGTGGCTGCTCTGG - Intergenic
1076117635 10:127911576-127911598 GGGCTGTCCTGGGCCATCTCTGG + Intronic
1076143252 10:128096365-128096387 CTGCTGACTTGGGGCAGCCCTGG + Intergenic
1076451029 10:130557101-130557123 GTGATGCCCTGGGCCACCTCAGG + Intergenic
1076999626 11:316106-316128 CTGCTGTCCACGGGCACCCGAGG - Intergenic
1077502093 11:2913993-2914015 CCACTGTTCTGGGGCCCCTCTGG - Intronic
1077886896 11:6393437-6393459 CTGTTGAGCTGGAGCACCTCTGG + Intronic
1078831634 11:14982885-14982907 GTGCTGCCCTGTGCCACCTCAGG - Intronic
1079116428 11:17643331-17643353 CTCCTGCCCTGGGGCATCACGGG + Intronic
1079819379 11:25105816-25105838 CTGCTGTCTTGTGAAACCTCAGG - Intergenic
1080600492 11:33817471-33817493 CTGCTGGCCTGGTGCATCCCAGG + Intergenic
1081121565 11:39272923-39272945 CTGATGCCGTGGTGCACCTCCGG - Intergenic
1081861534 11:46335859-46335881 CTGCTGTCCTGGGTGGCCTGTGG + Intronic
1083853522 11:65380883-65380905 CTGCTGTCCTGAGTCCCCTCTGG - Intronic
1083989983 11:66240968-66240990 CTGCTGTCCTGAGGCTGCACTGG + Intronic
1084944476 11:72631302-72631324 CTGCTTCCCATGGGCACCTCTGG + Intronic
1085477352 11:76796710-76796732 CTGCTGTCCTGGGCTGCCTCAGG + Exonic
1085951593 11:81339010-81339032 CTGCTCTGCTGGTGCACCTTTGG - Intergenic
1089010132 11:115125400-115125422 CCGCTGTCCTAGAGCACCCCAGG + Intergenic
1089388072 11:118080766-118080788 CTGCTGCCCTGGGGCGTTTCTGG - Intronic
1089689610 11:120179156-120179178 TTGATGTCCAGGGGCACCTGTGG - Intronic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1090644661 11:128758007-128758029 AAGCTGTCCTGGGGCAGCCCTGG + Intronic
1091316437 11:134617350-134617372 CTGCTGCCCTGTGTCACCTCAGG + Intergenic
1091316458 11:134617451-134617473 CTGCTGCCCGGTGTCACCTCAGG + Intergenic
1092396816 12:8134433-8134455 TTGATGTCCTGGGACTCCTCCGG + Intronic
1096748390 12:53743430-53743452 CTGCTGTGCTGGAGCCCCTGGGG + Intergenic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1100234574 12:92647544-92647566 CTGGTGTCCTATTGCACCTCAGG + Intergenic
1101270492 12:103138706-103138728 CTGATGTCCTGGCACACCCCTGG + Intergenic
1101866808 12:108526370-108526392 CTGCTGTCGTGCAGCACCTTGGG + Exonic
1102246701 12:111361014-111361036 CTGCTCTCCACAGGCACCTCTGG - Exonic
1102464643 12:113121397-113121419 CCTCAGTCCTGGGGCACTTCTGG - Intronic
1102864839 12:116366289-116366311 CTGGTGTCCTCGGGCCCCTGTGG + Intergenic
1103320040 12:120087099-120087121 TGGCTGTCGTGGGGCACCACGGG + Intronic
1104495343 12:129231833-129231855 CTAAGGTCCTGGGGCACCTGAGG + Intronic
1104769882 12:131354801-131354823 CTGCTGACCTGCTGCAGCTCTGG - Intergenic
1104929337 12:132329713-132329735 CTGCTGTCCTGGGGTCCCCGGGG - Intergenic
1106878666 13:34105086-34105108 CTCCTGTCCTGGGGCCACTTTGG + Intergenic
1108979520 13:56492596-56492618 CTGCTGTCCTGGGCAAGCCCAGG - Intergenic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1112299507 13:98217390-98217412 CTGCTCTCCTGGGGGGCTTCTGG - Intronic
1112579941 13:100669857-100669879 GTTCTGACCTGGGGTACCTCTGG + Intronic
1113008924 13:105741031-105741053 GTGCTGTCCTGGGGGCCCACAGG - Intergenic
1113121162 13:106924942-106924964 CTGCAGTCCTTGGCCACCCCAGG - Intergenic
1113902731 13:113805659-113805681 CCGCTGTGCTGGGGCACCCTAGG + Intronic
1113948250 13:114056992-114057014 CTGTTGTCCTTGGGAACCACGGG + Intronic
1114032839 14:18590752-18590774 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1114058629 14:18999282-18999304 GTGCTGTCCTTGTACACCTCTGG + Intergenic
1114077628 14:19169800-19169822 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1114103917 14:19402472-19402494 GTGCTGTCCTTGTACACCTCTGG - Exonic
1115093175 14:29602799-29602821 CCTCTGTACAGGGGCACCTCAGG - Intronic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1117164170 14:53017359-53017381 TTGCTTTCCTAGGCCACCTCTGG + Intergenic
1117435040 14:55707952-55707974 GTGCTGCCCTGGGGTACCTTTGG + Intergenic
1121273365 14:92652092-92652114 CTGCAGGCCTGGGCCCCCTCAGG + Exonic
1121485943 14:94314401-94314423 ATGCTGTCCCTGGGCACCTGTGG - Exonic
1122051763 14:99065660-99065682 CTGATCTCCTGGGGGAGCTCTGG - Intergenic
1122143597 14:99676216-99676238 CTGCAGGCCTGGGGCCCCACTGG + Exonic
1122153717 14:99738127-99738149 CCTCTGTCCTGGGTCAGCTCTGG - Intronic
1122804125 14:104248093-104248115 CTGGTGGCCCAGGGCACCTCTGG + Intergenic
1122828910 14:104386055-104386077 CTGCTGTCCAGAGGCACCGCTGG + Intergenic
1123072112 14:105646978-105647000 CTGCTCACCTGAGGCACCTGAGG + Intergenic
1123132453 14:105999630-105999652 CTGGTGTCCTGGGTGACCCCTGG + Intergenic
1123994318 15:25707749-25707771 CTGCTGTCTTGGGGTGCCTGGGG + Intronic
1124580723 15:30952614-30952636 CTGCTGTCCTAGGGAGCCTGAGG - Intronic
1125681070 15:41530461-41530483 CAGCTGGCCTGGAGCTCCTCCGG + Intronic
1125825843 15:42675721-42675743 CTGCTGTCCTGCGGCAGCGAAGG + Exonic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1125889989 15:43258711-43258733 CTCCTGTCCTGCAGCACCACAGG + Intronic
1125931138 15:43600887-43600909 CTGATGTGCTGGAGCTCCTCTGG + Exonic
1125944297 15:43700705-43700727 CTGATGTGCTGGAGCTCCTCTGG + Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG + Intergenic
1128089974 15:64912602-64912624 CAGCTGGCCTGGGGCAGCTTTGG + Intronic
1128787291 15:70407140-70407162 CCGCTGCCCTGGGACAGCTCTGG + Intergenic
1129410749 15:75349011-75349033 CTGCTCTCAAAGGGCACCTCAGG - Exonic
1129557435 15:76527370-76527392 TTGCTTTCCTTGGGCACCTAGGG + Intronic
1129611874 15:77066938-77066960 GTGATGTCCTGGGCCACCTCAGG - Intronic
1129652127 15:77498503-77498525 CTGCAGTCCCCAGGCACCTCTGG + Intergenic
1129715353 15:77845278-77845300 CTGCTGCCCTGCGCAACCTCAGG + Intergenic
1130650298 15:85758667-85758689 CCACCGTGCTGGGGCACCTCCGG + Intergenic
1131153886 15:90063153-90063175 GAGCTGTCCTGGGTCACCACAGG - Intronic
1132551458 16:555482-555504 CCTCTGTCCTGGGCCACCCCAGG - Intergenic
1133809411 16:9149532-9149554 GTGATGCCCTGGGCCACCTCAGG - Intergenic
1135640637 16:24116865-24116887 TTTCTGTCCTGGGGCAGCTGGGG + Intronic
1135866463 16:26106947-26106969 CTGCTGTCCTGTGGCCTCTTTGG + Intronic
1138468873 16:57215434-57215456 CTGATGTTCTGGAGCTCCTCTGG + Intronic
1139485369 16:67253196-67253218 CTGCTGTCCTGGCTCTCCCCAGG + Intronic
1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG + Intergenic
1142024420 16:87804817-87804839 CTGCTGTCCTGAGGCTTCCCGGG + Intergenic
1143893161 17:10117649-10117671 CTGCCGACATGGGGCACCACTGG + Intronic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1146399404 17:32491650-32491672 CTGCTGGCCTGGGAGACCCCGGG - Intergenic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1148170468 17:45515265-45515287 CTGCTGTCTGAGGGCTCCTCCGG + Intergenic
1148170945 17:45519258-45519280 CTGCTGTCTGAGGGCTCCTCCGG + Intergenic
1148278736 17:46330542-46330564 CTGCTGTCTGAGGGCTCCTCTGG - Exonic
1148300946 17:46548404-46548426 CTGCTGTCTGAGGGCTCCTCTGG - Exonic
1148365075 17:47049294-47049316 CTGCTGTCTGAGGGCTCCTCCGG - Intergenic
1149439376 17:56662230-56662252 CTGCTGTCGTGTGGCAGCTTGGG - Intergenic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1149897102 17:60436851-60436873 GCGCTGGCCTGGGGGACCTCAGG - Intergenic
1150401561 17:64860859-64860881 CTGCTGTCTGAGGGCTCCTCCGG + Exonic
1151728782 17:75899017-75899039 CTGCTGGCCTGCGCCCCCTCAGG + Intronic
1152363412 17:79842556-79842578 CTCCTCTCCTGGGGCCCCTGAGG - Intergenic
1152439279 17:80295476-80295498 CTGTGGTGCTGGGGCAGCTCTGG + Intronic
1152755927 17:82087013-82087035 CTGCTGGCTTCGGACACCTCTGG - Intronic
1153014188 18:568622-568644 TTTCTGTTCTGGGGCATCTCAGG - Intergenic
1154071844 18:11159794-11159816 CTGCTGTCCTGGGGCGCTGTGGG - Intergenic
1154253714 18:12765596-12765618 CTGTGGTGCTGGGGCATCTCTGG - Intergenic
1155209289 18:23586778-23586800 GTGCTGTTCTGGGGGACTTCCGG + Exonic
1155261925 18:24051436-24051458 CTGCAGGTCAGGGGCACCTCAGG - Intronic
1155316290 18:24574451-24574473 CTGTTGTCCTGGGTAACCTGAGG + Intergenic
1155773309 18:29727017-29727039 CTGCTGTCCTAGGCAGCCTCAGG + Intergenic
1156473360 18:37391070-37391092 CTCCTGTCTGGTGGCACCTCAGG - Intronic
1156879962 18:42065284-42065306 CTGCGGTCATGGGTCATCTCAGG - Intronic
1157214143 18:45768290-45768312 GTGCTGGCCTGGGAAACCTCTGG - Intergenic
1159309553 18:66689053-66689075 CTGATGGCCTGGGGCTCCTTGGG + Intergenic
1161051881 19:2168409-2168431 CTTCTGCCCTGGGGGACCTGTGG + Intronic
1161136757 19:2624623-2624645 CTGCTGTGCTGTGGCACCACCGG - Intronic
1161370692 19:3909335-3909357 CTGCTGTCCTGGCGGACTGCAGG - Intronic
1161543736 19:4867543-4867565 ATGGAGTCCTGGGGCACCCCAGG - Intronic
1161664384 19:5565951-5565973 CTGCCGGCCTGGGGCAGCTCTGG - Intergenic
1162205766 19:9054930-9054952 CTGCAGGCCTGGGGCGCCTCAGG - Intergenic
1162449894 19:10748377-10748399 CTGCAGACCTGGGGCTCCCCTGG - Intronic
1162478650 19:10915548-10915570 CTTCTGCCCTGGGGGACCTGGGG - Intronic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1162875470 19:13617970-13617992 CTCCCGACCTGGGGCTCCTCTGG + Intronic
1164492607 19:28728372-28728394 CTGGTGACCTGGGCCATCTCAGG - Intergenic
1164630785 19:29760270-29760292 CTGCCCTCCTTGGGCGCCTCAGG - Intergenic
1165073281 19:33267787-33267809 CAGCTGGCCTGAGGCAGCTCGGG - Intergenic
1166419599 19:42626237-42626259 CTCCTGTCATGGGAGACCTCAGG - Intronic
1166652223 19:44583092-44583114 CTGTTGTCCTGGGACACCAATGG - Intergenic
1167349335 19:48964947-48964969 CTGGGGTCCTGGGGTGCCTCGGG - Intergenic
1167507659 19:49879386-49879408 CTCCTGCCCTGGGGCAGCGCAGG - Intronic
1167586532 19:50378599-50378621 CTGCTGCCCTGCGGCCCCACAGG - Exonic
1167715923 19:51142930-51142952 GTGCGGTCCTGGGGAAGCTCAGG - Intronic
1167768820 19:51501157-51501179 GTGCGGTCCTGGGGAAGCTCAGG + Intronic
1168404242 19:56102712-56102734 CTGCGCTCCTGGGCCACCCCTGG + Intronic
925033987 2:672348-672370 CTGATGTCGGGGGGCACCGCTGG - Intronic
925781126 2:7382697-7382719 CTGCCCTTTTGGGGCACCTCTGG + Intergenic
927384002 2:22511877-22511899 CTGCTCTTCTGGGAGACCTCTGG + Intergenic
929086289 2:38170744-38170766 TTGCTGGCCTGGGCCACCCCAGG + Intergenic
929289914 2:40178328-40178350 CTGCTGGCCTGTGCCACCCCTGG - Intronic
931851234 2:66252312-66252334 CTGATGTGCTCAGGCACCTCCGG + Intergenic
932131228 2:69189240-69189262 CTGCTGTCATTGGGCTCTTCTGG - Intronic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932794459 2:74682498-74682520 ATCCTGTTCTGGGTCACCTCTGG + Intronic
933685197 2:85135809-85135831 CTGCTGGCCTGGAGCACCCCAGG + Intronic
934476850 2:94599328-94599350 CTTCTGTCCTGGGGCTTCTGAGG + Intronic
934557819 2:95296742-95296764 CTGCTGTCCTGGGGGCCCCTTGG + Intergenic
934653300 2:96104387-96104409 CTGCTGGCCTGGGGCCTCGCTGG + Intergenic
935271854 2:101441463-101441485 GTGATGTCTTGGGCCACCTCGGG + Intronic
935806054 2:106748672-106748694 CTAGTGTCCTGGGGCACATCGGG - Intergenic
936047051 2:109196274-109196296 CTGCTGGCCTGGAGCAGCCCAGG - Intronic
936754480 2:115689896-115689918 CTGCTGCCCTTGGACACCCCAGG - Exonic
939354493 2:141083765-141083787 CTGATGCCCTGTGCCACCTCAGG + Intronic
941063176 2:160871232-160871254 CAGCTGTCCTAGGGAACATCTGG - Intergenic
941167951 2:162103813-162103835 CTGCTGTCCAGTGGTACCTGAGG - Intergenic
941590619 2:167416238-167416260 CTGCTGCCCAGGGTTACCTCAGG + Intergenic
941714410 2:168748902-168748924 CTGCTTCCCTGGGGCACTGCAGG - Intronic
944259162 2:197657322-197657344 CTTCTGCCCTGGGTCACCCCAGG + Intronic
945175384 2:207038561-207038583 CTGGTTTCCTGGGGGATCTCTGG + Intergenic
946080728 2:217116210-217116232 CTGTTTTCCTGAGGCCCCTCTGG + Intergenic
946306641 2:218860125-218860147 CGGCTGTCCTGGCGCGGCTCTGG + Intronic
948167304 2:235872993-235873015 CTGCCCTCCTGGGGCACGGCTGG - Intronic
948217113 2:236240016-236240038 CTGCTGTCCTGTGGTACACCTGG - Intronic
948220982 2:236269637-236269659 CTGCTGTCCTGTGCAACCTCAGG + Intergenic
948313849 2:237011633-237011655 CTGCAGTCCTGAGGCAGCTGAGG + Intergenic
948459805 2:238123678-238123700 CAGCTGTCCTGGGACACCGGGGG - Intronic
948564857 2:238878252-238878274 CTGATGTCCTGGGCCCCCACTGG - Intronic
948691811 2:239711047-239711069 CTCCTGTCCTGGAGCTCCTGGGG + Intergenic
1170219868 20:13930368-13930390 CTACTGCCCTGTGGCACTTCAGG + Intronic
1170479992 20:16755866-16755888 CTGCTGCCTTGTGCCACCTCAGG - Intronic
1170941692 20:20853543-20853565 CTGCTGTCCTGTGCAACCTCAGG - Intergenic
1172392469 20:34575170-34575192 TCCCTGTCCTGTGGCACCTCTGG - Exonic
1172425358 20:34852117-34852139 CTGCTTTCCTGGGGACCCTGAGG - Intronic
1173662902 20:44746234-44746256 CAGCCGTCCCGGGGCGCCTCTGG + Intronic
1173689440 20:44948692-44948714 CTGCTGGCCTGGGGCATTTCAGG - Intronic
1175304784 20:57968504-57968526 ATGCTGACTTGGGACACCTCGGG + Intergenic
1175578603 20:60081109-60081131 CCGCTGTCCTGGGACACCGGTGG + Intergenic
1175743641 20:61437832-61437854 CTGTTTTCCAGGGGCACATCTGG - Intronic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176615818 21:9027602-9027624 CTCCTGTCCTGTGGTACCTGGGG + Intergenic
1176709341 21:10136132-10136154 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1179000790 21:37456265-37456287 TTGTTCTCATGGGGCACCTCTGG - Intronic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1179999996 21:44991234-44991256 CAGCTGTGCTGGGGCAAGTCTGG + Intergenic
1180087465 21:45514405-45514427 CTGCTCCCCTGAGCCACCTCGGG + Exonic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1180252318 21:46597623-46597645 CTGCTGCCGGGGGGCAGCTCTGG - Intergenic
1180456955 22:15517809-15517831 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1180477114 22:15721901-15721923 GTGCTGTCCTTGTACACCTCTGG + Intergenic
1181048153 22:20226374-20226396 CTGCTGTGCTGGGGGACCTGGGG - Intergenic
1181135631 22:20764157-20764179 CTGCTGTCCCAGGGCGCCTGAGG + Intronic
1181552700 22:23649774-23649796 CTGCAGGCCTGGGTCACCCCTGG + Intergenic
1182276876 22:29195451-29195473 CAGCTGACCTGGGACTCCTCTGG - Intergenic
1182480771 22:30607324-30607346 CTGCTGCCATGAGGCACCTTGGG + Exonic
1182711802 22:32327874-32327896 CTGCCGGGATGGGGCACCTCGGG + Intergenic
1184403541 22:44287281-44287303 CTGCTTCCCTTGGGCTCCTCTGG + Intronic
1184423780 22:44397113-44397135 TTGCTCTACTGGGGCACCTATGG - Intergenic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
950469566 3:13176120-13176142 TTGCTCTCCTGGAGCAACTCAGG + Intergenic
950887357 3:16373618-16373640 CTGCTGTCCCAGGAGACCTCTGG + Intronic
952674306 3:36008541-36008563 CTGCTGTCCTGGGGAGCTTCTGG - Intergenic
953614616 3:44478433-44478455 CTGCTGTCCTGGTAGTCCTCTGG + Intergenic
953749084 3:45595785-45595807 CTCCTTGCCTGGGGCAGCTCAGG - Exonic
954626285 3:52023719-52023741 CTGCTGGCCAGGGGCACCCTGGG + Intergenic
954745033 3:52782898-52782920 GTGCTGTCCTGGGGCCACCCTGG + Intronic
955241214 3:57180002-57180024 CTGCTGGCCACGGGCACTTCTGG - Intergenic
956213790 3:66827612-66827634 CTGCTGCTCTGGAGCATCTCTGG - Intergenic
959683353 3:109120650-109120672 GTGATGTCCTGGGCCACCTGGGG + Intergenic
961919316 3:130409339-130409361 ATACTGCCCAGGGGCACCTCTGG - Exonic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
963511915 3:146257132-146257154 CTGCTGCCCTGTGCAACCTCTGG - Intergenic
963933289 3:151026539-151026561 CTGCTGTCCTGGGCCATGTGTGG + Intergenic
967995096 3:195160599-195160621 TTGCTGTTCAGGAGCACCTCTGG + Intronic
968292103 3:197546890-197546912 CTGATGCCCTGGGGCACCACAGG - Intronic
968382776 4:109746-109768 GTGCTTTCCTTGGGCACCCCTGG - Intergenic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
968943997 4:3654162-3654184 CATCTGTCCTCGGCCACCTCTGG + Intergenic
971454494 4:26831511-26831533 CTGCTGCCATGGGTCACATCTGG - Intergenic
971519507 4:27531315-27531337 CTGCTTTCTTGGACCACCTCTGG + Intergenic
973640090 4:52893897-52893919 TTGCTGTCCTTGGGCTCCCCAGG + Intronic
976695574 4:87916760-87916782 CTGCTATCCGGGGGCAGGTCAGG + Intergenic
978409959 4:108415895-108415917 CTGCTGGCCTGGGGCAACTTTGG + Intergenic
980422744 4:132585287-132585309 CTGCTGTTCTGTGGAGCCTCAGG + Intergenic
981260041 4:142708478-142708500 CTGCTGCCCTGTGCAACCTCAGG + Intronic
982469802 4:155774275-155774297 CTGCTGTCCTCTGACACCCCAGG + Intronic
984985760 4:185328381-185328403 CTGGTGGCCTGGGGCTCCTTGGG - Intronic
985481070 5:111282-111304 CAGCTTCCCTGGGGCAGCTCTGG + Intergenic
986729106 5:10622223-10622245 GTGCTGTCCAGGGGACCCTCTGG - Intronic
987340820 5:16937072-16937094 CTGCTTTCCAGGTGCCCCTCAGG + Intergenic
990265439 5:54070438-54070460 GTGATGCCCTGGGTCACCTCGGG + Intronic
990326079 5:54676634-54676656 GTGCTGTACTTGGGCAACTCAGG - Intergenic
990466847 5:56078875-56078897 CTGATTTCCTGGGGCACCTCAGG - Intergenic
994005897 5:94836848-94836870 CTGCTTTCCTGGGACACATATGG - Intronic
997272912 5:132556927-132556949 CCGCTCTCCTGGGGCACGCCGGG - Exonic
998146453 5:139731785-139731807 CTGCTGTCCCTGGGTACCTGGGG - Intergenic
998452644 5:142246656-142246678 TTGCTCTCCTGGGGTGCCTCTGG + Intergenic
999205134 5:149842194-149842216 CTGGCTTCCTGGGGCCCCTCTGG - Intronic
1000265130 5:159629012-159629034 GTGGAGTCCTGGGGGACCTCAGG + Intergenic
1001652892 5:173328081-173328103 CTCCTGTCTTGGGGACCCTCGGG + Exonic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002002983 5:176208580-176208602 CTGCTGTCCTGTGCAGCCTCAGG - Intergenic
1002223529 5:177702675-177702697 CTGCTGTCCTGTGCAGCCTCGGG + Intergenic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002319739 5:178367905-178367927 CTGCTGTCCTGGAGGGGCTCAGG + Intronic
1002594182 5:180311623-180311645 CAGCTGTCCAGTGGCAGCTCTGG + Intronic
1002911303 6:1493062-1493084 CTGCTGTGCTGCAGCCCCTCTGG + Intergenic
1006302562 6:33201288-33201310 CTGCTGACCTGGGCGACCTTGGG + Exonic
1006515073 6:34541231-34541253 CTGCTGTGATGGGGCACCCATGG + Intronic
1006643433 6:35500152-35500174 CTACTCCCCTGGGGCACCCCAGG - Exonic
1006874553 6:37284038-37284060 CTGCTGTACTGTGCCAGCTCTGG + Intronic
1007942846 6:45798498-45798520 CTGCTCTCCTGGGCAGCCTCTGG + Intergenic
1009348980 6:62651229-62651251 CTGATGGCCTGGGGCTCCTTGGG - Intergenic
1009624026 6:66113513-66113535 CAGCCATCCTGGGGTACCTCTGG - Intergenic
1012427389 6:99129459-99129481 CTGCTGTCTTAGGGCCCCTAGGG - Intergenic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1016937658 6:149459541-149459563 CTGCAGTCTTGGAGCACTTCTGG + Intronic
1017294346 6:152776811-152776833 CTGCTGTAATGGAGCAGCTCAGG - Intergenic
1017926522 6:158915597-158915619 CAGCTCTCCAGGGGCAACTCAGG - Intergenic
1018629185 6:165807463-165807485 CTGCTTTCCTGTGGGAGCTCGGG - Intronic
1019100771 6:169627565-169627587 CTGCTGTCCTGAGGCTCCCGAGG + Intronic
1019200996 6:170315105-170315127 CTGCTGTCCAGGGGCTCTCCTGG + Intronic
1019382005 7:728677-728699 GTGCTGTCCTGTGGAACCTACGG - Intronic
1019427914 7:986054-986076 CTGCTGCCCTGGGGCTGCCCCGG - Intronic
1019564773 7:1673873-1673895 GAGCTGTCCTGGGGCAGCTGGGG + Intergenic
1020434740 7:8150853-8150875 CTGCTTCCCAGGGGCACTTCTGG - Intronic
1021633788 7:22671424-22671446 CTGCTCTGCTTGGGCACCTCTGG - Intergenic
1023158345 7:37274062-37274084 CTGATGCACTGGGTCACCTCCGG + Intronic
1023491612 7:40748848-40748870 CTTCTGACCTGGGTCTCCTCTGG + Intronic
1023598098 7:41853683-41853705 CTGCTTCCCTGGGACACCTGAGG + Intergenic
1023640376 7:42251120-42251142 GTACTGTCCTGGGGCAACACTGG + Intergenic
1023870048 7:44258495-44258517 CAGCTGGACTGGGGCACCACTGG - Intronic
1023930259 7:44701071-44701093 CTGCTGCCCTGGGATACCGCGGG + Intronic
1023964167 7:44953405-44953427 TTACTGTCCAGGGCCACCTCAGG - Intergenic
1025942817 7:66086495-66086517 CTGCAGGCCTGGGTCACCCCTGG - Intronic
1028717067 7:93983070-93983092 TTCCTGGCCTGGGCCACCTCTGG - Intronic
1029979332 7:104863510-104863532 AAGCTGTCCTGAGGCAGCTCAGG - Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1032850986 7:135795206-135795228 GTGATGTCCTGTGCCACCTCAGG - Intergenic
1033048075 7:137980415-137980437 CGCCTGGCCTGGGGCAGCTCAGG + Intronic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1034400041 7:150856310-150856332 AGGCTGTCCTGGGGCAGCTGGGG - Intronic
1034499288 7:151439729-151439751 CTACTGGCCTGGGGCCTCTCTGG - Intronic
1035106702 7:156446997-156447019 GTGATGCCCTGGGCCACCTCTGG - Intergenic
1035405666 7:158595530-158595552 CTGCAGGCCTGAGGCAGCTCTGG - Intergenic
1035521373 8:277386-277408 CGGCTGCCCTCGGGAACCTCAGG + Intergenic
1037746626 8:21650548-21650570 GTGCTGTACTGAGGCTCCTCAGG + Intergenic
1039792624 8:40887840-40887862 CTGGAATGCTGGGGCACCTCTGG + Intronic
1039895523 8:41714116-41714138 CTGCTCTCCAGGGGCAGCTGGGG + Intronic
1040007531 8:42632832-42632854 CTGCCGTCCTGGGGAGCCTGGGG - Intergenic
1040302222 8:46194024-46194046 CTGCCGGCCTGGGGCAGCACTGG - Intergenic
1044040112 8:87356918-87356940 CTGCTGCCCTATGCCACCTCAGG + Intronic
1044152655 8:88800706-88800728 CTGCTGTCCTGTGCAGCCTCAGG + Intergenic
1045484724 8:102622114-102622136 TCGATGTCCTGGGGCCCCTCAGG + Intergenic
1045561791 8:103271287-103271309 CTGCTGCCCTGTGCAACCTCAGG + Intergenic
1047707325 8:127512750-127512772 CTGCTGCCTCGGGCCACCTCAGG - Intergenic
1048167007 8:132071347-132071369 CCTCTGTCCTGGGACTCCTCTGG + Exonic
1048266794 8:132994425-132994447 TGCCTGTCCTGGGGCTCCTCAGG + Intronic
1048487376 8:134860848-134860870 TTGGTGCCCTGGAGCACCTCAGG + Intergenic
1048779155 8:137982391-137982413 TGGCTGTCCTGGGGCACCGCAGG - Intergenic
1049137908 8:140922165-140922187 CAACTGTCCTGGGGCATCACTGG - Intronic
1049459455 8:142717928-142717950 CAGCCGCCCTGGGGCACCTGGGG - Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1051825507 9:21213836-21213858 CTGCTGTCTTGGTGCACTTTGGG + Intronic
1052853178 9:33390581-33390603 CTTCTGTCCTGGGGCTTCTGAGG - Intronic
1053505727 9:38641759-38641781 GTTCTGTCCTGAGGCACGTCAGG - Intergenic
1053646310 9:40121668-40121690 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1053681217 9:40486749-40486771 CTCCTGTCCTGGGGCTTCTGAGG - Intergenic
1053759404 9:41341883-41341905 CTCCTGTCCTGTGGTACCTGGGG + Intergenic
1053931203 9:43115081-43115103 CTTCTGTCCTGGGGCTTCTGAGG - Intergenic
1054282497 9:63138185-63138207 CTCCTGTCCTGGGGCTTCTGAGG + Intergenic
1054294304 9:63322265-63322287 CTCCTGTCCTGGGGCTTCTGAGG - Intergenic
1054327322 9:63719570-63719592 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1054392326 9:64626753-64626775 CTCCTGTCCTGGGGCTTCTGAGG - Intergenic
1054426974 9:65131963-65131985 CTCCTGTCCTGGGGCTTCTGAGG - Intergenic
1054503401 9:65889577-65889599 CTCCTGTCCTGGGGCTTCTGAGG + Intronic
1054538258 9:66254305-66254327 CTCCTGTCCTGTGGTACCTGGGG + Intergenic
1055583360 9:77731382-77731404 CTGCTGCACTGGGGCTGCTCTGG + Intronic
1056783805 9:89573495-89573517 GTGATGTCCTGTGCCACCTCAGG - Intergenic
1057177603 9:93011136-93011158 CAGCTGCCCTGGAGCCCCTCAGG + Intronic
1057897072 9:98917743-98917765 CTGCTGCCCTGGAGGCCCTCTGG - Intergenic
1060743761 9:126116597-126116619 CTGCTTTCATGGGACACCGCTGG + Intergenic
1060802997 9:126556664-126556686 CTGCCATCCTGGGGCTCCTGGGG - Intergenic
1060950830 9:127601568-127601590 CTGCTATGTTTGGGCACCTCTGG - Intergenic
1061191729 9:129086241-129086263 CTGCTATCCTGGGGAACAGCGGG - Exonic
1061288747 9:129639120-129639142 CTGTTGTCCTGGGGCACCCTGGG + Intronic
1061466587 9:130785359-130785381 CTGCTGCCCTGGGCCAGCTCTGG + Intronic
1061817170 9:133204482-133204504 CTGCTGGCCTGGCTCACTTCAGG + Intergenic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1202794100 9_KI270719v1_random:105099-105121 CTCCTGTCCTGTGGTACCTGGGG - Intergenic
1185743025 X:2549144-2549166 CAGCAGTCCTGGGGCTACTCTGG - Intergenic
1188475498 X:30587318-30587340 TTGCTGCCCTGTGCCACCTCAGG - Intergenic
1189349133 X:40263954-40263976 CTGCTGTCGTGTGGGCCCTCTGG + Intergenic
1190297650 X:49038022-49038044 CTGCAGTCCTGTGGTGCCTCCGG + Exonic
1190334472 X:49253945-49253967 TTGCTGTCCGGAGGCACCTGTGG - Exonic
1192170942 X:68854321-68854343 CTACTGGCCCAGGGCACCTCTGG - Intergenic
1192410780 X:70930688-70930710 GGGCTGCCCTGGGGCCCCTCTGG - Intronic
1192503779 X:71668920-71668942 CTGCTGTGCTTGGGCTCCTTGGG - Intergenic
1192522541 X:71814972-71814994 CTGCTGTGCTTGGGCTCCTTGGG - Intergenic
1193227038 X:78995899-78995921 CTTCTGCCCTGGGGCATCACAGG - Intergenic
1193492017 X:82162097-82162119 CTGCTGCCCTGTGCAACCTCGGG + Intergenic
1199243438 X:145575099-145575121 CCACTGTCCTGAGCCACCTCTGG + Intergenic
1199643036 X:149881782-149881804 CTGGGGTCCTGGGTCCCCTCGGG - Intronic
1201149214 Y:11086326-11086348 CTCCTGTCCTGTGGTACCTGGGG + Intergenic
1201373994 Y:13296250-13296272 TTGCTGCCCTGAGCCACCTCAGG - Intronic
1201935809 Y:19409835-19409857 CTGCTGCCCTGTGTCACCTCAGG + Intergenic
1201982871 Y:19926549-19926571 CTGATGGCCTGGGGCTCCTTGGG + Intergenic