ID: 962365038

View in Genome Browser
Species Human (GRCh38)
Location 3:134773163-134773185
Sequence ATGGGGGAGGAGAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 0, 3: 78, 4: 721}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962365038_962365049 26 Left 962365038 3:134773163-134773185 CCTTCCTGGTTCTCCTCCCCCAT 0: 1
1: 0
2: 0
3: 78
4: 721
Right 962365049 3:134773212-134773234 TTGCTGCCACCAGCACTCATGGG 0: 1
1: 0
2: 4
3: 14
4: 133
962365038_962365048 25 Left 962365038 3:134773163-134773185 CCTTCCTGGTTCTCCTCCCCCAT 0: 1
1: 0
2: 0
3: 78
4: 721
Right 962365048 3:134773211-134773233 TTTGCTGCCACCAGCACTCATGG 0: 1
1: 0
2: 0
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962365038 Original CRISPR ATGGGGGAGGAGAACCAGGA AGG (reversed) Intronic
900611427 1:3546181-3546203 GTGGGGGAGGAGGCCGAGGAGGG - Intronic
901201419 1:7469506-7469528 ATGGGGCTGGAGGCCCAGGAAGG - Intronic
901881355 1:12195688-12195710 ATGGAGGAGGAGGACAAGGGAGG + Intronic
902054295 1:13587470-13587492 ACGGGGGAGGAGGAGGAGGAGGG + Intronic
902254410 1:15178293-15178315 GTGGGGTGGGAGGACCAGGAAGG - Intronic
902620598 1:17648550-17648572 GTAGGGGAGGAGAACCAGCCAGG + Exonic
903345185 1:22679958-22679980 TTGGGGGAGGAGCAGCTGGAAGG - Intergenic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903713969 1:25349105-25349127 ATGGGGCAGGAGAAGCAGTGTGG + Intronic
904013799 1:27405396-27405418 TTGGGCGGGGTGAACCAGGAAGG + Exonic
904190358 1:28737997-28738019 ATGGGGGAGGGGAAGCGGGAGGG + Intronic
904964548 1:34361298-34361320 ATGGGGAAAGAGAGCCAGGATGG + Intergenic
905569451 1:38991816-38991838 CTGGGGGAGGAGAGCCTGGAGGG + Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
907052800 1:51341070-51341092 CTGAGGCAGGAGAACCTGGAAGG + Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907348018 1:53800423-53800445 CTGAGGCAGGAGAACCAGGGAGG - Intronic
908332015 1:63080590-63080612 AGTGGGGAGGGGAACAAGGAAGG + Intergenic
908858780 1:68459794-68459816 ATGGGGTAGAAGAAGCAGGGTGG + Intergenic
910620556 1:89248844-89248866 AGGAGGGAAGAGCACCAGGAAGG + Intergenic
910820218 1:91337860-91337882 AAGGAGGAGGAGAACCAAGAGGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911856495 1:102884164-102884186 ATGAGGGATGAGAGACAGGAGGG - Intronic
912201125 1:107459485-107459507 ATGGGGGAGGAAAAAAAGGCAGG + Intronic
912303086 1:108536717-108536739 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
912669237 1:111608800-111608822 CTGAGGCAGGAGAACCAGGCAGG + Intronic
912876967 1:113370227-113370249 GGGGGAGAGGAGAACCATGAGGG + Intergenic
913047002 1:115082660-115082682 ATATGGGAGAAGAAGCAGGAAGG - Intronic
913057896 1:115179117-115179139 TTGGGGGAGGAGAATTGGGAAGG + Intergenic
914938719 1:152003373-152003395 CTGGGGGAGGAGTAACACGAGGG + Intergenic
915010089 1:152677283-152677305 AGGGGGGAGAAGCGCCAGGATGG + Intergenic
915011254 1:152688099-152688121 AGGGGGGAGAAGTGCCAGGATGG + Intergenic
915046698 1:153023393-153023415 ATCAGGGAGGACAACCAGGAGGG + Intergenic
915074853 1:153299582-153299604 CAGGAGGAGGAGAACAAGGAGGG - Intronic
915105671 1:153533880-153533902 ATGGGGGCTGAGATCCAGGCTGG + Intergenic
915208239 1:154287016-154287038 CTGAGGCAGGAGAATCAGGAAGG - Intergenic
915360516 1:155283913-155283935 ATGGAGGAGGACAAGCAGGGAGG + Intronic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915458425 1:156055027-156055049 GTGGGGAAGGATCACCAGGAAGG + Intronic
915622710 1:157095667-157095689 GTGGGGGTGGAGAAACAGGGAGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915733702 1:158071610-158071632 AGGTGGGAGGGGAACCAGGAAGG - Intronic
915913877 1:159929981-159930003 ATGGGGATGGGGTACCAGGAGGG + Intronic
915916969 1:159946026-159946048 TGGGGGTAGGAGAACCAGGCGGG + Intergenic
916805202 1:168252939-168252961 ATGGGGGAGGAGAGACAGCTTGG - Exonic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
917779400 1:178376088-178376110 ATGTGGGAGGAAAGCCAGGATGG + Intronic
917794100 1:178520650-178520672 CTGGGGGAGGAGGGCCAGGGAGG - Intronic
917836717 1:178946909-178946931 ATGGGAGGGGAGCACAAGGAGGG + Intergenic
918364700 1:183795446-183795468 GTGGGAGAGGAGAACAGGGAAGG + Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919407198 1:197200731-197200753 TTTGGGGCGGAGAACAAGGAGGG + Intergenic
919760999 1:201098001-201098023 TTGGGGGGTGAGAGCCAGGAAGG - Intronic
919857025 1:201712955-201712977 AATGGGGTGGAGAGCCAGGAAGG - Intronic
919920991 1:202166294-202166316 GAGGGGCAGGGGAACCAGGATGG + Intergenic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920088178 1:203433100-203433122 TTGGGAGACGGGAACCAGGATGG + Intergenic
920647873 1:207816507-207816529 ATGTGGGATGAGGGCCAGGAAGG - Intergenic
920657337 1:207886767-207886789 ATGGGGGTGCAGAGCAAGGAAGG + Exonic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922952949 1:229574422-229574444 ATGGTGGAGGAGATTCAGTAAGG - Intergenic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
924009538 1:239649650-239649672 ATGGTGGAGGTAACCCAGGAAGG + Intronic
924462585 1:244272507-244272529 ATGGGGGAGGAGAGCAGGGCAGG - Intergenic
1063153408 10:3356495-3356517 ATGGGGCTAGAGAACGAGGAAGG - Intergenic
1063295675 10:4803247-4803269 GTGGAGGAGGAGCACCAGGAAGG + Intronic
1063335939 10:5213326-5213348 ATGGGTGGAGAGAATCAGGATGG + Intronic
1064971043 10:21067478-21067500 AGGAGGGAGGAGAACAAGAAGGG + Intronic
1065147609 10:22786321-22786343 ATGTGGGAAGAAAACCAGTAAGG - Intergenic
1065149063 10:22802955-22802977 TTGGGGGAGGAGTACCAAGTAGG + Intergenic
1065932314 10:30490696-30490718 ATGGGTGGGGAGAACCCTGAGGG + Intergenic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1069084169 10:64120278-64120300 ATGGGGGAGAGGAGCCAAGATGG + Intergenic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1069784199 10:70977505-70977527 GTGGGGAAGGAGAAGCAGGTGGG + Intergenic
1070212658 10:74342569-74342591 CTGAGGGAGGAGAATCAGGTGGG - Intronic
1070252801 10:74787735-74787757 GTGAGGAAGGAGAACAAGGAAGG + Intergenic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1070714279 10:78707914-78707936 AGGAGGAAGGAGAACCAGGAAGG - Intergenic
1070723652 10:78773548-78773570 GTGAGGGAGGAGACCCAGGCAGG - Intergenic
1070939043 10:80327006-80327028 ATGGGGGTGGAGGACAAGGAAGG - Intergenic
1071709882 10:88039602-88039624 ATGGGGGAGAAGAAAACGGAGGG + Intergenic
1072761618 10:98061467-98061489 AGTGGGGAGGAGATGCAGGAAGG - Intergenic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073070104 10:100787837-100787859 ATGGGGGAAGGAAGCCAGGAGGG + Intronic
1073329695 10:102661920-102661942 CTGGGGGAGGAGGCCCTGGAGGG + Intergenic
1073445218 10:103576356-103576378 GTAGGGGAGCAGATCCAGGAGGG + Intronic
1073512939 10:104053670-104053692 ATGGGAAAGGAGAGCCTGGAGGG - Intronic
1073895240 10:108148672-108148694 ATGGGGAAGAACATCCAGGAAGG + Intergenic
1074197874 10:111205287-111205309 AAGGGGAAGGAGAGCCAGCATGG - Intergenic
1074502439 10:114038750-114038772 GTGTGGGAGGAGGACGAGGATGG + Intergenic
1074754577 10:116615070-116615092 ATGGGGGAGGCTGACCTGGAGGG + Intergenic
1075799500 10:125144307-125144329 TTGGTGGAGGAGAACCAGTTCGG + Intronic
1076081631 10:127586869-127586891 ATGGGGAAGTGGTACCAGGAAGG - Intergenic
1076258281 10:129045785-129045807 AGGCTGGAGGAGAACCAGCATGG + Intergenic
1076831842 10:132999338-132999360 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831855 10:132999382-132999404 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831868 10:132999426-132999448 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831881 10:132999470-132999492 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831894 10:132999514-132999536 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1076831907 10:132999558-132999580 ATGGAGGTGGAGAGACAGGAGGG - Intergenic
1076831920 10:132999602-132999624 ATGGAGGTGGAGAAACAGGAGGG - Intergenic
1077008938 11:371508-371530 CTTGGGTAGGAGGACCAGGAGGG - Intronic
1077391648 11:2303158-2303180 GTGGGGCACGAGAACCAGGCAGG - Intronic
1077424040 11:2466176-2466198 TTGGGGGAGGAGATGCAGGCAGG + Intronic
1077579230 11:3406160-3406182 ATGCGGGAGGTGAACCTGGGAGG + Intergenic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077893552 11:6437190-6437212 ATGGGTGAGGAGAACACAGAAGG + Intronic
1078025757 11:7694023-7694045 ATGTGGGAGGAGAACCAAATTGG - Intronic
1078131677 11:8618972-8618994 ATGGGGGAGGAGAGCAGTGATGG + Intronic
1078323419 11:10357870-10357892 ATGGGGGTGAGGAACCAGGCTGG - Intronic
1078348047 11:10568871-10568893 CTGGGGGAGGAGGAACAGCAGGG - Intronic
1079074493 11:17375548-17375570 ATGGGCAAGGAGAACTAGAAAGG - Exonic
1079120923 11:17684310-17684332 ATTGGGGAGCAGCACCATGAGGG - Intergenic
1080787498 11:35489008-35489030 AGATAGGAGGAGAACCAGGAAGG - Intronic
1081629015 11:44675123-44675145 TTGGGGGAAGAGCACCACGAAGG - Intergenic
1082014002 11:47470800-47470822 GTGGGGGTAGAGAACCAGGAAGG - Exonic
1082836739 11:57656521-57656543 ATGGGGGAGGAGACTCAGATAGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083583656 11:63840622-63840644 GTGAGGGTGGAGAAACAGGAAGG - Intronic
1083877992 11:65534764-65534786 AGGTCAGAGGAGAACCAGGAGGG + Intronic
1084236256 11:67789691-67789713 ATGCGGGAGGTGAACCTGGGAGG + Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084617491 11:70246245-70246267 ATGGGGCAGCTGAGCCAGGAAGG - Intergenic
1084712915 11:70855188-70855210 ATGAGGGAGGAGAACGTGCAGGG - Intronic
1084953963 11:72681517-72681539 AGGGTGGAGGAGGAGCAGGAGGG + Intergenic
1085011046 11:73142073-73142095 ACGAGGGAGGAGCACCGGGAAGG + Exonic
1086079757 11:82890865-82890887 TTGGAGGAGGAAAACCAGGAGGG - Intronic
1086998895 11:93392910-93392932 AGGAGGGAGGAGAAGGAGGAGGG - Intronic
1087105368 11:94402158-94402180 ATGGGGAAGGAAAAACAGCATGG - Intergenic
1088203930 11:107371101-107371123 ATGAGGCAGGAGAACCCGGGAGG - Intronic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1088357542 11:108959600-108959622 TTGGGGGAGGAAATCAAGGAAGG - Intergenic
1088442123 11:109882417-109882439 AGGGTGGAGTAGAACCAGAAGGG - Intergenic
1088648931 11:111940364-111940386 ATGGGGGATGACAGCCAGGGTGG - Intronic
1088674663 11:112180711-112180733 AGGTGGGAGGAGGACCAGGTGGG + Intronic
1088817731 11:113433121-113433143 GAGGGGGAGGAGAAACAGAAAGG + Intronic
1088875497 11:113932831-113932853 TGGGGGCAGGAGAACGAGGAAGG + Intronic
1089255657 11:117192654-117192676 ATGGAGCAGGGGAACCAGGCAGG - Intronic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089657105 11:119956718-119956740 ACGGAGGAGGAGGACGAGGAGGG + Intergenic
1089832262 11:121338930-121338952 ATGTGGGAGGAGCCACAGGAGGG - Intergenic
1089919767 11:122197601-122197623 ATGAGGGAGGTAAAACAGGATGG - Intergenic
1089965884 11:122655060-122655082 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1090464611 11:126923030-126923052 AAGGAGGAGGAAAACCAGGAGGG - Intronic
1090785616 11:130044780-130044802 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1091333449 11:134749238-134749260 ATGAGGGAGGAGCTGCAGGAGGG - Intergenic
1091396079 12:154967-154989 CTGGAGGAGGTGAACCAGCATGG - Intronic
1091664852 12:2411762-2411784 ATGGGGGAGGAGCCTCAGGGTGG - Intronic
1091933452 12:4415888-4415910 ATGGGGAAGGAAGAGCAGGAAGG + Intergenic
1092453386 12:8624453-8624475 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093711708 12:22335268-22335290 ATGGGGGTGGGGGCCCAGGAAGG - Intronic
1093721825 12:22452354-22452376 AGGCGGGAGGGAAACCAGGAGGG - Intronic
1094567338 12:31611663-31611685 ATGGGGGAAGAGAATCTGGTAGG - Intergenic
1096021600 12:48329843-48329865 CAGGGCGAGGAGGACCAGGAGGG + Exonic
1097119652 12:56721370-56721392 GTGGGGCAGGAGAGCAAGGAGGG + Exonic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097928435 12:65157341-65157363 ATAGAGGAGGATAACCAGAATGG - Intergenic
1097952258 12:65444900-65444922 AACGGAGAGGAGAACCAGGCAGG - Intronic
1097965253 12:65572458-65572480 ATGGGGAGGGAGAAACAGAATGG - Intergenic
1098123992 12:67270364-67270386 AAGGGGGAGGGGAGCCAGGATGG + Intronic
1098147775 12:67515483-67515505 AAGGGGGTGGAGTACCAGAAGGG + Intergenic
1098335099 12:69396060-69396082 ATTAGGGTGGAGATCCAGGAGGG - Intergenic
1098387733 12:69936414-69936436 AGGGGGGAGGGGAAGCAAGAAGG - Intronic
1098774030 12:74588832-74588854 CTGAGGGAGGAGAATCAGGCAGG + Intergenic
1100129601 12:91475101-91475123 ATGGGGCAGCAGACCCATGAGGG - Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1100511177 12:95275485-95275507 CTGAGGCAGGAGAACCCGGAAGG + Intronic
1100606758 12:96158201-96158223 TTGAGGCAGGAGAACCAGGCAGG - Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101847354 12:108373190-108373212 ATGGGGGATGAAAAAAAGGATGG + Intergenic
1101909508 12:108850759-108850781 TCGGGGGAGGGGAACCTGGAGGG + Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1103003619 12:117404915-117404937 AGGGGGAAGTAGAACCACGAAGG + Intronic
1103333402 12:120170774-120170796 ATGGGGGAAGAGTACCAGATGGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1104823425 12:131692256-131692278 CTGTGAGAGGACAACCAGGAGGG - Intergenic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1104950994 12:132440039-132440061 ATGGGGATGGAGAACGAGGTTGG - Intergenic
1105887391 13:24653505-24653527 ATCAAGGAGGAAAACCAGGAGGG + Intergenic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106659624 13:31784911-31784933 TTGGGGGAGGAAGACCAGGCAGG - Intronic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107987208 13:45785817-45785839 TTGGGGAAGGGGAACCAGGTGGG - Intronic
1108355911 13:49628560-49628582 ATAGGGGAGGAGAGCCACGCAGG + Exonic
1108379139 13:49840120-49840142 ATGGAGGGAGAGAACAAGGAAGG + Intergenic
1108494305 13:51008793-51008815 ATGGGGGATGAGAAGAAGGGGGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1112206848 13:97332845-97332867 TTTGGGGAGGATAACCAGGCAGG - Intronic
1112416209 13:99205473-99205495 TCTGGGGAGGAGACCCAGGAAGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112872793 13:103995385-103995407 ATGGGGTAGGAGAAGCAGGGAGG - Intergenic
1113313897 13:109158407-109158429 CTGGGAGAGGAGACACAGGAAGG - Intronic
1113423164 13:110185746-110185768 GTGGGAGAGGAGAACGACGAGGG + Intronic
1113655618 13:112066708-112066730 AGGGGGGAGGAGGCCCGGGAGGG - Intergenic
1113706187 13:112434322-112434344 CTGGGGCAGGAGGACCGGGAGGG - Intronic
1114050944 14:18919485-18919507 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1114111615 14:19482437-19482459 ATGGAGGGGGAGAAACAGGGTGG + Intergenic
1114495236 14:23127415-23127437 CTGGAGCAGGAGAGCCAGGAAGG - Intronic
1114648700 14:24269854-24269876 ATGGGGAGGGATATCCAGGATGG - Intronic
1115912775 14:38274925-38274947 ATGGAGGTGGAGAACAAAGAGGG + Intergenic
1116044162 14:39722398-39722420 ATGGGCAAGGAGAATCAGGAAGG - Intergenic
1116941749 14:50797891-50797913 ATGTGGGAAGACCACCAGGAAGG + Intronic
1119025530 14:71149314-71149336 ATGCTGGAGGTGCACCAGGAAGG + Intergenic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119640843 14:76313803-76313825 AAGGGGGAGGGAAAGCAGGAGGG - Intronic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1121940100 14:98062491-98062513 ATGGGCAAGGAGAACTTGGAAGG - Intergenic
1122545042 14:102517324-102517346 CTGGGGGAGGGGAACCCGGAAGG - Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1124066809 15:26352547-26352569 ATGAGGGAGGAGAATAAGGTTGG - Intergenic
1124596892 15:31098750-31098772 CTGGGGGAGCAGACACAGGATGG + Intronic
1124721575 15:32115354-32115376 ATGTGGGAGGAGAAGCAGGCAGG + Intronic
1125158778 15:36619345-36619367 AGGGGAGAGGGTAACCAGGAAGG + Intronic
1126667371 15:51087429-51087451 ATGAGGGAGGAGATTCTGGAAGG - Intronic
1126670827 15:51113686-51113708 ATGGGTCAGAAGAAGCAGGAAGG - Intergenic
1127299639 15:57640020-57640042 GTGGGAGAAGAGAACGAGGAAGG - Intronic
1127682180 15:61308662-61308684 CTGGGGGTGGAGAAGAAGGAAGG - Intergenic
1127712272 15:61611242-61611264 ATGGTGTAGGAGAACAGGGAGGG + Intergenic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1129849019 15:78781243-78781265 ATGGGACAGGAGAGACAGGATGG - Intronic
1129963299 15:79709643-79709665 ATCGGGAAGGAGAACAAGTATGG + Intergenic
1130028381 15:80289770-80289792 ACTAGGGAGGAGAAGCAGGAGGG + Intergenic
1130078376 15:80709700-80709722 GTGGAGGAGGAGAACAATGAGGG - Intronic
1130174392 15:81553269-81553291 ATGGGGAAGGGGAATCAGCACGG - Intergenic
1130243841 15:82224577-82224599 ATGGGGCAGGAGAACCAGCTAGG + Intronic
1130306090 15:82712963-82712985 ATGGGCCAGGAGAAAAAGGAAGG - Intergenic
1130456636 15:84116707-84116729 ATGGGGCAGGAGAACCAGCTAGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131172336 15:90187314-90187336 GTGGGGGAAAAGATCCAGGAAGG + Intronic
1131609616 15:93947455-93947477 ATTGGGGTGGAGAACCATGAAGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132694936 16:1197854-1197876 TTGGGGGAGCAGGCCCAGGATGG + Intronic
1132709070 16:1258599-1258621 ATGGGAGAGGGGACTCAGGATGG - Exonic
1132709090 16:1258655-1258677 ATGGGGGAGGGGATCAAGAAAGG - Exonic
1132921975 16:2400662-2400684 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1133126879 16:3652900-3652922 CTGGGGGAGGAGGGCCTGGAAGG - Intronic
1133157388 16:3884728-3884750 CTGGGGGAGTAGTCCCAGGAAGG + Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1134635350 16:15787570-15787592 CTGAGGCAGGAGAACCAGGGAGG - Intronic
1135530107 16:23245741-23245763 CTGGGGGAAGAGTCCCAGGATGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136683955 16:31983407-31983429 ATGGAGGAGGTGCCCCAGGAGGG - Intergenic
1136784581 16:32926959-32926981 ATGGAGGAGGTGCCCCAGGAGGG - Intergenic
1136854494 16:33643366-33643388 GTGGGGGAGCAGAGCCAGGGTGG - Intergenic
1136885202 16:33926847-33926869 ATGGAGGAGGTGCCCCAGGAGGG + Intergenic
1138635288 16:58333290-58333312 ATGGGGGAGTGGAACCAGGCAGG - Intronic
1138650414 16:58457380-58457402 ATGATGGAGGAGAGCCTGGATGG + Intergenic
1139095726 16:63702862-63702884 ATGTGGGAGGAGAAAGAGTAGGG + Intergenic
1139466892 16:67159040-67159062 ATGGGGAAGGTGAACCAGGCTGG + Intronic
1139645617 16:68327542-68327564 ATGGGGGAGGAAGACTGGGAAGG + Intronic
1140130248 16:72154235-72154257 ATGGTGCAGAAGAACCAGGTCGG + Exonic
1140222530 16:73054345-73054367 GTGGGGGAGGGGAACCGGGCTGG - Intronic
1141021709 16:80502806-80502828 GTGGGAGAGGAGCACCTGGAAGG - Intergenic
1141335029 16:83146504-83146526 CTGGGGCAGGAGTAACAGGAAGG + Intronic
1141703590 16:85653217-85653239 AGGGGGGAGGAGGAGGAGGAGGG - Intronic
1141916399 16:87100131-87100153 ATTGTGGAGGACAAGCAGGACGG + Intronic
1142028272 16:87825809-87825831 ATGGGGGATGTGAACAAGGCTGG - Intergenic
1203087240 16_KI270728v1_random:1190965-1190987 ATGGAGGAGGTGCCCCAGGAGGG - Intergenic
1142641441 17:1288267-1288289 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641553 17:1288521-1288543 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641582 17:1288593-1288615 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641605 17:1288647-1288669 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142641673 17:1288792-1288814 GTGGGGGATGAGAAGCTGGAGGG - Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142905048 17:3035719-3035741 AGGGAGGAGGAGAACAAGGATGG + Exonic
1142961048 17:3552826-3552848 AAGGGGCAGGAGAGCCAGGGAGG + Intronic
1143115390 17:4578925-4578947 GTGAGGCAGGAGAACCAGGCAGG + Intergenic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1144087309 17:11822403-11822425 AAGGGTGGGGAGAACCAGGAAGG - Intronic
1144816871 17:18040614-18040636 CTGGGGGTGGAGAAGCTGGAAGG - Intronic
1145253631 17:21310719-21310741 ATGGGGGCGGAGACCCAGCCAGG - Intronic
1145322951 17:21777242-21777264 ATGGGGGCGGAGACCCAGCCAGG + Intergenic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1145776708 17:27534086-27534108 AAGAGGGAGGCAAACCAGGATGG - Intronic
1146456743 17:33014740-33014762 CTAGGGGAGGAGAAACAGGGTGG + Intronic
1146481763 17:33210671-33210693 ATGGGGGCAGACAACGAGGAGGG + Intronic
1146643902 17:34563640-34563662 ATGTGGGAGGAAGACCAGGTTGG - Intergenic
1146762689 17:35492306-35492328 ATTGGAAAGGAGAACCAGGTTGG + Intronic
1146947954 17:36886528-36886550 CTGGGGGAAGAGAACAAGGAAGG + Intergenic
1146986680 17:37226823-37226845 AAGTGGGAGGGGAAACAGGAAGG - Intronic
1147144880 17:38479110-38479132 ATGGAGGAGGTGCCCCAGGAGGG - Intronic
1147215909 17:38898929-38898951 GTGGGGGAGGAGGCCAAGGAAGG - Intronic
1147256467 17:39185008-39185030 ATGGCCAGGGAGAACCAGGAAGG + Intronic
1147341760 17:39756524-39756546 ATGGGGGAGGGGAAGAAGGAGGG + Intergenic
1147889945 17:43710105-43710127 ATAGGGAGGGAGCACCAGGATGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149513638 17:57263278-57263300 AAGGGAGAAGAGAACAAGGAGGG - Intronic
1150410605 17:64937879-64937901 AAGGGAGAGAAGACCCAGGATGG + Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150764761 17:67994018-67994040 GTGGGGGAGGAGAAGCAGTGAGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151842645 17:76628796-76628818 ATGGGGGAGGAGGAGCAGGCAGG - Intronic
1152261582 17:79270103-79270125 AGGACGGAGGAGAACCAGGAGGG - Intronic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152577756 17:81150379-81150401 ATGGGGTGGGAGCACTAGGATGG - Intronic
1153217664 18:2835341-2835363 ATGGGGGAGAAAAAGCAGGGTGG + Intergenic
1153884659 18:9453431-9453453 ATGGGGGAAGAAAACAATGATGG - Intergenic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154391211 18:13937870-13937892 AGGGTGGAGGAGAGCAAGGACGG - Intergenic
1154498174 18:14977707-14977729 TTGGGATAGGAGGACCAGGATGG + Intergenic
1155063228 18:22247039-22247061 AGGGAGGAGGAGGAGCAGGAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156461454 18:37323518-37323540 ATGGGAGAGGGGCTCCAGGAGGG + Intronic
1157519579 18:48336303-48336325 GTGGGGGGTGAGAGCCAGGAAGG - Intronic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158872769 18:61704646-61704668 ATGAGGGATGAGAGACAGGAGGG - Intergenic
1159571532 18:70119545-70119567 ATTGTGGCGGAGAACCAGCAAGG + Intronic
1160281853 18:77498616-77498638 TTGGGGCAGGAGAACCATTAGGG + Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160517375 18:79486106-79486128 ATGGGGTGGGAGAACCAGGCAGG + Intronic
1160927664 19:1554629-1554651 GTGGGGGATGGGCACCAGGAGGG - Intergenic
1161350216 19:3786954-3786976 ATGGGGGAGGAAATCCCGGCTGG - Intronic
1161633090 19:5369203-5369225 ATGGGGTAGGAGCCACAGGATGG - Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162142932 19:8595646-8595668 AGGGGGTGGGAGAACCGGGAAGG - Intronic
1162224690 19:9210861-9210883 GTGGCGAAGGAGAACCAGGGTGG + Intergenic
1162565208 19:11442150-11442172 ATGGGGCTGGAGAATCAGGCAGG + Intronic
1162866513 19:13551950-13551972 CTAGAGGAGGAGAACCAGGAGGG - Intronic
1162932792 19:13965723-13965745 CTTGGAGAGGAGCACCAGGATGG + Exonic
1163748589 19:19062308-19062330 ATGGGAGAGGAGGTCCAGGTAGG + Intergenic
1163846913 19:19643270-19643292 CTGGGGGAGGGGGCCCAGGAAGG - Intronic
1164441970 19:28285354-28285376 ATGGTGGAGGGGAAGCAGGTTGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1164915216 19:32046627-32046649 CTGGAGGAGGTGAACCAAGAGGG - Intergenic
1165159889 19:33809952-33809974 ATGGGGCAGGAGAGGCAGGATGG + Intronic
1165188950 19:34046177-34046199 ATGGGGCATGTGACCCAGGATGG - Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165586709 19:36923109-36923131 ATGGGGACAGGGAACCAGGATGG - Intronic
1166090331 19:40504153-40504175 ATGCGGGTGGAGTGCCAGGAGGG + Intronic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167115934 19:47489080-47489102 CTGGGGCAGGAGGAACAGGATGG + Intronic
1167286658 19:48602233-48602255 AGGGAGGAGGGGAGCCAGGAAGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167689828 19:50978487-50978509 ATGGGGGTGGAAAAGAAGGAGGG + Intronic
1167689844 19:50978574-50978596 ATGGGGGTGGAGAAGAAAGAGGG + Intronic
1167781758 19:51602880-51602902 GTGGGAGGGGAGAATCAGGAAGG - Intergenic
1168357735 19:55712897-55712919 AGGGGGGAGGAGATGGAGGAGGG + Intronic
1168510196 19:56967510-56967532 AGGAGGGAGGAGAAGGAGGAAGG - Intergenic
925378647 2:3407822-3407844 ATGGAGGAGGGCCACCAGGAAGG + Intronic
925407734 2:3616658-3616680 CTGAGGCAGGAGAACCAGGCAGG + Intronic
925532352 2:4877834-4877856 GTGTGAGAGGAGAACCTGGAAGG + Intergenic
925579579 2:5397040-5397062 AGGATGGAGGAGACCCAGGAGGG + Intergenic
925794275 2:7526006-7526028 AGGTGGGAGGAGAGCTAGGAGGG - Intergenic
925927587 2:8681672-8681694 AAGGGGGAGGGGAAGGAGGAGGG - Intronic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926228606 2:10986051-10986073 ATGGGTGAGGGGAGCCAGGCGGG + Intergenic
927190190 2:20512112-20512134 ATGGGGAAGAAGAACCAGGGTGG + Intergenic
927706311 2:25298601-25298623 GTGTGGGAGGAGAGCCAGGCCGG - Intronic
928070489 2:28210181-28210203 AGCAGGGAGGAGAACCAGGGAGG - Intronic
928106742 2:28475421-28475443 ATGGTGGTGGAGAAGGAGGAAGG - Intronic
928341168 2:30444157-30444179 ATGGGGGTGGGGAACGGGGAAGG + Intergenic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929524967 2:42693461-42693483 AAGGGGAAGGAAAAGCAGGAAGG - Intronic
929789359 2:45012207-45012229 ATGGGGGAGGAGGAGAATGAGGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931508874 2:62965874-62965896 ATAGGGAAAGAGAGCCAGGAAGG - Intronic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931899211 2:66769378-66769400 AGGGAGGAGGTGAACAAGGAAGG - Intergenic
932422655 2:71610806-71610828 AGGAGGCAGGAGAACCAGGCTGG + Intronic
932601965 2:73133724-73133746 AAATGGGAGGAGAGCCAGGAAGG + Intronic
932688982 2:73896538-73896560 GTGGGAAAGGGGAACCAGGAGGG + Intronic
932737157 2:74262231-74262253 ATCTGGGAGGAGAATCAGAAGGG + Exonic
933071084 2:77858422-77858444 AAGGTGGAGGAGAAGCAGGCAGG - Intergenic
933374343 2:81460396-81460418 ATGAGGGAGGATAACTGGGAAGG - Intergenic
933590220 2:84224735-84224757 ATGGGGGAGAGGAGCCAAGATGG + Intergenic
933721362 2:85399390-85399412 CTGAGGCAGGACAACCAGGAAGG + Intronic
933739983 2:85525698-85525720 CTGGGAGAGGAAAACCAGGAGGG - Intergenic
933750942 2:85601947-85601969 ATGAGGGAGGGGAGCCAGGGTGG + Exonic
934566059 2:95341967-95341989 ATGATGGAGGAGATCTAGGAAGG + Intronic
934769547 2:96899119-96899141 ATGGGGAAGGAGCTCCAGGAAGG + Intronic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935531679 2:104240404-104240426 AGGAGGGAGGAGGACGAGGAGGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
935788525 2:106570467-106570489 ATGTGGGAGGAGAGCCCTGAAGG + Intergenic
937317979 2:120944038-120944060 ATGGGGGATGTGTACCTGGACGG - Intronic
937412752 2:121690593-121690615 ATGGGGGAGGAGTAAGGGGAGGG - Intergenic
937878821 2:126849933-126849955 AAGGAGGAGGAGGAGCAGGAAGG + Intergenic
938394105 2:130929348-130929370 ATGGAGGAAGAGAAACTGGATGG - Intronic
938422869 2:131157727-131157749 CTGGGCCAGGAGATCCAGGAGGG - Intronic
938613336 2:132971798-132971820 CTGGGGGAGGAGAAGAAGTACGG + Intronic
938775613 2:134538823-134538845 ATGGGGAAGGAGACCTGGGAGGG + Intronic
940324767 2:152413517-152413539 ATGGGGGAGGAGGAGAAGGTGGG + Intronic
940452504 2:153857468-153857490 ATGGGGCAGGAGAACCAAGTAGG + Intergenic
941010843 2:160297817-160297839 TTGGAGGAGGATAAGCAGGAAGG + Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
942618819 2:177825391-177825413 GTGGGAGAGGAGAACAAGGAAGG + Intronic
943435937 2:187866405-187866427 ATGGGGCTGGACAACCAGGGAGG + Intergenic
943982587 2:194573343-194573365 AAGGGGGAGGAAAACAATGAAGG - Intergenic
944542069 2:200763523-200763545 TGGGGAGAGGGGAACCAGGAAGG + Intergenic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
944842136 2:203634678-203634700 ATGGGGGGATAGCACCAGGAAGG + Intergenic
946179712 2:217942152-217942174 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946199599 2:218064195-218064217 ATGGGGAAGCAGAGCCAGAAGGG + Intronic
946401272 2:219469502-219469524 CTGGGGGAAGGGAACCCGGAGGG + Intronic
946501852 2:220257370-220257392 AGGGGGGAGGAGGAATAGGAGGG + Intergenic
946993642 2:225365165-225365187 TTGGGGGAGGAGAAGCAGCAGGG - Intergenic
947014524 2:225603631-225603653 ATGGGCCAGGAGAACCAGAATGG - Intronic
947040545 2:225913945-225913967 ATGGGGAAGGAAAAGCATGAAGG - Intergenic
948478920 2:238238767-238238789 AGGAGGGAGGAGATCCAGGGAGG + Exonic
948760312 2:240186171-240186193 TTGGTGGAGGAGAAGCGGGATGG + Intergenic
948789322 2:240369302-240369324 GTGGGGCAGGTGAAGCAGGAAGG - Intergenic
948918100 2:241048475-241048497 CTGGGGCAGGAGACCCAGGGAGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1169325285 20:4670744-4670766 ATGGGGGAGGAGATGCAGCAAGG + Intergenic
1169571204 20:6908050-6908072 ATGGGGGAGGGGACACTGGATGG + Intergenic
1169585984 20:7086048-7086070 ATGGAGGAGGAAAAGAAGGAAGG - Intergenic
1169897775 20:10522733-10522755 ATGGCGGGGAAGAACAAGGAGGG - Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170966005 20:21072214-21072236 AGTGGGGAGCAGAACCAGGAAGG + Intergenic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1170996947 20:21370950-21370972 ATGGGGGAGAAGAAACAGTGTGG + Intronic
1171178878 20:23076943-23076965 ATGGGGGATGAGGGCCTGGATGG + Intergenic
1171964033 20:31515834-31515856 GTGGGGGAGGAGCATCGGGAAGG - Intronic
1172279797 20:33700873-33700895 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1172451780 20:35030623-35030645 ATCGGTGAGGAGAACCAAAATGG - Intronic
1172735671 20:37125316-37125338 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1172778304 20:37420669-37420691 ATGGGGAAGGAGGAGCAGGGAGG - Intergenic
1173551720 20:43937392-43937414 CTGGGAGAGGAGACCCAGGAGGG + Intronic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1173948814 20:46974336-46974358 CTGGGGGAAGAGAAACAGGCAGG - Intronic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1175356848 20:58375407-58375429 ATGGGGGAGGGGGAGGAGGAGGG - Intergenic
1175676760 20:60952921-60952943 ATCAGGAAGGAGAAGCAGGATGG + Intergenic
1176053391 20:63132594-63132616 ATGGGGCTGATGAACCAGGAAGG - Intergenic
1176310429 21:5146221-5146243 GAGGAGGAGGAGGACCAGGAGGG - Exonic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177743301 21:25179715-25179737 GTGAGGGAGGAAAACCTGGAGGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1179341629 21:40516391-40516413 TTGGGGGAGGGGAGCCAGGGAGG - Intronic
1179570812 21:42277941-42277963 ATGGGGGAGGAGGAGCATTAAGG - Intronic
1179674823 21:42974410-42974432 CTGGGGGAGGAGAGCGAGGGCGG - Intergenic
1179778663 21:43685300-43685322 ATGGGGGAGGAGACACTGGATGG - Intronic
1179846626 21:44115814-44115836 GAGGAGGAGGAGGACCAGGAGGG + Exonic
1180039336 21:45268090-45268112 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1180086267 21:45509296-45509318 ATGGAGGAGGGGCACCCGGAGGG + Intronic
1180469421 22:15641860-15641882 ATGGAGGGGGAGAAACAGGGTGG - Intergenic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1180971956 22:19820483-19820505 ATGGGGTGGGGGAACCAGAAGGG - Intronic
1181052987 22:20246456-20246478 AGGTGGGAGGAGAGCGAGGAGGG + Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181387926 22:22558410-22558432 ATGGGGGAAGGGAAACAGGGTGG + Intronic
1181571953 22:23772714-23772736 GTGGGGGAGGTGAACGGGGAGGG - Intronic
1181853987 22:25769354-25769376 ATACGGAAGGAGAACCAAGACGG + Exonic
1182003297 22:26938931-26938953 ATGTGGGATGGGAACCAGAAGGG - Intergenic
1182066080 22:27432628-27432650 TTTGGGGAGGTGAGCCAGGATGG - Intergenic
1183394624 22:37564255-37564277 GTGGGGGTGGGGAATCAGGAAGG + Intronic
1184115480 22:42419343-42419365 CTGCTGGAGGAGACCCAGGAAGG + Intronic
1184282581 22:43446614-43446636 ATGGGGGATGGGACCCAGTAGGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184620345 22:45671986-45672008 AAGGGGGAGGATGACGAGGAGGG - Exonic
1184661355 22:45967045-45967067 ATGGGGGAGGGGCCCCAGGCAGG + Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
949570142 3:5284623-5284645 ATGAGGCAGGAGAATCAGGCAGG + Intergenic
950283297 3:11725164-11725186 AAGAGGGAAGAGAACAAGGAGGG - Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950650893 3:14406015-14406037 CTGTGGGTGGAGAAACAGGATGG + Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
954060243 3:48061289-48061311 CTGAGGGAGGAGAATCAGGCAGG - Intronic
954294175 3:49665004-49665026 ATGTGGGAGGAGAAAAAGGAGGG + Intronic
954876441 3:53805868-53805890 ATGCGGGAGGAGGAGGAGGAGGG - Intronic
955140936 3:56269254-56269276 ATTTGAGATGAGAACCAGGAAGG - Intronic
955147903 3:56338443-56338465 GTGGGGGATGAGAGACAGGAAGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955857033 3:63283905-63283927 CTGAGGCAGGAGAACCCGGAAGG - Intronic
956823292 3:72973207-72973229 CTGGGGGAGGGGCACCAGGGAGG + Intronic
957307174 3:78472701-78472723 TTGGGGGAGCTGAACCAAGATGG + Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
957562417 3:81839657-81839679 ATGGGGGAGGGGAAGGAGTAGGG + Intergenic
957617695 3:82552536-82552558 TTGGTGGAGGAGAAGTAGGAAGG - Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
959023673 3:101216023-101216045 ATGGTCAAGGAGAACCTGGAGGG - Intergenic
960260177 3:115558553-115558575 ATGGGGGTGAAGAACTTGGAAGG + Intergenic
960556871 3:119039612-119039634 ATGGGGGACTAGATCCAGTAGGG - Intronic
960628543 3:119704403-119704425 AGGGCGGATGAGAACCTGGATGG + Intronic
960996494 3:123343772-123343794 GTGGGGGAGGACAGGCAGGAGGG + Intronic
961508806 3:127388808-127388830 CTGGGGCTGGAGAAGCAGGAGGG - Intergenic
962309341 3:134314165-134314187 TTGGGGGTGGAGATCCAGGAGGG + Intergenic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
962960834 3:140309747-140309769 ATAGGGAAGGAGAAGCACGAAGG - Intronic
963838415 3:150080133-150080155 ATGGGGGATGAGCAGCCGGAAGG - Intergenic
964374428 3:156035578-156035600 AGGGGGGAGGAGGAGGAGGAAGG - Intergenic
964398431 3:156272682-156272704 AGTGGGGAGGAGCACCAAGAGGG - Intronic
964814126 3:160698507-160698529 TTAGGGGAGGAGAAACAGGTTGG - Intergenic
965406867 3:168280436-168280458 ATGGGGGAAGAAGACCAGGCAGG - Intergenic
966967077 3:185004379-185004401 CTGAGGCAGGAGAACCAGGCAGG + Intronic
967066345 3:185920385-185920407 CTGGGGGAGGAGACTCAGGTGGG + Intronic
967442788 3:189528285-189528307 CTGAGGCAGGAGAACCTGGAAGG - Intergenic
967655540 3:192043863-192043885 ATGTGGGAGGTGCAGCAGGATGG + Intergenic
968702348 4:2062994-2063016 GTGGGGGAGGGGAACCGGCAGGG - Intronic
968713560 4:2138244-2138266 ATGGGGTTGGAGAAGCAGGTGGG + Intronic
968922789 4:3531281-3531303 AAGGGAGAGGAGAAACAGGTGGG - Intronic
968968447 4:3781283-3781305 ATGGGGGAGGAGTTTCATGAGGG - Intergenic
968995012 4:3939858-3939880 ATGCGGGAGGTGAACCTGGGAGG + Intergenic
969323292 4:6426024-6426046 ATGGGGGATCAGAGCCATGAGGG - Intronic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
972289570 4:37678904-37678926 ATGGGAGAGGAGGATCAGGTAGG + Intronic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
972939595 4:44181342-44181364 CTGAGGCAGGAGAACCAGGCAGG - Intronic
973158605 4:46989524-46989546 AAGGGAGAGGAGATCCTGGAGGG + Intronic
973330190 4:48905074-48905096 CTGGGGCAGGAGGACCAGGTTGG + Intronic
973857391 4:55026697-55026719 GCGGGGGAGGAGTATCAGGAGGG + Intergenic
974155784 4:58070378-58070400 ATTGGGGAGGTGATTCAGGAAGG + Intergenic
974329496 4:60459046-60459068 ATGGTGAAGGAAAACCAGCAAGG - Intergenic
975078221 4:70240380-70240402 TTGTGGGAAGAGAACCAGCAGGG - Intergenic
975838694 4:78451790-78451812 ATGGAACAGGAGAACCTGGAGGG + Intronic
976416975 4:84787834-84787856 TTTGGGGTGGAGAAACAGGAAGG + Intronic
976756230 4:88500573-88500595 AAGGGGCAGGAGAACTAGGATGG + Intronic
977171117 4:93763766-93763788 ATGGGGGAGGAGAAACAGACGGG + Intronic
977416891 4:96744246-96744268 AAGGAGGAGGAGAACAAAGAGGG - Intergenic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
977891809 4:102321044-102321066 CTGGAGGATGACAACCAGGAAGG + Intronic
978721890 4:111919902-111919924 ATGGGAGAGGAGTTGCAGGAGGG - Intergenic
979188335 4:117826840-117826862 ATAGGGGAACAGAAACAGGAAGG + Intergenic
979561663 4:122108358-122108380 ATAGGGGAGGACCATCAGGAGGG - Intergenic
980762900 4:137260303-137260325 ATGGGGCAGGAGATCAAGAAAGG - Intergenic
981310534 4:143293927-143293949 CTGAGATAGGAGAACCAGGAAGG - Intergenic
981735206 4:147942581-147942603 AAGGGGCAGGAGAAGGAGGACGG - Intronic
981842459 4:149128346-149128368 ATTGGGGTGGAGAGCCAAGATGG + Intergenic
982106574 4:152016568-152016590 ATGAGAGAGGAGAGACAGGAGGG + Intergenic
982373821 4:154664800-154664822 CTGAGGCAGGAGAACCAGGAAGG - Intronic
983120457 4:163877751-163877773 ATGGGTGAGGAGATCCAAGATGG - Intronic
983906940 4:173193011-173193033 ATGGGGGAGGAAAACCTAAAAGG + Intronic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985075540 4:186210342-186210364 AGGTGGAAGGAGAACCAGAATGG - Intronic
985132146 4:186749677-186749699 GTGGGGGAAGAGAGACAGGAAGG - Intergenic
985475508 5:76739-76761 ATGGGAGAGGAGGCCTAGGAGGG + Intergenic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
986079172 5:4371739-4371761 CTGGGGGAGGAAGACCTGGATGG - Intergenic
986445134 5:7814933-7814955 CGGGGGGAGGGGAACCAGCAAGG - Intronic
987717118 5:21586185-21586207 TTGGGAAAGGAGAACCAAGAAGG + Intergenic
988318123 5:29658002-29658024 ATGTGGGAGGAGGACCATGGTGG + Intergenic
988785897 5:34565153-34565175 ATGGGGAAGGAGACCCGGAAGGG - Intergenic
988808406 5:34761710-34761732 AAGGCGGAAGAGAACCAGGGAGG - Intronic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
991910263 5:71552719-71552741 CTGAGGCAGGAGAACCAGGCAGG + Intronic
992067198 5:73119753-73119775 TTAGTGGTGGAGAACCAGGAAGG + Intergenic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
996324169 5:122253192-122253214 ATGTGGGAGGAGATTCAAGATGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997443384 5:133924656-133924678 AGGTGGGAGGAAAGCCAGGAGGG - Intergenic
998416527 5:141950228-141950250 ATGGGAGAGAGGGACCAGGATGG - Intronic
998600690 5:143581881-143581903 AGGGAGGAGGAAAACCAAGAGGG + Intergenic
1000113869 5:158135209-158135231 ATGGGGCAGGAGAAAGGGGATGG + Intergenic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000155965 5:158552078-158552100 GTTGGAGAGGAGAATCAGGAGGG + Intergenic
1000204672 5:159047522-159047544 ATGGGGGAGGGGCAACAGCAAGG + Intronic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1001116927 5:168947743-168947765 ATGGGGAAGGAGAGCCTGAAAGG + Intronic
1001492050 5:172162830-172162852 ATGGTGGAGGAGGCCCAGGTGGG + Intronic
1001651184 5:173317521-173317543 GTGGGGGAGGTGAACCAGGGAGG - Exonic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1001966169 5:175911251-175911273 ATGTGGGTGGACAACCAGGCCGG - Intergenic
1002087389 5:176784748-176784770 CTGGGGGAGGAGTCCCAGGGAGG + Intergenic
1002250776 5:177927951-177927973 ATGTGGGTGGACAACCAGGCCGG + Intergenic
1003167615 6:3694964-3694986 AAGGAGGAGGAGGACAAGGAGGG - Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003688741 6:8330796-8330818 ACTGTGGAGCAGAACCAGGAGGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1005169565 6:22967299-22967321 ATGGGGAAGAAGCACCAGGAAGG - Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005345331 6:24883869-24883891 GTGGGGGAGCATAAACAGGATGG - Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006795436 6:36729398-36729420 AAGTGGGAAGAGAAACAGGAAGG - Intronic
1006818056 6:36866972-36866994 ATGGTGGCGGAGAACCACAATGG + Intronic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007389007 6:41539070-41539092 GGGGTGCAGGAGAACCAGGAAGG + Intergenic
1007651877 6:43427718-43427740 CTGGGGGCGGAGAAACGGGAGGG + Exonic
1007740315 6:44005709-44005731 GTGGGGGTGGAGTGCCAGGAAGG - Exonic
1007761480 6:44135941-44135963 ATGGACCAGGAGAACCTGGAAGG - Intronic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1007955213 6:45911887-45911909 TTGGGAGATGAGAACTAGGAGGG + Intronic
1008029417 6:46676784-46676806 TTAGAGGAGGAGTACCAGGAGGG + Exonic
1008137191 6:47790500-47790522 ATGGGGGAGGTGAAGGAGGGAGG - Intronic
1008370374 6:50724127-50724149 ATGGGGGAGGAGGGTTAGGAAGG + Intronic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1009933377 6:70203504-70203526 TTGGTGGAGTAGAACCAGGGAGG + Intronic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1011632309 6:89339492-89339514 ATGGGGGAGGAGAGAGGGGAGGG + Intronic
1012956516 6:105576606-105576628 AAGGGAGAGGAAATCCAGGAGGG - Intergenic
1012958367 6:105595072-105595094 AAGATGGAGAAGAACCAGGAAGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014399148 6:120965440-120965462 ACGGGGGAGCAGACCCAGAAAGG + Intergenic
1014642340 6:123927792-123927814 AGAGGGGAGGAGAAGGAGGAGGG + Intronic
1014665981 6:124238169-124238191 AGGGGGGAAGAAAAACAGGAAGG + Intronic
1014913316 6:127118621-127118643 ATAGGGGAGGAGGAGGAGGAGGG - Exonic
1014947423 6:127515384-127515406 AAGAGGGAGGAGAACAAGAAAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016000653 6:139037683-139037705 GTGTGGGAGGAGGAACAGGAGGG - Intronic
1016528907 6:145036630-145036652 ATGGAGGAGGAGCCACAGGACGG - Intergenic
1017297236 6:152812085-152812107 AAGGAGGAGGAGAAGAAGGAAGG - Intergenic
1017318061 6:153055482-153055504 ATGGTGGAGAAGAACAAGGCAGG + Intronic
1017557121 6:155583486-155583508 ATGGGGGAGGAGGTGCTGGATGG + Intergenic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1019129625 6:169864309-169864331 AGGGGGAAGGAGCACCAGGGAGG - Intergenic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019152545 6:170018605-170018627 AGGGGGGAGGCGAATCCGGAGGG + Intergenic
1019266796 7:121627-121649 AGGGGGGAGGAAATGCAGGAAGG + Intergenic
1019420062 7:946578-946600 ATGGGGCTGGAGCACCAGGAGGG - Intronic
1019446938 7:1076272-1076294 ATGAGGGAGGAGCACCACCAGGG + Intronic
1019529067 7:1494674-1494696 ATTGTGGAGGAGGAGCAGGATGG + Intronic
1020262147 7:6536554-6536576 GTGGGAGAGGAGAACCGAGAGGG + Intronic
1020319277 7:6928176-6928198 ATGCGGGAGGTGAACCTGGGAGG + Intergenic
1022229546 7:28400576-28400598 AAGGGGGAGGAGAGCCAGGTAGG + Intronic
1022521328 7:31009035-31009057 ATGGGGGGAGAGAAGCAGGAGGG - Intergenic
1022816001 7:33914802-33914824 AGGCAAGAGGAGAACCAGGAAGG + Intronic
1023021617 7:36016573-36016595 AGGGGAGAGGAGACCCATGAGGG - Intergenic
1023911227 7:44558440-44558462 AGGGGGGAGGAGAAGGAGGGAGG - Intergenic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1025233635 7:57219245-57219267 ATGGAGCTGGAGACCCAGGAAGG - Intergenic
1025943502 7:66089707-66089729 CTAGGGGAGGAGAAGCAGGGGGG - Intronic
1026019978 7:66698821-66698843 AAGGTGGAGGAGTACCAGGGTGG - Intronic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026800605 7:73397755-73397777 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026800611 7:73397773-73397795 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026980906 7:74526111-74526133 TTGGGGGAGGGGAACCAGGGAGG + Intronic
1028687606 7:93609654-93609676 GTGGGGCAGGAGAATGAGGATGG + Intronic
1028742255 7:94288957-94288979 CTGGGGGAGGAGAAAAAAGAAGG + Intergenic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1029346311 7:99981118-99981140 CTTGGGGTGGAGAGCCAGGACGG + Intergenic
1029558861 7:101289398-101289420 CTTGGGGTGGAGAGCCAGGACGG - Intergenic
1030343739 7:108409631-108409653 TTGGGGGAGGAGGAGCATGATGG + Intronic
1030561430 7:111091774-111091796 TGGGGGGAGGAGAAAAAGGAGGG + Intronic
1031443116 7:121817382-121817404 ATTGGAGAGGAGAAATAGGATGG + Intergenic
1031555968 7:123176778-123176800 AGGTAGGAGGAGAACCAGGAGGG - Intronic
1032466298 7:132147753-132147775 ATCGGGGAAGAGAGCCAGGTGGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1033718553 7:144030721-144030743 ATGAGAGAGGAGAGACAGGAAGG - Intergenic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1034254641 7:149717895-149717917 CTGAGGCAGGAGAACCTGGAAGG - Intronic
1034520303 7:151614311-151614333 ATGGGGGAGCAGCAGCAGGGTGG + Intronic
1034593072 7:152160391-152160413 AAGTGTGAGGAGCACCAGGAGGG - Intronic
1034684575 7:152958932-152958954 ATGGGGGAGGAGGACCCAGATGG - Intergenic
1035022950 7:155809603-155809625 TTGGGTGAGGAGAGCCAGGCCGG - Intronic
1035299755 7:157889226-157889248 ATGGGGGCGGGTAACCAGGCGGG - Intronic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1037403721 8:18519631-18519653 ATGAGGGGAGAGAGCCAGGAGGG + Intergenic
1038151341 8:24944002-24944024 ATCGGTGTGGAGAACTAGGAAGG - Intergenic
1038205092 8:25458286-25458308 AGGTGGGAGGAGGACCAGGTGGG - Exonic
1038666702 8:29543633-29543655 ATGAGGGAGGGGAACCAAGGAGG + Intergenic
1038845012 8:31221056-31221078 AGGTGGGAGGAGGACCAGGTGGG - Intergenic
1039597001 8:38799137-38799159 GTGGGGGAGGAGAGCTGGGAGGG + Intronic
1041234762 8:55788901-55788923 ATGAGGGAGGAGAACCAAAGAGG - Intronic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041775220 8:61515445-61515467 AGGAGGAAGGAGAACCAAGAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1043449098 8:80348992-80349014 ATAGGAGAGGAGATACAGGAGGG + Intergenic
1044331054 8:90920762-90920784 ATGGGGGAGATAAACAAGGAAGG - Intronic
1044333644 8:90950189-90950211 GTGGGGGTGGAGAAAAAGGATGG + Intronic
1044460421 8:92438160-92438182 ATGGGGGAAGAGAAAAAGGATGG - Intergenic
1044712833 8:95073515-95073537 ATGGGGGAGGAGGAGCAGCGGGG - Intronic
1045087824 8:98706231-98706253 TTGGGGGAGGAGAACAGTGATGG + Intronic
1045498274 8:102726538-102726560 TCGGGGGAGGAGAATCAGCAGGG + Intergenic
1046097749 8:109580622-109580644 AAGAGGCAGGAGAACCAAGATGG - Intronic
1046738153 8:117799676-117799698 GTGGGGGAGGGGAAGCAAGAAGG - Exonic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049297107 8:141847353-141847375 ATGTGAGATGAGAAACAGGAAGG + Intergenic
1049440305 8:142606545-142606567 CTGGGGGAGGAACAACAGGAGGG - Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1050337697 9:4605415-4605437 ATGTGGACTGAGAACCAGGATGG + Exonic
1051320120 9:15894286-15894308 GTGGGGGAAGAGCATCAGGAAGG + Intronic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1051575474 9:18610506-18610528 ATGGCAGTAGAGAACCAGGAAGG + Intronic
1052377314 9:27731967-27731989 CTGGGGGATGAGAACCAGCCTGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053185153 9:36009722-36009744 ATGAGGCAGGAGAAGCAGAAAGG + Intergenic
1053433328 9:38058399-38058421 ATGAGGGAGAAGAGCCAGGATGG - Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055563233 9:77542850-77542872 ATGGGGGAAGGGAACTAGGTTGG + Intronic
1056006365 9:82275796-82275818 AAGGAGGAGGAAAACAAGGAAGG - Intergenic
1057493908 9:95544703-95544725 ATGGGGGAGGAGTCCCAGAAAGG - Intergenic
1058137289 9:101320892-101320914 GTGGTGTAGGAGAACCAGCAGGG - Intronic
1058649129 9:107158672-107158694 TTGGGGGAGGAGACCCAACATGG - Intergenic
1059343921 9:113615646-113615668 ATGGGGGACCAGAATCAGAAAGG + Intergenic
1060259990 9:122066027-122066049 ATGGGGGTGGAGTAGAAGGAGGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060689060 9:125639978-125640000 AAGGGTGAGGAGAACCTGGCTGG - Intronic
1060717586 9:125947210-125947232 ACAGGGGAGGAGATACAGGAAGG + Intronic
1060799609 9:126535240-126535262 AAAGGGGAGGAGGACCAGGAGGG - Intergenic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1061021840 9:128020773-128020795 AGGGGGAAGGAGAAACAGAAAGG - Intergenic
1061246045 9:129401735-129401757 AGGGGGGAGGAGAAGGAAGAGGG - Intergenic
1061994526 9:134176976-134176998 ATGGGGGAGGAGAGACATGGGGG - Intergenic
1061994541 9:134177022-134177044 ATGGGGGAGGAGAGACATGGGGG - Intergenic
1062151647 9:135022416-135022438 AAGTGGGAGGAGACCCAGGAAGG - Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062695380 9:137873307-137873329 AGCGGGGAGGAGAACTAGGAGGG - Intergenic
1185492270 X:526714-526736 CTGGGGAAAGAGACCCAGGAAGG - Intergenic
1185603702 X:1355266-1355288 ATGGAGGAAGAGGAGCAGGAGGG + Intronic
1185634740 X:1543447-1543469 CTGGGGGAGTATGACCAGGAGGG + Intergenic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1185921758 X:4100849-4100871 AAGGAGGAGGAGAAACAAGAGGG + Intergenic
1186573323 X:10738678-10738700 AAGGGGGAGGAGAAACAGAGTGG + Intronic
1186719157 X:12284323-12284345 TTGGGGGAGGAGGCACAGGAAGG - Intronic
1186772415 X:12830967-12830989 TTGGGGGTGGAGAAACGGGAGGG + Intergenic
1187307890 X:18113715-18113737 ATGGTGGAGGAGAAACAGGCAGG - Intergenic
1187371938 X:18716592-18716614 ATGGGGATGGAGAGCCGGGAGGG - Intronic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190137134 X:47807537-47807559 CTGGGCGGGGTGAACCAGGAAGG - Intergenic
1190753551 X:53381888-53381910 AAAGGGGAGGAGAATGAGGAAGG + Intronic
1191942899 X:66499455-66499477 ATGGGTTGGGGGAACCAGGAGGG - Intergenic
1192223690 X:69214446-69214468 GTGAGGGAGGAGAATCAGGTGGG - Intergenic
1193492308 X:82165199-82165221 ATGAGGGAGGAGCCCCAAGATGG + Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1195067508 X:101250823-101250845 GAGGGGCAGGAGAACCAGCAGGG - Intronic
1195394032 X:104391852-104391874 AGTGGGGAAGAGAAGCAGGAGGG + Intergenic
1195485873 X:105405585-105405607 AGGTGGGAGGAGGACCAGGTGGG + Intronic
1196006130 X:110839218-110839240 ATGGGGGTGGGGGACAAGGAAGG - Intergenic
1198209924 X:134507247-134507269 CTGGAGGAGGAGAACCAAGCAGG + Intronic
1198298548 X:135310677-135310699 GTGGGGGAGGGGACACAGGAAGG - Intronic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199347140 X:146754802-146754824 ATGGGAGAGGAGAATCTGGGAGG + Intergenic
1200384817 X:155880121-155880143 AGGTGGGAGGAGAACCAGCAGGG + Intergenic
1201579315 Y:15494348-15494370 AAGGGAAAGGAGAACCAGGCTGG + Intergenic
1202577124 Y:26339730-26339752 ATGGGGGAGAGGAGCCAAGATGG + Intergenic