ID: 962370312

View in Genome Browser
Species Human (GRCh38)
Location 3:134815987-134816009
Sequence GCCCCAGCATTTACCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962370312_962370317 19 Left 962370312 3:134815987-134816009 CCACCAAAGGTAAATGCTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 962370317 3:134816029-134816051 ACGTTGTCCTTCTGCCTCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962370312 Original CRISPR GCCCCAGCATTTACCTTTGG TGG (reversed) Intronic
904034273 1:27550706-27550728 GCCCCGGCACTTGCCTTTGCGGG + Exonic
905318432 1:37098305-37098327 GCCCCTGCATGTGTCTTTGGAGG - Intergenic
906537589 1:46560220-46560242 GTCAGAGCATTTACCTCTGGAGG + Exonic
907971946 1:59391569-59391591 GCCCCATCTTTGTCCTTTGGAGG + Intronic
915985670 1:160461897-160461919 GCCCCAGCATGTACCCTTCCCGG - Intergenic
917514495 1:175696288-175696310 GCCCGCCCATTTACCTGTGGGGG - Intronic
919851849 1:201678173-201678195 GCTCCCTCATTTACCTTTTGGGG - Intronic
921669416 1:217909645-217909667 GCTCCAAAATTTCCCTTTGGAGG + Intergenic
922486193 1:225975003-225975025 GCCCCTGCATTTCTCCTTGGTGG - Intergenic
923128661 1:231055968-231055990 GCCACAGCAGTTCCTTTTGGTGG + Intergenic
923158480 1:231298408-231298430 GCCCCTGGATTTACCTTTCTAGG + Intergenic
1065587377 10:27232855-27232877 CCCCTAGAATTGACCTTTGGTGG - Intronic
1069293651 10:66815398-66815420 GCCCCATCCTTCCCCTTTGGTGG - Intronic
1071433596 10:85626019-85626041 GCACCAGCATTCTCATTTGGGGG - Intronic
1074107601 10:110400168-110400190 GCCCCAACATTGACATCTGGAGG - Intergenic
1074709006 10:116161546-116161568 GCCCCACCCTTGACATTTGGGGG - Intronic
1078325028 11:10373352-10373374 GCCCCAGCTTTGCCCTTTGGAGG - Intronic
1083054424 11:59806374-59806396 GCCCCAGTATTTCCCCTTGTGGG + Exonic
1084321829 11:68377552-68377574 GCCCCACCACTTACCCCTGGGGG + Intronic
1085763454 11:79261812-79261834 GCCCCAGTATTTGTCTCTGGGGG - Intronic
1087128846 11:94651822-94651844 GCCCCAGAACTTTCCTTCGGGGG - Intergenic
1088374360 11:109123908-109123930 GCCCCGGCCTGTACCTCTGGAGG + Intergenic
1090872594 11:130761655-130761677 GTCCCATCTTATACCTTTGGAGG - Intergenic
1092853794 12:12654285-12654307 GTCCCAGCTATTACATTTGGAGG + Intergenic
1096646167 12:53037534-53037556 ACCCAAGCATTCTCCTTTGGTGG - Exonic
1097420576 12:59373504-59373526 TTCCTAGTATTTACCTTTGGAGG - Intergenic
1098230478 12:68367912-68367934 GCCCCTACATTTACCTCTGCTGG - Intergenic
1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG + Intronic
1099712171 12:86241973-86241995 ACCACTGTATTTACCTTTGGTGG + Intronic
1101360104 12:104018390-104018412 GCCTCAGGATGTAGCTTTGGAGG - Intronic
1101592413 12:106136599-106136621 GCCCCAGCATTTAGACTTTGGGG + Intronic
1103212824 12:119179104-119179126 GCCCCGGGGGTTACCTTTGGGGG + Exonic
1103910428 12:124349220-124349242 AGCCCAGCCTTTACCTTCGGGGG - Intronic
1105937416 13:25115128-25115150 CACCCAGTATTTACCTTTGGCGG - Intergenic
1108981065 13:56515140-56515162 GCCCCAGCCTTTAGTTTTAGAGG - Intergenic
1111516569 13:89340290-89340312 GCTCCAGCATTTGTCATTGGAGG - Intergenic
1115114483 14:29862960-29862982 CCCCAAGCATTTTCTTTTGGCGG + Intronic
1115445120 14:33480911-33480933 GCAACAGCATTTTTCTTTGGGGG + Intronic
1117059127 14:51943134-51943156 GCCCTGGAATTTACCTTTGTAGG - Intronic
1117998891 14:61504637-61504659 TCTCCAGCATTTTCCTTTGATGG + Intronic
1118512052 14:66486036-66486058 GACACAGCATATACCTTTTGGGG - Intergenic
1126924228 15:53564867-53564889 GCCCCAGCATTTTCATTTTTGGG - Intronic
1131360185 15:91783786-91783808 GCCCCAACATTCACCATTGAGGG + Intergenic
1131924926 15:97372421-97372443 GCCCCAGCATTTACCCTAACAGG - Intergenic
1136596077 16:31250884-31250906 GCCCCAGCATCAGCATTTGGGGG - Intergenic
1137337560 16:47565462-47565484 ACCCAAGCATTCTCCTTTGGTGG + Intronic
1137551678 16:49441678-49441700 GCCGCGTCATTTACCTTCGGGGG + Intergenic
1138512073 16:57514738-57514760 GCCACAGCATTGACCTGTGCCGG - Intronic
1140883454 16:79220292-79220314 TGCCCAGCATTTAAGTTTGGGGG + Intergenic
1142725158 17:1808115-1808137 GCCCCAGCAATTACCCTTCTAGG + Intronic
1147316627 17:39623967-39623989 GGCCCTGCATTCACCTTTGGAGG - Intergenic
1150312611 17:64141258-64141280 GCTTCAGCATTTCCTTTTGGAGG + Intergenic
1152626586 17:81390498-81390520 GCCACAGCTTCTGCCTTTGGAGG - Intergenic
1154210031 18:12371578-12371600 ACCTAAGCATTTACCTTTTGGGG + Exonic
1160135384 18:76266873-76266895 GCCCCTGCATGTGTCTTTGGAGG + Intergenic
1161613019 19:5254125-5254147 GCACCAGCACCTAGCTTTGGTGG + Intronic
1163746545 19:19052187-19052209 CCCCCAGCTCTTACCTTTGGTGG - Exonic
1165350563 19:35272887-35272909 GCCCCACGACTTACCTGTGGTGG + Intronic
1166752113 19:45169220-45169242 GCCCCAGCACTTACCAGTGTGGG + Intronic
927652169 2:24919669-24919691 GCCCCTGCGTTTACCTGTGCGGG + Exonic
927748557 2:25644986-25645008 TCCCCAGCATTTCCCTTTGTGGG - Intronic
939996266 2:148923068-148923090 GCCACAGCATTCACATTTGAAGG - Intronic
945760836 2:213912712-213912734 GCCCCAGAATGTACCTGTGTAGG + Intronic
946299852 2:218816092-218816114 GCCCCAGCAGTAAATTTTGGTGG + Intergenic
948777315 2:240296554-240296576 CCCCCAGCACTTATCTCTGGCGG - Intergenic
1171006987 20:21476116-21476138 GGCCCTGCTATTACCTTTGGAGG + Intergenic
1173374703 20:42472975-42472997 GCCCCAGCCTGTCCCCTTGGAGG + Intronic
1173410189 20:42803256-42803278 GCCCAAGGATTTACTTTTTGAGG - Intronic
1173945482 20:46946784-46946806 GCCCCATCATCTACGTTGGGTGG - Intronic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175804047 20:61817427-61817449 GCCCCAGCAGATCCATTTGGGGG - Intronic
1176032602 20:63020868-63020890 GCCGTAGCAGTTCCCTTTGGAGG + Intergenic
1184665556 22:45987149-45987171 GCTCCTGGATTTGCCTTTGGGGG - Intergenic
949090883 3:27688-27710 GCCCCACAAGTTACCTTTAGAGG - Intergenic
952045155 3:29310073-29310095 GACCCAGGATTTACCTTTAATGG - Intronic
952127457 3:30318393-30318415 GCCTCAGCATTGGCCTTTGAAGG - Intergenic
952235806 3:31478917-31478939 TCCCCAACATTTTCTTTTGGAGG - Intergenic
953577406 3:44123928-44123950 GCCACAGCATTTGCCTTTGAGGG + Intergenic
955364225 3:58298034-58298056 GCCCCAGCCTTCTGCTTTGGAGG + Intergenic
960792050 3:121443216-121443238 GAACCATCATTCACCTTTGGTGG - Intronic
961852162 3:129831646-129831668 GCCACAGCATTTGACTTTGGTGG - Intronic
962370312 3:134815987-134816009 GCCCCAGCATTTACCTTTGGTGG - Intronic
966243281 3:177778089-177778111 GTACCAGCTTATACCTTTGGTGG + Intergenic
968398949 4:271165-271187 GCCACATCCTTTACATTTGGGGG + Exonic
970639291 4:18046109-18046131 GCCTCAACATTTAAATTTGGGGG - Intergenic
970928111 4:21476772-21476794 GCTTCAGCATCTTCCTTTGGGGG + Intronic
976514887 4:85953903-85953925 GCCCCAGCTTTTTGCCTTGGAGG - Intronic
983926227 4:173405687-173405709 GTCCCAGCTTTTGCCTTTAGGGG + Intronic
987165308 5:15192268-15192290 GCCCCAGCAGGTACATTTGCAGG - Intergenic
991203130 5:64017557-64017579 GCACAAGCATTTATCTTTGAGGG - Intergenic
1005188765 6:23193706-23193728 GTCCCAGCTTTTTCCTTGGGAGG + Intergenic
1011685578 6:89820887-89820909 GCCCCAGCAATTCCCCTTGTAGG + Intergenic
1011882494 6:92047331-92047353 GCCCTAGCTTTTAACTTTAGTGG - Intergenic
1015712210 6:136154518-136154540 GCACCAGCATTGAACTTTGTTGG + Intronic
1017233941 6:152100130-152100152 GACCCCGCATTGCCCTTTGGGGG + Exonic
1019842406 7:3461179-3461201 GACCCAGCATTTACCTTAGGCGG + Intronic
1022625805 7:32034704-32034726 GCCTCTGTATTTAACTTTGGAGG - Intronic
1023005419 7:35860416-35860438 GCCCTTGCATTTACCTTTACGGG + Intronic
1024020465 7:45363615-45363637 GCCGCAGCATTTGCCGTTGCTGG + Intergenic
1025977162 7:66378370-66378392 CGCCCAGCTTTTCCCTTTGGTGG - Intronic
1025991876 7:66503290-66503312 GCCCCAGCACTCACCATGGGGGG + Intergenic
1029958938 7:104669172-104669194 ACCCAAGCATTCTCCTTTGGTGG - Intronic
1030879989 7:114866175-114866197 GTCCCAGCTTTTACATTTTGGGG - Intergenic
1031815515 7:126429662-126429684 GCCCCAGCAGTTCACTTTGAGGG - Intergenic
1033566225 7:142580814-142580836 GACTTAGCATTCACCTTTGGAGG + Intergenic
1035252037 7:157603956-157603978 GCCCCAGGCTTTCCCTTGGGTGG - Intronic
1035679174 8:1475483-1475505 ACCCCAGCGTTTTGCTTTGGAGG + Intergenic
1035695060 8:1589869-1589891 GCAACACCATTTACATTTGGGGG + Intronic
1036974405 8:13394833-13394855 GTCCCAGTATTTCCCTTTGCTGG + Intronic
1043116016 8:76254925-76254947 GCAGCAGCAGCTACCTTTGGTGG - Intergenic
1049806190 8:144541285-144541307 GGCCCAGGATTTACCGTTTGTGG + Intronic
1051247159 9:15123572-15123594 GTCCCAACATTTACCATTGAAGG - Intergenic
1052295620 9:26893614-26893636 GCCCCAGGATTTACCTTACAAGG - Intergenic
1057563510 9:96147452-96147474 ACCCAAGCATTCTCCTTTGGTGG - Intergenic
1059946455 9:119413432-119413454 GCCTCAGCATCTTCCTTTTGTGG + Intergenic
1061022766 9:128026936-128026958 GCCCCAGGCTTTTCCTGTGGAGG + Intergenic
1189501080 X:41559832-41559854 TCCCCCGCATTTCCCTCTGGAGG + Exonic
1189833656 X:44999811-44999833 GCCTCTGCATCAACCTTTGGAGG + Intronic
1196079903 X:111620057-111620079 ACCCAAGCATTCTCCTTTGGTGG + Intergenic
1199937400 X:152588360-152588382 GCCCTACCATTTTACTTTGGAGG + Intergenic