ID: 962371103

View in Genome Browser
Species Human (GRCh38)
Location 3:134821505-134821527
Sequence GGGTAAAGATAAAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962371096_962371103 26 Left 962371096 3:134821456-134821478 CCAGGCAATTAATTGTTTAAAGG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 21
4: 329
962371099_962371103 -3 Left 962371099 3:134821485-134821507 CCAGTAAAGTGAAAAAGTTAGGG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 21
4: 329
962371095_962371103 27 Left 962371095 3:134821455-134821477 CCCAGGCAATTAATTGTTTAAAG 0: 1
1: 0
2: 4
3: 22
4: 330
Right 962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 21
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962371103 Original CRISPR GGGTAAAGATAAAAGGTGGA TGG Intronic
901352111 1:8606610-8606632 GGGAAAAGCCAAAAGGTGGGAGG + Intronic
901618359 1:10560355-10560377 TGTTAAATATAAAAGATGGAAGG - Intronic
903001785 1:20271393-20271415 ATGTGAAGATAAAAGGAGGAGGG + Intergenic
903034670 1:20486080-20486102 GGGGAAAGATGAGAGGAGGAGGG + Exonic
903547274 1:24133556-24133578 GAGTAATAATAAGAGGTGGAAGG - Intronic
904881647 1:33702162-33702184 GGGAAAAGAAAAGAGATGGAGGG + Intronic
904999062 1:34653868-34653890 GTCTAAAGAGGAAAGGTGGACGG + Intergenic
905052412 1:35063082-35063104 GGGCAAAGATCAAATGTGGGAGG + Intronic
907123105 1:52024961-52024983 GGCTAAAAAAGAAAGGTGGAAGG - Intronic
907594770 1:55709400-55709422 TGGGAAAGATAAAAGGAGGATGG - Intergenic
908420678 1:63955757-63955779 GGGGAAAGCTAGAGGGTGGAAGG - Intronic
909496622 1:76286135-76286157 GGCTAAAAATAAAGAGTGGATGG - Intronic
910510221 1:87995160-87995182 GAGTCAAGAATAAAGGTGGAAGG + Intergenic
910758392 1:90713594-90713616 TGGTAAAGATGACAAGTGGATGG + Intronic
911684249 1:100756725-100756747 AGGTAGAGATAAAAAGTGAAAGG + Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912733844 1:112132942-112132964 GGGAAAAGATAGAAGGCAGAAGG - Intergenic
913049369 1:115103423-115103445 AGGTACATATAAAAGGTGGATGG - Intergenic
913172999 1:116249214-116249236 GGATAAAGATAAGAAGTGAAGGG - Intergenic
914227565 1:145733801-145733823 GAGTAAAGAGAAAAGGTTGAAGG - Intronic
916419780 1:164626157-164626179 CCTTAAAGATAAAAGGGGGAAGG - Intronic
916626808 1:166567111-166567133 GGGAAAAGAGAGAAGGTGGAAGG + Intergenic
918496363 1:185141708-185141730 GAGTAAAGAAAAACGGTGTATGG + Intronic
918688657 1:187451617-187451639 ACTCAAAGATAAAAGGTGGAAGG + Intergenic
919503919 1:198373908-198373930 GGCCAAAGAAAAAAGGTGAAAGG - Intergenic
920977117 1:210796791-210796813 GGGTAAGGAGACCAGGTGGAAGG - Intronic
921592594 1:217021936-217021958 GGGAAAAGAGAAAAGATGGGAGG - Intronic
922177698 1:223209451-223209473 GGGTAAAAAGAAAAAGAGGAGGG + Intergenic
922336349 1:224621587-224621609 GGGAGGAGATAAAAGGGGGATGG - Intronic
922758779 1:228111217-228111239 GGGTTAAGATAAAAGATTGTGGG + Intergenic
1062797432 10:355026-355048 GGAGAAAGATGAAAAGTGGAAGG + Intronic
1063905068 10:10773189-10773211 GGGTCAATATAAAAGGTGGGGGG - Intergenic
1065484373 10:26222693-26222715 GGGTAAAGATATAAGCTGGGAGG - Intronic
1066222986 10:33354416-33354438 GGGTAAGGAGAGAAAGTGGAGGG - Intergenic
1066342543 10:34550221-34550243 TCTCAAAGATAAAAGGTGGAGGG - Intronic
1066701010 10:38128229-38128251 GGGTTAATATAATAGGAGGAAGG + Intergenic
1069154093 10:65003075-65003097 GGATAAAAGAAAAAGGTGGAAGG - Intergenic
1069733544 10:70635350-70635372 GGATAAACATAAAAGGTCAATGG - Intergenic
1071039829 10:81293763-81293785 GAAGAAAGATAAAATGTGGATGG + Intergenic
1071188589 10:83074718-83074740 GGGGAAAGCTGATAGGTGGAGGG + Intergenic
1071490456 10:86132902-86132924 AGGTTAAGGAAAAAGGTGGAAGG - Intronic
1071970916 10:90905835-90905857 GGTTAATTATAAAGGGTGGATGG + Intronic
1072351623 10:94562875-94562897 AGGTAAAAATAAAAGGGAGAGGG + Exonic
1072598034 10:96894008-96894030 GAGGAAAGATAACAGCTGGAAGG + Intronic
1073198041 10:101711046-101711068 GGGAAAAAATAATAGATGGAAGG + Intergenic
1075135245 10:119779011-119779033 GGGTACAGAGAAGAGGGGGATGG - Intronic
1076348007 10:129793877-129793899 GGGTAAAAAAGAAAGGAGGAGGG - Intergenic
1076939112 10:133590001-133590023 GAGAAAAGATAAACGGTTGAGGG - Intergenic
1077564525 11:3288917-3288939 GGGTAGAGATGAAAGGGCGAGGG - Intergenic
1077570414 11:3334734-3334756 GGGTAGAGATGAAAGGGCGAGGG - Intergenic
1077921674 11:6646547-6646569 GGGGAAAGAGACAAGATGGAGGG - Intronic
1077935646 11:6783008-6783030 GAGCAAAGATAAAAGCTGCAGGG - Intergenic
1078009683 11:7563163-7563185 GAGTCAGGCTAAAAGGTGGATGG - Intronic
1078487702 11:11739500-11739522 AGGTAATGATACAAGGTGGGAGG + Intergenic
1078731165 11:13975274-13975296 CAGTAAAGATAAAAGGATGAGGG + Intronic
1078958101 11:16226720-16226742 GGGTGAAGAAATATGGTGGAAGG - Intronic
1079056352 11:17209260-17209282 GGGGAAAGATAGGAGTTGGAAGG - Intronic
1079173273 11:18116234-18116256 GTGTATAGATAAAAGATAGAAGG + Intronic
1079314710 11:19397889-19397911 GGGAAAAGAGAAAAGGAGAAAGG + Intronic
1080001727 11:27358249-27358271 GGGTAAAGAGAAGAGGGGCAGGG + Intronic
1081674404 11:44960208-44960230 GTGGGAAGAGAAAAGGTGGAGGG + Intergenic
1082882920 11:58055849-58055871 GGCTGAAGATAGAAGGTAGAAGG - Exonic
1082898060 11:58214054-58214076 GGGTAAAGAGAAAAGATGGTGGG - Intergenic
1084588676 11:70078165-70078187 GGATAAAAATAAAACTTGGAGGG + Intergenic
1085306651 11:75490216-75490238 AGGTAAAGAGAAAAGGAGGGAGG - Exonic
1087552766 11:99672875-99672897 TGGAAAAGAAAAAAAGTGGAAGG + Intronic
1087949766 11:104206612-104206634 GGGTAAAGAAAAATGGTTCAAGG + Intergenic
1088363595 11:109016531-109016553 GGGTAAAGATAGGAGATAGAGGG + Intergenic
1088560651 11:111112455-111112477 GGGTAAAAAGAGAAGGTGGGTGG + Intergenic
1089038857 11:115426486-115426508 GGGTAAAAATAAAAGGGGAAAGG - Intronic
1090136627 11:124205989-124206011 AGGTAAGGATGAAAGGTGGCCGG - Intergenic
1091536690 12:1416928-1416950 GGGGAACGATAAAAGCAGGAAGG - Intronic
1092269362 12:7010809-7010831 GGGTATAGATAAAAAGTGGTTGG + Intronic
1093791389 12:23254526-23254548 GAAGAAAGATGAAAGGTGGAGGG + Intergenic
1094531593 12:31280271-31280293 GGGAAACTATAAAAGTTGGAAGG - Intergenic
1095252449 12:39995384-39995406 GGGAAATGAGAAGAGGTGGAAGG - Intronic
1095812205 12:46383338-46383360 GGGAAGAGAGAAAAGGAGGAGGG + Intergenic
1096229710 12:49890096-49890118 AGGTAAAGGGAACAGGTGGAAGG - Exonic
1096463889 12:51837629-51837651 GGGTCCAGAGAAAACGTGGAGGG - Intergenic
1097173092 12:57128396-57128418 GGGGAAAGAAAAAAGGTTGGTGG - Intronic
1097727620 12:63093057-63093079 GGGTACTGTTAGAAGGTGGAAGG - Intergenic
1097727969 12:63095928-63095950 TTATAAAGAGAAAAGGTGGAAGG - Intergenic
1097745424 12:63296864-63296886 GGAAAAAGAAAAAAGGTAGAGGG - Intergenic
1098129225 12:67331341-67331363 GGGCAAAGGTAAAATGTGGCGGG - Intergenic
1098554358 12:71802013-71802035 TGGAAAAGAACAAAGGTGGAGGG - Intergenic
1100431487 12:94535233-94535255 GGGTATGGATAGAAGGGGGAAGG + Intergenic
1102036721 12:109774811-109774833 GGTTAAAGCTAAAAGGGGGCTGG - Intergenic
1102703044 12:114856533-114856555 GGGTAGAGGGAAAAGATGGAAGG + Intergenic
1103318226 12:120074237-120074259 GGGAAGAGACAAAAGGTGGAAGG - Intronic
1104517241 12:129439321-129439343 GGGTAAAGAGAAAAAGAGGAGGG - Intronic
1106147608 13:27063925-27063947 GGAGAAAGAAAAAAGGAGGAAGG + Intergenic
1110592939 13:77285832-77285854 GGGAAAAGAAAAAAGGAGAAAGG + Intronic
1110982723 13:81921708-81921730 AGGTAAAGACAAAAGCAGGAAGG - Intergenic
1112728254 13:102329764-102329786 GGGTTAAGATTAAAGGAGTAAGG - Intronic
1114746152 14:25149634-25149656 ATGTAAAGAAAAAAGGGGGAGGG + Intergenic
1115147234 14:30239621-30239643 GAGTAAAAATATAAGGAGGAGGG - Intergenic
1117861104 14:60093349-60093371 GGGTAAGGATAATGGGGGGAGGG - Intronic
1118608069 14:67517577-67517599 GGGTTAAGATCTAAGGTGCAAGG + Intronic
1121094661 14:91208042-91208064 ATGTAAAGATTAAAGGTGGCCGG - Intronic
1121760435 14:96440405-96440427 GGGTGAAGAAAAAAGGTCTAGGG - Intronic
1123451150 15:20359814-20359836 GGGAAAAGATGAAAGTAGGATGG + Intergenic
1125618160 15:41034715-41034737 GGGGAAATGTAAAAGTTGGAAGG - Intronic
1127124570 15:55799673-55799695 GGGTAAAGAGAAACGGCGGTTGG - Intergenic
1127263258 15:57341218-57341240 GGGTCTAGATTGAAGGTGGAGGG + Intergenic
1128210464 15:65896761-65896783 GTTTTAAGATAGAAGGTGGAAGG + Exonic
1128581951 15:68817281-68817303 AGGCAAAAATAAAAGGGGGAAGG + Intronic
1128924056 15:71637681-71637703 GGGTACAGAGTAGAGGTGGATGG + Intronic
1129044859 15:72725719-72725741 GGGGGAAGAGAAAAGGGGGAAGG - Intronic
1129291120 15:74568599-74568621 GGGGAAAGAGAAAAGGTAGCAGG - Intronic
1129698466 15:77754129-77754151 GGGAAAAGGGAAAAGGAGGAAGG + Intronic
1129733642 15:77946731-77946753 AAATAAAGTTAAAAGGTGGATGG + Intergenic
1129841952 15:78749270-78749292 AAATAAAGTTAAAAGGTGGATGG - Intergenic
1130029493 15:80298763-80298785 GGGTAAAGAAACTCGGTGGATGG + Intergenic
1130031626 15:80319535-80319557 GTATAAAGAAAAAAGGGGGATGG + Intergenic
1130543024 15:84835442-84835464 GGGTGAACACACAAGGTGGATGG - Intronic
1131009410 15:89004651-89004673 GGGCAAAGGGAAAAGGTAGAAGG - Intergenic
1131079985 15:89526797-89526819 GAGTAAAGTTAGAAGGTGAAAGG - Intergenic
1131309798 15:91279567-91279589 GGGAAGAGATAAAAGGAGAAAGG - Intronic
1131731239 15:95283604-95283626 GGGTAGAGATCCAAGATGGAGGG + Intergenic
1133521917 16:6566695-6566717 CAGTAAAGATGAAAAGTGGATGG - Intronic
1134465957 16:14477788-14477810 GGGAAAAGGGAAAAGGGGGAAGG + Intronic
1135010538 16:18873807-18873829 GTGTAAAGGAAAAAGATGGATGG - Intronic
1135051014 16:19193027-19193049 GGTGAAAGGTGAAAGGTGGAAGG + Intronic
1135317412 16:21461392-21461414 GTGTAAAGGAAAAAGATGGATGG - Intergenic
1135370310 16:21893204-21893226 GTGTAAAGGAAAAAGATGGATGG - Intergenic
1135441479 16:22477497-22477519 GTGTAAAGGAAAAAGATGGATGG + Intergenic
1135623038 16:23972483-23972505 GGAAATAGATAAAATGTGGATGG - Intronic
1136123017 16:28153080-28153102 GGGAAATGATAAAAAGTTGATGG + Intronic
1136442328 16:30282897-30282919 GTGTAAAGGAAAAAGATGGATGG - Intergenic
1136670190 16:31849664-31849686 AGGTAAAAATAAATGGTGTAAGG + Intergenic
1137927384 16:52553560-52553582 GGGTTGGGATAAGAGGTGGAAGG - Intergenic
1138006346 16:53341421-53341443 GGGTAAAAACAAAAGAAGGAAGG + Intergenic
1138091217 16:54176216-54176238 GGGGAAAGAAAAAAGATAGAAGG + Intergenic
1138929058 16:61630340-61630362 AGTGAAAGATATAAGGTGGAGGG + Intergenic
1139889133 16:70236617-70236639 GTGTAAAGGAAAAAGATGGATGG - Intergenic
1141773030 16:86102358-86102380 GGGGAGAGAGAAAAGGAGGATGG - Intergenic
1141774570 16:86114237-86114259 GGGAAAAGAGGAAGGGTGGAGGG + Intergenic
1142523731 17:523062-523084 GGGGTTAGACAAAAGGTGGAAGG + Intronic
1143120351 17:4602807-4602829 GGGTGAAGAGCAAAGGTGGCAGG + Intronic
1143121938 17:4613567-4613589 AGGTAAAAAGAAAAGGAGGAAGG - Intergenic
1143652710 17:8273752-8273774 GGATAAAGAAGAAAGATGGAAGG - Intergenic
1144259326 17:13502653-13502675 GGTTAAAAATAAAATGGGGAAGG - Intronic
1144440564 17:15277432-15277454 GGATAAAGATGAGATGTGGAGGG + Intergenic
1147580813 17:41626139-41626161 GCGGAAAGATTAAGGGTGGAGGG - Intergenic
1148661949 17:49341350-49341372 AGGAAAAGAAAAAAGATGGATGG + Intronic
1148781308 17:50123624-50123646 GGGAAGAGATAGAAGCTGGAGGG - Intronic
1149244093 17:54684931-54684953 GGGTAAAGAAAAAAACTGGTTGG - Intergenic
1153753686 18:8259489-8259511 GGGGAAGGATAAGAGGTGGGGGG - Intronic
1155122747 18:22839835-22839857 GGGTAATGATAAATGTTGGGTGG - Intronic
1155667197 18:28325636-28325658 GTGTTAAGATAGCAGGTGGAGGG - Intergenic
1156602017 18:38619202-38619224 TGGTAAAAATAAAGGGTGAAGGG + Intergenic
1156718363 18:40039990-40040012 AGGGAAAGAGAAAAGGTGTAGGG + Intergenic
1158406219 18:57161917-57161939 GGGTATAGACAAGAGATGGAGGG + Intergenic
1158519979 18:58163866-58163888 GGGCAAAAATAAAACATGGAGGG - Intronic
1158907644 18:62029425-62029447 AGGTAAAGATAGAAAGGGGATGG + Intergenic
1159968189 18:74617538-74617560 GAGGAAAGAAAAAAGGTGGAGGG - Intronic
1160156259 18:76436157-76436179 GGGTAAAGGTAAAAAGCAGAAGG - Intronic
1160447513 18:78939111-78939133 GGGAGAAGATAAAATGTGGTGGG - Intergenic
1160521039 18:79508203-79508225 GGCTGGAGAAAAAAGGTGGAGGG + Intronic
1164587204 19:29483532-29483554 GGGGAAAGAGAAAGGCTGGAGGG + Intergenic
1166511531 19:43412510-43412532 GGGTGAAGAATAGAGGTGGAGGG + Intronic
1166869621 19:45863510-45863532 GGGTCAAGAACAAAGATGGAGGG - Intergenic
1166931433 19:46303841-46303863 CGGGAAAGAGAAAAGGAGGACGG - Intronic
925654224 2:6127747-6127769 GGGTAAAGAGAAAGAGTGGGAGG + Intergenic
926307743 2:11651367-11651389 AGGTAAAGATACAATGGGGAAGG - Intergenic
926485826 2:13456510-13456532 GGGAAAAGATGAAAGTAGGATGG - Intergenic
926662237 2:15480486-15480508 AGGTATAGATAAAAGGTATAGGG + Intronic
927855651 2:26526106-26526128 AGGAAAAGAAAAAAGGTGGAAGG + Intronic
928304305 2:30153863-30153885 GGGTAAAGAGAAAAAATAGATGG + Intronic
930399087 2:50860471-50860493 GTGAAAAGATGAAAGGTGAAAGG + Intronic
930626189 2:53700069-53700091 GGGAAAAGATAAGAGGTGACTGG - Intronic
931152095 2:59585689-59585711 GGGAAAAAAGAAAAGGGGGAGGG - Intergenic
932424866 2:71623723-71623745 GAGATAACATAAAAGGTGGAAGG - Intronic
933187517 2:79294546-79294568 GGGTTAAGATAGGAGGTTGATGG - Intronic
933725067 2:85422029-85422051 GGATAAAGAGCCAAGGTGGAAGG + Intronic
934040004 2:88120174-88120196 TGGTAAAGATATAAAGTGGTGGG - Intergenic
934156694 2:89207603-89207625 GGGCAGAGAAAAAAGGAGGAGGG + Intergenic
934210622 2:89975148-89975170 GGGCAGAGAAAAAAGGAGGAGGG - Intergenic
934871654 2:97872027-97872049 GGGAAAAGAAAAGAGGGGGAGGG + Intronic
935660721 2:105464767-105464789 GGACAAAGAGAAAAGGTGTAGGG - Intergenic
936659245 2:114523825-114523847 GAGTAGAGAGAAAAGGGGGATGG - Intronic
937356874 2:121203223-121203245 GGGTAAAGAGAGAAGGCAGAAGG + Intergenic
937848144 2:126604200-126604222 GGCTCAAGATAAAAGGATGAGGG + Intergenic
938664181 2:133517108-133517130 AGGTTAAGATAAATGGGGGATGG + Intronic
939191731 2:138924536-138924558 GAGAAGAGAGAAAAGGTGGAAGG - Intergenic
939718304 2:145614013-145614035 GGGGAAAGAGAAAAAGTGGGAGG + Intergenic
939726338 2:145725936-145725958 GGATAGAGATAAAAACTGGACGG - Intergenic
941720687 2:168809387-168809409 GGTTATAGATCAAAGGGGGAGGG + Intronic
941856878 2:170240231-170240253 TGGTAAACATAAAAGTTGGTTGG - Intronic
943783718 2:191852788-191852810 GGGCAATGAGAAAAGGTGGCGGG - Intergenic
945799868 2:214414824-214414846 GGGCAAAAATAAAAGGTGTTAGG - Intronic
946149624 2:217755489-217755511 GGGTAGGGGTAGAAGGTGGAGGG - Intronic
1170263660 20:14441185-14441207 GGGTAAAAGTGAAAGGTGCAAGG - Intronic
1170694413 20:18645719-18645741 GGGTAAGGATAAAAGGTCTGTGG + Intronic
1172777062 20:37413924-37413946 GGAAGAGGATAAAAGGTGGAAGG - Intergenic
1172921502 20:38486715-38486737 TAGTAAAAATAAAAGTTGGATGG - Intronic
1172974453 20:38895742-38895764 GGAAAAAGACAAGAGGTGGAGGG - Intronic
1173214266 20:41065594-41065616 TCATAAAGATAAAAGGTAGAAGG - Intronic
1174058760 20:47817537-47817559 GGATAAAGATAGAAGGAGGTGGG + Intergenic
1174650590 20:52121553-52121575 AGGAAAAGAGAAAAGTTGGAAGG + Intronic
1175045546 20:56101669-56101691 TGGTAAAGTCACAAGGTGGAGGG - Intergenic
1180333581 22:11555542-11555564 AGGAAAAGATAAAATGGGGACGG + Intergenic
949327390 3:2881825-2881847 GGTTAAAGACAAAAAATGGATGG - Intronic
950863805 3:16173346-16173368 GGGGAAGGAGAGAAGGTGGAAGG - Intergenic
951011554 3:17687608-17687630 CGGTAGAGCAAAAAGGTGGAAGG - Intronic
951392442 3:22123188-22123210 GAGAAAAGAGAAAAAGTGGAGGG + Intronic
952264253 3:31770146-31770168 AGATAAAGAGAAAAGGTGCAGGG + Intronic
953611374 3:44450233-44450255 TTGTAAAGATTAAAGGTGGCTGG - Intronic
954451831 3:50575891-50575913 GGGTAGGGGTAAAGGGTGGAAGG - Intronic
955019124 3:55101495-55101517 GGGTAAAGAGAAGAATTGGAAGG - Intergenic
956959983 3:74388007-74388029 GGGAAATGTTTAAAGGTGGATGG + Intronic
957236664 3:77601961-77601983 GGTTAAAGAAAATAGGGGGAAGG + Intronic
957513629 3:81222783-81222805 ATGTAATGATAAAAGGTTGAAGG - Intergenic
957719584 3:83977018-83977040 TGGTAAACATTAAAGGTGAAGGG - Intergenic
958624961 3:96612189-96612211 GGGGAAAGAAATAAGGTGGAGGG + Intergenic
959727830 3:109564079-109564101 GAGTAAAGCAAAAAAGTGGAGGG + Intergenic
959834823 3:110906054-110906076 GGGCTGAGATAAGAGGTGGACGG - Intergenic
961860679 3:129914797-129914819 GGGAAAAAAAAAAAGCTGGAGGG - Intergenic
962371103 3:134821505-134821527 GGGTAAAGATAAAAGGTGGATGG + Intronic
963368274 3:144366390-144366412 AGTTAAAGACAAAGGGTGGAGGG + Intergenic
963743770 3:149105739-149105761 GGGTAAAGATACAAAATGAAGGG + Intergenic
964206769 3:154183682-154183704 ATGTAAAAATAAAAGGTGGGTGG + Intronic
964327528 3:155563420-155563442 GGGGAGAGCTAGAAGGTGGATGG - Intronic
965744321 3:171907944-171907966 GGGTAAAGATCAAGGGTGAATGG - Intronic
965874817 3:173303490-173303512 GGGTAAAGACAAAGGAAGGAAGG + Intergenic
966109228 3:176377684-176377706 GGGTCAAGGTTAAAGGTGAAAGG - Intergenic
967336829 3:188353220-188353242 GGGCAAGAATAAAAAGTGGAAGG - Intronic
969454550 4:7293987-7294009 GGGTAAAAATAAAAGGAAAAGGG - Intronic
969846919 4:9926594-9926616 GGCTAAAGATGAAAGGGAGAGGG - Intronic
970914975 4:21321961-21321983 AGGGAAAGAGAAATGGTGGAAGG + Intronic
971690544 4:29828882-29828904 GTGAAAAGTTAAAAGGTGGGGGG + Intergenic
977692355 4:99928334-99928356 GTGGAGACATAAAAGGTGGAAGG - Intronic
979657819 4:123217309-123217331 TGTTAAATAGAAAAGGTGGAGGG + Intronic
979885801 4:126025853-126025875 GGATAAAGAGAAAAGGTGGGGGG - Intergenic
981324219 4:143427798-143427820 GGGTACAGACTAAAGGTGAATGG + Intronic
982077218 4:151749842-151749864 GAATAAAGATATAAGGGGGAGGG - Intronic
983794612 4:171845675-171845697 TGGTAAAGACACAAGATGGAAGG + Intronic
984803306 4:183733816-183733838 GAGGAAAGAAAAAAGGGGGAAGG - Intergenic
984830597 4:183969267-183969289 GGATAAAAGTAAAATGTGGAAGG + Intronic
985639244 5:1055894-1055916 GGTTAAAGATAAAAAGGGAAGGG + Intronic
986213738 5:5698732-5698754 GGGTATAGATTAAAGATGAATGG - Intergenic
987909087 5:24118179-24118201 GGGGAAAGAGGAAAGGTGGCTGG - Intronic
988095711 5:26606628-26606650 CGGTGAAGATAAAACTTGGAAGG + Intergenic
988181725 5:27803638-27803660 GGGTAAAGATTAATGGGGCAAGG - Intergenic
989353743 5:40517808-40517830 GGGACAATATAAAAGGAGGAGGG - Intergenic
989606946 5:43253571-43253593 TGGGAAAGAGATAAGGTGGATGG + Intronic
990908495 5:60829509-60829531 TGGTAAATATAAAAGATAGAGGG - Intronic
993388578 5:87290130-87290152 GGGTAAAGATGCAAGGCAGAAGG - Intronic
994738948 5:103594470-103594492 AGTTAAAGAAAAAAGGTGAAGGG - Intergenic
995342100 5:111071496-111071518 GGGCAAAGCAAAAAGGAGGAAGG + Intronic
996934176 5:128929061-128929083 AGGTAAGGATAAAAGGAGGCTGG - Intronic
997671115 5:135672867-135672889 GGGTAAAGATGGAGGGAGGAAGG - Intergenic
999018707 5:148138944-148138966 GAGTAAGAATCAAAGGTGGAGGG + Intergenic
1000223174 5:159233786-159233808 GGAGAAAGATGAAAGCTGGAAGG + Intergenic
1003020488 6:2505044-2505066 GGGTAAAGACAAGATGAGGAGGG - Intergenic
1003779547 6:9408299-9408321 GAGCAAAGAAAAAGGGTGGAAGG - Intergenic
1005397887 6:25402799-25402821 GGGAACAGAGAAAAGGTGAAAGG + Intronic
1007278018 6:40689911-40689933 GGGTAAGGATAAAAGAGCGAAGG - Intergenic
1007401859 6:41607318-41607340 GGGAAAAGATAAAATGTTAAAGG + Intergenic
1008371416 6:50735720-50735742 GGCTCAAGATTAAAGGTAGAAGG - Intronic
1009463738 6:63945476-63945498 AGGTAAAGATTAAAGGTTTAGGG + Intronic
1009885458 6:69618844-69618866 GGGTAAAAAGAAAAAGAGGAGGG - Intergenic
1010083731 6:71891573-71891595 GGGAAAAGAAGAAAAGTGGAAGG + Intronic
1011491034 6:87892696-87892718 TGTTGAAGATAAAATGTGGAGGG + Intergenic
1011857501 6:91713090-91713112 GGAAAAAGATGAAAGGTTGAGGG - Intergenic
1012434797 6:99204162-99204184 GGGTAAATAGAAAATGTGAACGG - Intergenic
1012455622 6:99401173-99401195 GGGTAAAGATTAGAGATAGAAGG - Exonic
1013142857 6:107356468-107356490 TGCTACAGAAAAAAGGTGGAAGG - Intronic
1013370370 6:109465285-109465307 GCATAAAGATAAAACGTTGAGGG + Exonic
1014975759 6:127880236-127880258 GTCTAAAGTTAAAAGGAGGATGG + Intronic
1015400696 6:132785056-132785078 AGGAAAAGAAAAAAGGGGGAGGG + Intronic
1016051155 6:139531920-139531942 AGGTAAAAATAAGAGGAGGATGG - Intergenic
1016830119 6:148425734-148425756 GGGAAAAAAAAAAAGGAGGAGGG - Intronic
1016834296 6:148461961-148461983 GGGGAAGGTTAAAAGGTTGAAGG - Intronic
1018273659 6:162107162-162107184 GCTTAAAAATAAAAGGTTGAAGG + Intronic
1018868318 6:167762093-167762115 GGGTGGAGATGAAAGGTAGAGGG - Intergenic
1019320809 7:414470-414492 GGGGGAAGAAAAAAGGAGGAGGG - Intergenic
1020692377 7:11371770-11371792 GGGAAAAGGAAAAATGTGGAAGG - Exonic
1021243475 7:18233701-18233723 GGGTCAAGAAAGAAGGAGGAAGG - Intronic
1021734166 7:23626918-23626940 AGGAAAAGATATAAGGTGGATGG - Intronic
1022303268 7:29121638-29121660 GGATATGGATAAAAGGTGAATGG + Intronic
1023584525 7:41715408-41715430 GGTAAAGGATAAAAGGAGGAGGG - Intergenic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024422282 7:49182655-49182677 GGGTAAAGATAATCAATGGATGG + Intergenic
1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG + Intronic
1024809103 7:53186474-53186496 AGGAAAAAATAAAAGATGGATGG + Intergenic
1027656923 7:80941917-80941939 GGGGAAAGAAAAGAGATGGAAGG - Intergenic
1027904814 7:84165936-84165958 GTGAAAATATAAAATGTGGAGGG + Intronic
1027960017 7:84933513-84933535 AGGAAAATATAGAAGGTGGAGGG + Intergenic
1029524001 7:101083979-101084001 GGGTCCAGGTGAAAGGTGGAGGG - Intergenic
1030378388 7:108781456-108781478 GGGGAAGGATTAAAGATGGAGGG - Intergenic
1031540050 7:122984357-122984379 GGGGAAGGTTAAAAGATGGATGG - Intergenic
1031634321 7:124083330-124083352 GGGGAAAGAGAAAATGAGGATGG - Intergenic
1031723226 7:125203991-125204013 AGGTAAAGAGAAACGGAGGAGGG - Intergenic
1032014755 7:128371626-128371648 GGATAAAGAAAATAGGAGGAGGG + Intergenic
1032185510 7:129721971-129721993 GCTTACAGATAAAAGGTTGATGG + Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032411150 7:131694033-131694055 GGGGGAAGAGACAAGGTGGATGG + Intergenic
1033790207 7:144783502-144783524 GGGTAAAAAGAAAAGATGTAGGG - Intronic
1033894129 7:146051514-146051536 GGGTAAAAAGAAAAAGAGGAAGG - Intergenic
1035580036 8:733869-733891 GGGTGGAGAGAAAAGCTGGACGG - Intronic
1036067643 8:5400759-5400781 GGTTAAAGAAAAAAAATGGAAGG + Intergenic
1036481781 8:9146494-9146516 ATGTAAAGAAAAAAGGTGAACGG + Intronic
1038742708 8:30229674-30229696 AGGGAAAGAGAAAAAGTGGAGGG + Intergenic
1041429083 8:57758932-57758954 CAGTAATGATACAAGGTGGAGGG - Intergenic
1041794909 8:61737114-61737136 GGGAAAACAGAAAAGGAGGAAGG - Intergenic
1041866364 8:62578903-62578925 AGGAAAAGATAAAATGAGGATGG + Intronic
1042641534 8:70940797-70940819 GGGTAAAGGTAGAAGTGGGAAGG - Intergenic
1044771683 8:95642320-95642342 GGGAAAACATAAAAACTGGATGG + Intergenic
1045344562 8:101282612-101282634 GGGTAAAGATACAAAGTCAAGGG - Intergenic
1045443465 8:102238352-102238374 GGGTGAAGATGACAGGTAGAAGG - Intronic
1045686195 8:104714770-104714792 GGGTAAAGATAAAAACTTCAAGG - Intronic
1046907976 8:119594667-119594689 AGCTAAAGATGAAAGGGGGATGG - Intronic
1048232170 8:132653187-132653209 TGGAAAAGATAATAGGTAGATGG + Intronic
1048834985 8:138510381-138510403 GGGTAAAGATGACAGGTGTGGGG - Intergenic
1048966907 8:139621756-139621778 GGGTAAATATAAAAGATGCAGGG + Intronic
1049999705 9:1064053-1064075 TGATAAAGATATAAGCTGGAAGG + Intergenic
1050760311 9:9061495-9061517 GGGCAAAGAGAAAAGGAGGAAGG - Intronic
1051129361 9:13842073-13842095 GGGGAAAGATAAAAGGGCCAAGG + Intergenic
1052270903 9:26626967-26626989 GGGTATATATAAAAGATGGCAGG - Intergenic
1052813422 9:33081521-33081543 GGTTAAGGAAAAGAGGTGGAGGG + Intergenic
1053031712 9:34785731-34785753 GGCTAAAGTATAAAGGTGGAAGG - Intergenic
1053194257 9:36103348-36103370 GGGGAAAGATAAAAGGAGCCTGG - Intronic
1055794790 9:79964291-79964313 GGGGAAAGAAAAAAGGGGAAAGG - Intergenic
1056016939 9:82399413-82399435 GGTTAAAGATAAAATGCAGATGG + Intergenic
1057246352 9:93458321-93458343 GGGAAAAGAGAAATGGCGGAAGG - Intronic
1057945563 9:99325051-99325073 GGTTAAAGGTTAATGGTGGATGG + Intergenic
1058039199 9:100285583-100285605 GAGCAAAGAGAAAAGGTGTATGG + Intronic
1058284799 9:103163806-103163828 GAATAAAGATACAAGGAGGAAGG - Intergenic
1060609966 9:124954867-124954889 GGTCAAAAATAAAAGGTGGCCGG + Intronic
1060771745 9:126336985-126337007 GGGTAAGGAATAAAGGTGGTAGG - Intronic
1060803138 9:126557202-126557224 AGGGAAAGATAAAAGGTGCGGGG + Intergenic
1062247937 9:135579168-135579190 GGTGGAAGATAAATGGTGGATGG - Intergenic
1186018035 X:5221251-5221273 GGGGATAGATGATAGGTGGATGG + Intergenic
1186705120 X:12132821-12132843 GGGTAAAAAGAAAACATGGATGG + Intergenic
1187047246 X:15659420-15659442 GGGAAAAGAGAAAGGGAGGAAGG - Intronic
1187350573 X:18511760-18511782 GGGAAAAGAGAAAAGGTGGTGGG + Intronic
1187596851 X:20782784-20782806 GGGTAGAGATAAAAGTTAGGGGG + Intergenic
1187930732 X:24291578-24291600 GAGTAAAGAGAAAAGGAAGAAGG - Intergenic
1188457555 X:30384164-30384186 GGAAAAAGATGAAAGGTGGGAGG - Intergenic
1189701009 X:43716298-43716320 GGGTAGATATAAAGGATGGATGG + Intronic
1192838499 X:74828113-74828135 GAGTAGAGAAAGAAGGTGGATGG + Intronic
1193966164 X:87989073-87989095 GGATAGAGCTAAAAGATGGAAGG - Intergenic
1195012093 X:100742682-100742704 TGGAGAAGATAAAAGGAGGATGG - Intergenic
1195582083 X:106516886-106516908 AGGTAAAGAAAAAAGGGAGAGGG - Intergenic
1195861164 X:109384866-109384888 GGGTAAAGAAAAAAATTGGCCGG - Intronic
1195901004 X:109797249-109797271 GGGTTAAGAAAAAATGTGGAAGG - Intergenic
1196504453 X:116424925-116424947 GGGTAAAGAGTAAAGGTAAAAGG + Intergenic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1202339016 Y:23840775-23840797 GGGTAACAACAAAAGGAGGAAGG + Intergenic
1202531750 Y:25829297-25829319 GGGTAACAACAAAAGGAGGAAGG - Intergenic