ID: 962373755

View in Genome Browser
Species Human (GRCh38)
Location 3:134842478-134842500
Sequence CAGTCAGAAGATCCTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962373747_962373755 20 Left 962373747 3:134842435-134842457 CCAGTACCTACTCCATCCTGGGC 0: 1
1: 0
2: 2
3: 14
4: 197
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373749_962373755 8 Left 962373749 3:134842447-134842469 CCATCCTGGGCCTGTGCCATTCC 0: 1
1: 1
2: 1
3: 41
4: 356
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373750_962373755 4 Left 962373750 3:134842451-134842473 CCTGGGCCTGTGCCATTCCAATG 0: 1
1: 0
2: 0
3: 15
4: 184
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373748_962373755 14 Left 962373748 3:134842441-134842463 CCTACTCCATCCTGGGCCTGTGC 0: 1
1: 0
2: 3
3: 53
4: 355
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373743_962373755 30 Left 962373743 3:134842425-134842447 CCCTGTTCATCCAGTACCTACTC 0: 1
1: 0
2: 2
3: 13
4: 144
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373744_962373755 29 Left 962373744 3:134842426-134842448 CCTGTTCATCCAGTACCTACTCC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373752_962373755 -8 Left 962373752 3:134842463-134842485 CCATTCCAATGCCTGCAGTCAGA 0: 1
1: 0
2: 1
3: 19
4: 227
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175
962373751_962373755 -2 Left 962373751 3:134842457-134842479 CCTGTGCCATTCCAATGCCTGCA 0: 1
1: 0
2: 0
3: 18
4: 177
Right 962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962373755 Original CRISPR CAGTCAGAAGATCCTTCCTG AGG Intronic
900621452 1:3589398-3589420 CAGCCACAAGATCCTGCCTCAGG + Intronic
901712526 1:11126993-11127015 GAGCCTGAAGATCCTACCTGAGG + Exonic
901822708 1:11840426-11840448 AAGTGGGAAGATCCTTGCTGGGG - Exonic
904128781 1:28260378-28260400 CGGGCAGAGGACCCTTCCTGGGG + Intronic
904381211 1:30112277-30112299 CAGACAGATGTTCCTGCCTGGGG + Intergenic
905649135 1:39644928-39644950 CAGTGAGCAAATTCTTCCTGAGG - Intergenic
907609500 1:55854142-55854164 CAGTCAGAAGGTCTATGCTGTGG + Intergenic
912077015 1:105887564-105887586 CAGTCAGAAGAGAAATCCTGTGG - Intergenic
912865784 1:113255074-113255096 CATTCAGAAGATCATGCCAGTGG - Intergenic
913173419 1:116252903-116252925 CCTTCAGAGGATTCTTCCTGGGG - Intergenic
919735499 1:200947747-200947769 CAGTGAGAAGAGCCTCCCTGTGG - Intergenic
920205951 1:204292400-204292422 CAGTCCGAAGCTCTTTCCTCAGG + Intronic
921222572 1:212983677-212983699 GAGTCAGAAAATACTTCCTGAGG + Intronic
921287519 1:213622454-213622476 TAGTCTGTAGATACTTCCTGTGG - Intergenic
922653456 1:227360502-227360524 CAGTGAGAACATCATCCCTGGGG - Intergenic
1062775939 10:147982-148004 CAGTCAGATCAACCGTCCTGGGG + Intronic
1064615291 10:17147630-17147652 ATGTCAGAATTTCCTTCCTGCGG + Exonic
1065116409 10:22487529-22487551 CAGGCAGATGTTCCTTCCAGTGG - Intergenic
1071888641 10:89978321-89978343 CAGACAGAACTTTCTTCCTGAGG - Intergenic
1074146835 10:110724416-110724438 AAGTCTGAAGATGTTTCCTGGGG + Intronic
1074776047 10:116769130-116769152 CAGTCAGAAGATCCTAGTGGTGG - Intergenic
1075917498 10:126181799-126181821 CAGTCAGAAGATCAGGCCTTTGG + Intronic
1076000520 10:126909143-126909165 CAGTCAGAAGATCCTATGTTTGG + Intronic
1076726922 10:132418354-132418376 CCGCCAGACGATCCTTGCTGAGG - Intergenic
1078359026 11:10654063-10654085 CAGTCAGCAGTACCTTCCAGAGG - Intronic
1080758520 11:35225514-35225536 GAGTCAGAAGATCCAAGCTGTGG + Intronic
1081011808 11:37822259-37822281 CAGTCATAAGATCCTTAAAGAGG - Intergenic
1081837148 11:46165172-46165194 CAGGCAGAAGATGATTCCAGTGG - Intergenic
1083080683 11:60089723-60089745 CTGCCTGAAGATACTTCCTGGGG - Exonic
1083782474 11:64925507-64925529 CAGGCCTCAGATCCTTCCTGGGG - Exonic
1085195739 11:74670609-74670631 CAGTCAGCACAACCTTGCTGAGG + Intergenic
1086740018 11:90355316-90355338 CTGGCACAAGATGCTTCCTGTGG + Intergenic
1086943980 11:92827102-92827124 CAGTGAGAGGATCATCCCTGGGG - Intronic
1087290381 11:96314492-96314514 CAATAACAACATCCTTCCTGTGG + Intronic
1087586563 11:100129121-100129143 CATTCAGTAGATATTTCCTGTGG - Intronic
1088757783 11:112900769-112900791 AAGTCAGAAGATCCCAGCTGCGG + Intergenic
1089004364 11:115078670-115078692 CAGTCACAAGTTCCTCCATGCGG - Intergenic
1090668808 11:128931838-128931860 CAGGCAGTAGAGCATTCCTGGGG + Intergenic
1090756110 11:129793235-129793257 TAGTTAGAAGAACCTGCCTGGGG - Intergenic
1091951958 12:4600536-4600558 CTGTCAGAGGAAGCTTCCTGAGG + Intronic
1092029136 12:5269239-5269261 CACTCAGAGGATCCATCCTCAGG - Intergenic
1092179397 12:6435051-6435073 CAGTCTGGTGATCCTCCCTGTGG - Intergenic
1096470972 12:51875452-51875474 CAGTAACAAGACCCTTGCTGAGG + Intergenic
1101347504 12:103900068-103900090 CAGGCAGTATATACTTCCTGAGG - Intergenic
1101624512 12:106425663-106425685 CACTCACAAGTTCCTTTCTGTGG - Intronic
1101728714 12:107409020-107409042 CACTCAGAAGTCCCTTTCTGGGG - Intronic
1104204528 12:126625406-126625428 CACTCAGAAGCTCCTTACTGCGG - Intergenic
1104732021 12:131112451-131112473 AGCTCAGAAGAGCCTTCCTGGGG - Intronic
1105742573 13:23343132-23343154 CACTCAGAAGATATTTCCTTGGG + Intronic
1106284929 13:28310188-28310210 CAGTCAGAAAATACTGCTTGCGG - Intronic
1107829171 13:44359207-44359229 CTGTCAGAAGAGCCTTCGGGAGG + Intergenic
1108510236 13:51148909-51148931 CAGGCAGCTGCTCCTTCCTGGGG + Intergenic
1108804901 13:54142409-54142431 CAGTCAGAATTTCCTTACTCTGG + Intergenic
1110126109 13:71943838-71943860 CAGCCAGAACATACTTCATGTGG - Intergenic
1113475487 13:110577754-110577776 CAGTCAAACTATCCTTCATGAGG - Intergenic
1115327368 14:32155209-32155231 CAATCAGTATATCATTCCTGTGG + Exonic
1118331999 14:64822464-64822486 CATCAAGAAAATCCTTCCTGAGG + Intronic
1119645064 14:76342013-76342035 CATTCTGAAGTTCCTCCCTGGGG - Intronic
1122269243 14:100561006-100561028 CAGGCAGAAAATCCTTCCGAGGG - Intronic
1125145941 15:36468534-36468556 CAGTCAGAAGCTACTTTCTATGG + Intergenic
1125423419 15:39526888-39526910 CTGTCACAATATCCTTTCTGTGG + Intergenic
1127643267 15:60935077-60935099 CATTCAGAAAATATTTCCTGAGG - Intronic
1132035729 15:98482214-98482236 AAGGGAGAAGATCCTTCATGTGG + Intronic
1132916763 16:2352304-2352326 CAGCCAGCAGATCCATCCTTAGG + Intergenic
1133297841 16:4763801-4763823 CAGTCAGAAAATCCTGCCATCGG - Intronic
1137234521 16:46604064-46604086 CGGTCAGAAGATCACTCATGTGG - Exonic
1137370941 16:47905184-47905206 CAGTTAGAATTTCTTTCCTGTGG - Intergenic
1142320444 16:89379103-89379125 CAGTGAGAAAGGCCTTCCTGGGG - Intronic
1145885597 17:28380593-28380615 CATTCAACAGATGCTTCCTGAGG - Intronic
1148958908 17:51376741-51376763 TAGTGAGAACTTCCTTCCTGGGG + Intergenic
1149355840 17:55838419-55838441 AAGTTAGAAGAGGCTTCCTGAGG - Intronic
1151059056 17:71069966-71069988 CATCCAGAAGAACCTACCTGAGG + Intergenic
1151151282 17:72089572-72089594 CAGTCAGAAGATTTTGCCCGTGG + Intergenic
1154165980 18:12014804-12014826 CTGTGAGAAGAGCCATCCTGGGG + Intronic
1155160709 18:23193132-23193154 CATTTAGTAGATGCTTCCTGTGG - Intronic
1155346719 18:24864746-24864768 CAATCAGAAGATCCTTCATTTGG + Intergenic
1158874455 18:61719689-61719711 CAGTGAGAAAATTCTTCCTTGGG - Intergenic
1164827814 19:31297222-31297244 CCCTCAGAGGATCCCTCCTGCGG + Intronic
1168432943 19:56295716-56295738 CAGTCAGAGGCTGCTTCGTGTGG - Intronic
925064869 2:922046-922068 CAGTCAGTATCTCCATCCTGAGG + Intergenic
925355775 2:3240021-3240043 AAGCCAGCAGATCCTTCCTAAGG + Intronic
927937820 2:27085475-27085497 CATTCAGCAGATCTTTACTGGGG + Intronic
929055992 2:37876215-37876237 CAGGCAGAGGTTCCTTCTTGAGG + Intergenic
930439626 2:51390180-51390202 CAGGCAGAGGAACCTCCCTGTGG + Intergenic
936504243 2:113092405-113092427 CAGTCAAAAGCCCATTCCTGTGG - Intergenic
937144914 2:119636557-119636579 GAGTCAGTAGATACTGCCTGAGG + Intronic
938792363 2:134688179-134688201 CAGTGAGAAGCTCCTGCTTGGGG - Intronic
940197078 2:151106630-151106652 CCCTCAGAAGATCCTCCCTTAGG + Intergenic
942464208 2:176190122-176190144 CAGTCCCAAGAGCCTTCGTGAGG + Exonic
943250033 2:185508062-185508084 CAGGCAGAAGAGCCTGCCAGTGG + Intergenic
945963987 2:216166013-216166035 CAGAAAGAACATGCTTCCTGGGG - Intronic
946278012 2:218645122-218645144 CAGTCAGTAAATACTTACTGTGG + Intronic
946978859 2:225184433-225184455 CAGCCAGAAGATTCTTGTTGGGG + Intergenic
947819671 2:233061118-233061140 CAGTCAGAAGCTGCTTTCAGGGG + Intronic
948589214 2:239038711-239038733 CAGTGGGAGGATCCTTACTGGGG - Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1170220348 20:13935525-13935547 CTGTCAGAACTCCCTTCCTGAGG - Intronic
1170506567 20:17031546-17031568 CAGTGAGAGGAACCTTCCTCGGG - Intergenic
1171339924 20:24419844-24419866 GAGACAGAGGAACCTTCCTGTGG + Intergenic
1172843056 20:37913638-37913660 CAGTCAGGGGAGACTTCCTGGGG + Intronic
1173225041 20:41157643-41157665 AACTGAGAAGCTCCTTCCTGTGG - Intronic
1173897004 20:46558842-46558864 CATTCAGCAGACACTTCCTGAGG + Exonic
1174445741 20:50589931-50589953 CAGTCACAAGATCTATACTGTGG + Intronic
1174578622 20:51555271-51555293 GAGTCTGAAGTTCATTCCTGGGG - Intronic
1174599252 20:51711059-51711081 TAGTCAGAAGACCCTTCTGGAGG - Intronic
1174886130 20:54336997-54337019 CAGTCATAAGTTCTTTCCTAAGG - Intergenic
1176221721 20:63972475-63972497 CAGTCAGTCAATCCTTCCTTCGG + Intronic
1181775663 22:25158512-25158534 CAGCCAGGAGAGGCTTCCTGGGG + Intronic
1181865876 22:25854835-25854857 GTGTCAGAATTTCCTTCCTGAGG + Intronic
1182066071 22:27432563-27432585 CATTTAGAAAATTCTTCCTGGGG - Intergenic
1183043654 22:35202482-35202504 AAGTCAGAGAATACTTCCTGGGG + Intergenic
950156562 3:10725451-10725473 CAGTCACCAGATCCATCCTCAGG + Intergenic
951997471 3:28747198-28747220 AAGTCAGAACATCAGTCCTGTGG - Intergenic
953178317 3:40572705-40572727 AAGGCAGAAGTTCTTTCCTGAGG + Intronic
954177968 3:48859251-48859273 CATTCAGACTATCCTGCCTGTGG + Intronic
954766448 3:52921718-52921740 CAGTGAGAGGCTCCTACCTGTGG - Exonic
956386327 3:68723855-68723877 CAGTGAGAAGATCAATCCTAAGG - Intergenic
958029492 3:88090179-88090201 CCTTCAGAAGAACCTGCCTGTGG - Intronic
960531891 3:118774381-118774403 CAGTCAGGAGATTGTTCCAGGGG - Intergenic
962373755 3:134842478-134842500 CAGTCAGAAGATCCTTCCTGAGG + Intronic
962380150 3:134892151-134892173 CACTTAGAACATCCTTTCTGTGG - Intronic
964133126 3:153313402-153313424 CAGTCAAAAGATAATGCCTGAGG - Intergenic
964834590 3:160923755-160923777 CAGTCAGAGAATCATTCTTGGGG - Intronic
965864191 3:173184133-173184155 CTGGCAGCAGATCTTTCCTGTGG + Intergenic
967881898 3:194307420-194307442 CGGTCAGGAGAGGCTTCCTGGGG - Intergenic
970661039 4:18286167-18286189 AACTCATAAGATCCTTCCTAAGG + Intergenic
971523529 4:27586100-27586122 CTGTCAGAACATCCATCCTAGGG + Intergenic
971649170 4:29249854-29249876 CTGACAGAGGATTCTTCCTGAGG - Intergenic
973735819 4:53870635-53870657 CAATCAGATTATCTTTCCTGGGG + Intronic
977085171 4:92587441-92587463 CTGTCCCAGGATCCTTCCTGTGG + Intronic
978189114 4:105893224-105893246 AAGTCAGAAAAGGCTTCCTGGGG + Intronic
979190339 4:117849284-117849306 CAGTGTGAGCATCCTTCCTGGGG - Intergenic
983083393 4:163414771-163414793 CAGTCAGAAGTTCCCTGCAGGGG + Intergenic
983208097 4:164932137-164932159 GATCCAGAAGATCATTCCTGAGG + Intergenic
986129658 5:4916189-4916211 CTTTCAGAAGATCTTTCCTGTGG - Intergenic
990802694 5:59622947-59622969 CAGTAAGAAAACCCTTCCTTTGG + Intronic
992002521 5:72449788-72449810 CACTCAGCAGATGCTTACTGAGG - Intronic
992655690 5:78907427-78907449 GAGTCATGAGATCTTTCCTGGGG + Intronic
996240576 5:121195697-121195719 CAATCAGTATATCATTCCTGTGG - Intergenic
997172776 5:131740653-131740675 CTGACAGAAGAACCTTCCCGTGG - Intronic
997565976 5:134886697-134886719 CACACAGCAGCTCCTTCCTGAGG - Intronic
999636093 5:153624254-153624276 CATTCACAACATTCTTCCTGGGG - Intronic
999729571 5:154466607-154466629 CAGTTAAAAGAGACTTCCTGAGG + Intergenic
1001152475 5:169244297-169244319 CGGGCAGAAGCTCCCTCCTGAGG - Intronic
1003902462 6:10667942-10667964 CAGTCAGGAGATTCTTCCATAGG + Intergenic
1004089943 6:12490616-12490638 CTGTCAGAAGTTCGTACCTGAGG + Intergenic
1005416460 6:25605124-25605146 CAGTCAGAATTTCCTCCCTTTGG - Intronic
1007082203 6:39115466-39115488 CAGTGAGAAGATGGTTCCAGGGG + Intergenic
1007857157 6:44869760-44869782 CAGTCAGAAGGTACTTCCTAGGG - Intronic
1008495932 6:52134110-52134132 CAGTGAGATGATCTTTCCTGTGG - Intergenic
1008954661 6:57201341-57201363 GGGTCAGAAAATCCTTCCTTTGG - Intronic
1011125497 6:84002970-84002992 CAGTCTCAACATCCTTCCTAAGG - Intergenic
1011685071 6:89817506-89817528 AAGTCAGAAAAGTCTTCCTGGGG + Intronic
1012264009 6:97119329-97119351 CAGAGAGAAGATCTTTCCTTTGG + Intronic
1014941902 6:127450844-127450866 CAGTCAAAAGATGTTTCCTTTGG + Intronic
1016862808 6:148737579-148737601 CATTCAGCAGATCCTTACTGAGG - Intergenic
1016952454 6:149593420-149593442 CAGTCAGAAGATCCCTACCCAGG + Intergenic
1020470390 7:8527967-8527989 CAGAGAGAAGATTCTTCCCGAGG - Intronic
1023361697 7:39423457-39423479 CACTCAGCAAATCCTTTCTGAGG - Intronic
1027220408 7:76210316-76210338 CATTCAGTGGGTCCTTCCTGGGG + Intronic
1029210374 7:98903459-98903481 CAATCAGAAGCTCCTTTCTGAGG - Exonic
1033553343 7:142467237-142467259 CAGTCAGAACATCTTCCCTAGGG + Intergenic
1034374383 7:150629742-150629764 CTGTCAGCACATCCATCCTGAGG + Intronic
1035307629 7:157943447-157943469 GAGCCAGCAGATGCTTCCTGTGG - Intronic
1035482311 7:159197369-159197391 CAGTCAGAGGTTCCTCCCTCTGG + Intergenic
1038306227 8:26405532-26405554 CTGTCTGAAGCTCCTTCCTGGGG + Intronic
1041177188 8:55208897-55208919 AAGTAAAAAGATCCTTCCAGTGG + Intronic
1041430393 8:57775503-57775525 CAGTCAGACAACGCTTCCTGGGG - Intergenic
1044081979 8:87896771-87896793 CAGTCACAAGACCATTCCAGAGG + Intergenic
1044594453 8:93944170-93944192 AGCTAAGAAGATCCTTCCTGGGG + Intergenic
1045051612 8:98332340-98332362 AAGTAATAAGATCCTTCCTGGGG + Intergenic
1048765033 8:137834453-137834475 CAGGTAGAGGTTCCTTCCTGGGG + Intergenic
1050665530 9:7932151-7932173 CAGCCAGAAGATTCTACCTGTGG - Intergenic
1051108577 9:13608699-13608721 CATTCAGAAGAGCCTGCCTCAGG - Intergenic
1053009334 9:34624504-34624526 CTGTCCGAAAGTCCTTCCTGCGG - Intronic
1057952635 9:99382060-99382082 TAGTCAGAGGACCCTTCCTGAGG - Intergenic
1058226789 9:102374123-102374145 CAGTCAAAAGATACATGCTGAGG - Intergenic
1058404266 9:104654016-104654038 CAGTCTGAAGACCCTCTCTGAGG - Intergenic
1059150245 9:111943002-111943024 CAGTCAGAAAAGCCCTCCTGGGG - Intergenic
1059867798 9:118535969-118535991 CAGTCATAAAATCCTCCCAGGGG - Intergenic
1185836274 X:3347496-3347518 CAGTCAGCAGAGCCAACCTGGGG + Intergenic
1186631311 X:11351803-11351825 CAGTGAGAACATCCTTTCTGTGG + Intronic
1187771667 X:22705723-22705745 CAGTCAGAACCTCTTGCCTGAGG + Intergenic
1189270731 X:39750022-39750044 CAGTCAGTATATCCATGCTGTGG - Intergenic
1192568805 X:72185260-72185282 CACTCAGATGAGCCTGCCTGAGG - Intronic
1194334465 X:92628533-92628555 AAGTGAGAAAATCTTTCCTGTGG + Intergenic
1197355736 X:125436056-125436078 CAGACTGAAGGTCCTTCCTATGG + Intergenic
1198930613 X:141854775-141854797 CAGTCAAAAGATTCTGCATGTGG + Intronic
1200642943 Y:5745587-5745609 AAGTGAGAAAATCTTTCCTGTGG + Intergenic
1201859983 Y:18586273-18586295 CTGTCAGAAACTCCTTCTTGGGG + Intronic
1201873338 Y:18734108-18734130 CTGTCAGAAACTCCTTCTTGGGG - Intronic