ID: 962374532

View in Genome Browser
Species Human (GRCh38)
Location 3:134849371-134849393
Sequence TCTTCTCCATGAAGTCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962374532_962374539 25 Left 962374532 3:134849371-134849393 CCAAGAGGACTTCATGGAGAAGA 0: 1
1: 0
2: 4
3: 39
4: 347
Right 962374539 3:134849419-134849441 CAGAATCTCATCAAGTAGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 140
962374532_962374535 -2 Left 962374532 3:134849371-134849393 CCAAGAGGACTTCATGGAGAAGA 0: 1
1: 0
2: 4
3: 39
4: 347
Right 962374535 3:134849392-134849414 GAGTCCTTTTGGCTTTTCCAGGG 0: 1
1: 0
2: 2
3: 29
4: 251
962374532_962374536 -1 Left 962374532 3:134849371-134849393 CCAAGAGGACTTCATGGAGAAGA 0: 1
1: 0
2: 4
3: 39
4: 347
Right 962374536 3:134849393-134849415 AGTCCTTTTGGCTTTTCCAGGGG 0: 1
1: 0
2: 2
3: 27
4: 232
962374532_962374534 -3 Left 962374532 3:134849371-134849393 CCAAGAGGACTTCATGGAGAAGA 0: 1
1: 0
2: 4
3: 39
4: 347
Right 962374534 3:134849391-134849413 AGAGTCCTTTTGGCTTTTCCAGG 0: 1
1: 0
2: 2
3: 66
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962374532 Original CRISPR TCTTCTCCATGAAGTCCTCT TGG (reversed) Intronic