ID: 962375940

View in Genome Browser
Species Human (GRCh38)
Location 3:134858808-134858830
Sequence CAGCCAGGACAGCCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962375935_962375940 1 Left 962375935 3:134858784-134858806 CCAAGGCCAGCTGGCCAGAGTTT 0: 1
1: 0
2: 1
3: 23
4: 218
Right 962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG 0: 1
1: 0
2: 2
3: 26
4: 358
962375931_962375940 27 Left 962375931 3:134858758-134858780 CCACAGAGTCAATGACAGAGCTG 0: 1
1: 1
2: 1
3: 25
4: 267
Right 962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG 0: 1
1: 0
2: 2
3: 26
4: 358
962375936_962375940 -5 Left 962375936 3:134858790-134858812 CCAGCTGGCCAGAGTTTCCAGCC 0: 1
1: 0
2: 2
3: 30
4: 238
Right 962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG 0: 1
1: 0
2: 2
3: 26
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962375940 Original CRISPR CAGCCAGGACAGCCCCACAG TGG Intronic
900179419 1:1304747-1304769 CCACCAGGACAGCCTGACAGTGG + Intronic
900368020 1:2319409-2319431 CGGCCAGGCCGGGCCCACAGAGG - Intergenic
900590649 1:3457985-3458007 GGGCCAGGGCAGCCCCATAGAGG - Intronic
900651715 1:3733073-3733095 CAGCCAGGCGAGGCCCTCAGTGG - Exonic
902184896 1:14717738-14717760 CTTCCATGTCAGCCCCACAGGGG - Intronic
903745179 1:25581902-25581924 CATCCAGGACAGAACAACAGAGG - Intergenic
904435275 1:30490847-30490869 CAGCAAGGGCAGGACCACAGAGG + Intergenic
905390863 1:37634631-37634653 CGCCCAGGACAGTCCCGCAGCGG - Exonic
905498719 1:38418797-38418819 CTGCGAGGTCAGCCCCACAAGGG - Intergenic
905914410 1:41674997-41675019 CAGCCTAGAAAGCCCCTCAGAGG + Intronic
906145627 1:43558522-43558544 CAGCCAGGACAGGCTCACCCCGG - Intronic
906613525 1:47219797-47219819 CAGCCCGGACAGCTACACGGAGG - Exonic
907884472 1:58580211-58580233 AAGCTAGAACAGCCCCACATGGG + Intergenic
909558946 1:76987656-76987678 CAGACACAACAGCCCAACAGTGG + Intronic
909563969 1:77034540-77034562 AAGCCAGGACATCCCCTTAGAGG - Intronic
912955770 1:114153424-114153446 CAGCCAGGAGAGACCCGAAGGGG - Intronic
914947756 1:152081094-152081116 CACCCCCAACAGCCCCACAGGGG - Intergenic
914956859 1:152170499-152170521 AAGCCAGGAGAGCAGCACAGAGG - Intergenic
915400082 1:155615787-155615809 CAGCAAGGTCAGCTCCACTGGGG - Intergenic
915417288 1:155751982-155752004 CAGCAAGGTCAGCTCCACTGGGG - Exonic
915529199 1:156493761-156493783 CAGGCAGGACTTCCCCTCAGAGG - Intronic
916075625 1:161198526-161198548 CAGCCAGGAGAGCGGCACAATGG + Exonic
917300670 1:173570751-173570773 CAGCCAGCACCTGCCCACAGAGG - Intronic
917755624 1:178094521-178094543 CGGCCAGGACAGCGCCTCCGCGG - Exonic
919309871 1:195894013-195894035 CATCCAGGCCACCCCAACAGAGG - Intergenic
920271976 1:204772285-204772307 CAGGCAGGCAAGCCCCAAAGTGG + Intergenic
920529808 1:206693666-206693688 ATGCTAGGACAGCCCCACATGGG + Intronic
920982712 1:210853375-210853397 TAGCCAGGACTGCTCCCCAGAGG + Intronic
921948732 1:220907252-220907274 CATCCAGGATAGCCCTAGAGTGG - Intergenic
922766856 1:228160479-228160501 CAGCCAGGCAAGCCCCAGAAAGG - Intergenic
923325421 1:232876186-232876208 CAGTCAGCACAGCCCCACCGTGG + Intergenic
923555421 1:234997145-234997167 CAGGAAAGACAGCCCCTCAGAGG + Intergenic
1062946531 10:1465826-1465848 CAGCCAGGACCGCCCGAGGGAGG - Intronic
1063062194 10:2567645-2567667 CAGCCAGACCAGCCCCTCACTGG - Intergenic
1064860316 10:19817918-19817940 CTGCCAGGACAGCCACTAAGAGG - Intronic
1065614041 10:27501894-27501916 CTGCCAAGACATCCCCACATGGG - Intergenic
1065949316 10:30637454-30637476 CTGCCAAGACATCCCCACATGGG + Intergenic
1065961549 10:30738046-30738068 CAGCCGGGAGAGCACCACATGGG - Intergenic
1066026596 10:31364335-31364357 CACCCCCAACAGCCCCACAGGGG - Intronic
1066546435 10:36505221-36505243 CAGCCAGGTAAGCCACCCAGGGG + Intergenic
1067097193 10:43309528-43309550 CAGCCTGGGCATGCCCACAGGGG + Intergenic
1067460074 10:46451683-46451705 CAGCCAGAACAGACCAAGAGAGG - Intergenic
1067627116 10:47932930-47932952 CAGCCAGAACAGACCAAGAGAGG + Intergenic
1067972440 10:50988121-50988143 AATCCAGGACAGCGTCACAGGGG - Intergenic
1069898291 10:71692414-71692436 TAGCCAGGGCTGCTCCACAGAGG + Intronic
1070755426 10:78989039-78989061 CAGCCAGGTCAGCAGCAGAGCGG + Intergenic
1070803582 10:79257365-79257387 CAACCAGGACAGCACAACTGAGG - Intronic
1071638533 10:87280980-87281002 CATCCAGGGCAGCAACACAGTGG + Intergenic
1071656709 10:87456972-87456994 CATCCAGGGCAGCAACACAGTGG - Intergenic
1073737768 10:106369331-106369353 CAGACAGGACAGCCTCCAAGGGG - Intergenic
1074104973 10:110382610-110382632 AAGTCAAGACAGACCCACAGGGG + Intergenic
1074308750 10:112302798-112302820 CAGCCAGGGAAGCCCCTTAGAGG + Intronic
1074355724 10:112781496-112781518 GAGCCAAGACAGCCCCGTAGAGG - Intronic
1075398188 10:122142757-122142779 CAGCCTGGCCAGTCCCACTGTGG + Intronic
1075513633 10:123092365-123092387 CAGCCATGACTGCCCCAGCGAGG + Intergenic
1075798207 10:125135791-125135813 CAGGCAGGAGAGCAGCACAGGGG - Intronic
1075895541 10:125991354-125991376 CACCCAGTACAGCCCCCCTGAGG - Intronic
1076203806 10:128578975-128578997 CAGGCAGGGCAGTCCCGCAGGGG + Intergenic
1076500433 10:130932309-130932331 AAGCCAGGAAAGGCCCCCAGTGG + Intergenic
1076673690 10:132136781-132136803 CAGCCCGGACAGACACACATGGG - Intronic
1077164333 11:1128535-1128557 CAGCCAGGACAGTCCCCGAGTGG + Intergenic
1077537027 11:3129328-3129350 CAGCCAGGACAGCCCAGCTCAGG + Intronic
1077889651 11:6409998-6410020 CAGCCAGCAGCTCCCCACAGAGG - Intronic
1078103332 11:8343141-8343163 CAGCCGGGACAGAGCCCCAGTGG + Intergenic
1079097181 11:17518528-17518550 AGGCCAGGACACCACCACAGAGG - Intronic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1082809633 11:57471611-57471633 GAGCCAGGCCTGCCCCAAAGGGG + Intronic
1083184405 11:61008791-61008813 CTGCCAGGACAGCACTACTGCGG + Exonic
1083253072 11:61481027-61481049 TGGCCAGGTCAGCCCCTCAGTGG + Intronic
1083457065 11:62786550-62786572 CAGGCAGCAGAGCCCAACAGGGG + Exonic
1083656852 11:64234178-64234200 CATCCAGGTGAGCCCCTCAGGGG - Exonic
1084418900 11:69050330-69050352 CAGCCAGTGCAGCCCCAGAAAGG - Intronic
1084531519 11:69730578-69730600 CAGCCAGGCCAGCCCCTCCCTGG - Intergenic
1084780502 11:71405146-71405168 CAACTAGGACAGTCCCACATGGG + Intergenic
1085283711 11:75346654-75346676 AAGCAGGGACAGACCCACAGAGG - Intronic
1085700410 11:78740763-78740785 CAGCCAGGACAGCCCCAGAAAGG - Intronic
1086451487 11:86921492-86921514 CAGCCAGGCAAGCCTCACAAAGG + Intronic
1089272924 11:117314609-117314631 GGGCCCGGACTGCCCCACAGAGG + Intronic
1089282351 11:117383095-117383117 CAGCCTTGAGAGCCCCACACAGG + Intronic
1089498943 11:118921847-118921869 CAGCTAGCACAGCCCCAAGGTGG + Intronic
1089844644 11:121449015-121449037 CAGCAAGGACAGCCACGAAGAGG - Intergenic
1090962859 11:131572661-131572683 CAGCTCAGACATCCCCACAGAGG + Intronic
1092030197 12:5277441-5277463 CAGACAGAACGGCTCCACAGTGG - Intergenic
1092116374 12:6011576-6011598 CAGCCAGGGCAGCGTCAAAGGGG - Intronic
1092140597 12:6180711-6180733 CAGCCAGGCCTGCCCCGCAGTGG - Intergenic
1092489327 12:8930791-8930813 GAGCCAGGGCAGCCAGACAGAGG + Exonic
1093623787 12:21322944-21322966 CAGCCATGCCACCCCCACAATGG - Intronic
1094361828 12:29638935-29638957 CAGCCATGACAGGCCTACACAGG + Intronic
1094709826 12:32950315-32950337 CGGGCAGGAGAGCCCCAAAGTGG - Intergenic
1096546717 12:52345186-52345208 CAGCCCGCACACCCCCAGAGTGG - Intergenic
1096586137 12:52621207-52621229 ATGGCAGGACAGCCCCACTGTGG - Intergenic
1096946465 12:55413746-55413768 GAGCCAGGGCAGCCAGACAGAGG - Intergenic
1097891456 12:64781147-64781169 CAGCCTCGACAGCTCCACCGAGG + Intergenic
1101735448 12:107459796-107459818 CACACAGGGCTGCCCCACAGAGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1102415829 12:112761762-112761784 CATGCAAGACAGCCCCTCAGAGG - Intronic
1103847842 12:123912201-123912223 CACCCAGGACAGACCCACCCAGG - Intronic
1104083752 12:125456526-125456548 CAGCAGGCAAAGCCCCACAGAGG - Intronic
1104619871 12:130302800-130302822 CAGCCAGGACACGCACACCGGGG - Intergenic
1104900509 12:132187473-132187495 CAGCCAGGACGGCCGCAGCGAGG - Intergenic
1110565667 13:76955363-76955385 CAGGAAGGACAGCCCCAGAAGGG - Exonic
1110626958 13:77662912-77662934 CACCCCCAACAGCCCCACAGGGG - Intergenic
1111914042 13:94342618-94342640 CTGCCAGGAAAGTCCCACAACGG - Intronic
1113619013 13:111700577-111700599 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113624542 13:111785838-111785860 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113949320 13:114062747-114062769 CAGTCATGACAGCCAGACAGTGG + Intronic
1114120889 14:19669403-19669425 CAGCAAGGCCACCCCCACATGGG + Intergenic
1115717509 14:36122607-36122629 CCACCAGGACTGCCCTACAGAGG - Intergenic
1116251495 14:42489193-42489215 CTCCCAGGAGAGCACCACAGCGG + Intergenic
1116351651 14:43871222-43871244 CAACCAGGACAGCCCCGCGTAGG + Intergenic
1118734998 14:68694905-68694927 CAGCCCAGACCGCCCCACACAGG + Intronic
1118861432 14:69667313-69667335 CAGCCAGTGCAGCCCCACTAAGG + Intronic
1118883963 14:69851422-69851444 CTGCCAAGACTGTCCCACAGAGG + Intergenic
1122430240 14:101635643-101635665 CCGCCAGGACCGCCCCACGCTGG - Intergenic
1122668001 14:103347235-103347257 CAGCCAGGACAGATCCACCCTGG + Intergenic
1122921335 14:104881609-104881631 CCTCCGGGACAGCCCCACACTGG - Intronic
1123012452 14:105356033-105356055 CAGCCAGCGCAGCCCCTCATTGG + Intronic
1202851512 14_GL000225v1_random:23232-23254 CCGCCCGGACAGCCACCCAGCGG - Intergenic
1202862371 14_GL000225v1_random:90629-90651 CTGCCAGGACAGCCAGCCAGCGG + Intergenic
1124169935 15:27363627-27363649 GAGCCATGACAGCCCTTCAGGGG + Intronic
1125512329 15:40298751-40298773 AAGGCAGGACAGGACCACAGGGG + Intronic
1126650203 15:50912612-50912634 ATGCTGGGACAGCCCCACAGTGG - Intronic
1127712117 15:61609755-61609777 CAGCCAGGTCAGTCTCATAGAGG - Intergenic
1127865587 15:63029937-63029959 GAGCCAGAAATGCCCCACAGAGG + Intergenic
1129411986 15:75355394-75355416 CTGCAAGGACAGCCCCTCAGAGG + Exonic
1130651403 15:85764060-85764082 CAGCCCTGACAGCTCCGCAGTGG + Intronic
1130910801 15:88269674-88269696 CAGGAAGGACAGACCCACATGGG + Intergenic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1132558575 16:583421-583443 CAGCCAGGGCAGAGCCACTGGGG - Exonic
1132565271 16:619615-619637 GAGCCAGGAGAGCCCCTCCGGGG + Intronic
1132608922 16:805491-805513 CAGCCAGGTCACCCCAACACGGG + Exonic
1132831971 16:1932873-1932895 TGGCCAGGGCAGCCCCAGAGCGG + Intergenic
1133030166 16:3006986-3007008 AAGGTAGGTCAGCCCCACAGGGG - Intergenic
1133272056 16:4615056-4615078 CGGCCCGGACATCCGCACAGCGG - Intergenic
1133306829 16:4814941-4814963 CAGCCAGGACAGCACAGCGGGGG - Intronic
1136025287 16:27464647-27464669 CAGTGAGGACAGCCCCCCCGAGG - Exonic
1136124118 16:28164175-28164197 AGGGCAGGAGAGCCCCACAGGGG + Intronic
1136279920 16:29202312-29202334 GAGCCAGCCCAGGCCCACAGCGG - Intergenic
1136279951 16:29202482-29202504 GAGCCAGCCCAGGCCCACAGCGG - Intergenic
1136629845 16:31483445-31483467 CAGCTAGCACAGTCCCAAAGTGG - Intronic
1136683940 16:31983327-31983349 CAGCCAAGCCAGGCCCCCAGAGG - Intergenic
1136784567 16:32926879-32926901 CAGCCAAGCCAGGCCCCCAGAGG - Intergenic
1136885216 16:33926927-33926949 CAGCCAAGCCAGGCCCCCAGAGG + Intergenic
1137057483 16:35752552-35752574 CTGCCAGGGCAGACCCCCAGCGG - Intergenic
1137791227 16:51176410-51176432 CAGCCATGGGAGCCCCCCAGGGG - Intergenic
1138829617 16:60359987-60360009 CACCCCCAACAGCCCCACAGGGG - Intergenic
1139245148 16:65434342-65434364 CAGGCAGGACAGTGCCACAGTGG + Intergenic
1139430780 16:66910126-66910148 CAGCCTGGACAGGCCCTCTGGGG + Intronic
1139704828 16:68734116-68734138 CAGACAGTACAGCCCCATGGGGG + Intergenic
1139911578 16:70400512-70400534 CAGCCAGGAGACCCCAAAAGTGG - Exonic
1140457837 16:75115057-75115079 CAGCCAGACCAGACCCCCAGAGG + Intronic
1141036440 16:80630355-80630377 CACCCAGGGCTGCTCCACAGAGG + Intronic
1142084313 16:88168420-88168442 GAGCCAGCCCAGGCCCACAGCGG - Intergenic
1203087226 16_KI270728v1_random:1190885-1190907 CAGCCAAGCCAGGCCCCCAGAGG - Intergenic
1142477498 17:198105-198127 CAGACACGACAGCCAGACAGCGG + Intergenic
1142507041 17:371084-371106 CCGCCAGTCCAGCCCCACAACGG - Intronic
1142582637 17:951741-951763 CAGCAGGGCCAGCCCCAGAGGGG + Intronic
1142586157 17:975189-975211 CAGCCAGGACAGGCTCCCACTGG - Intronic
1142942918 17:3397961-3397983 CACCCAGGACAGCGCCACCAGGG + Exonic
1142946451 17:3433365-3433387 CACCCAGGACAGCGCCACCACGG + Exonic
1144945966 17:18969592-18969614 CAGCCAGGGCAGTCCCTGAGGGG - Exonic
1145004397 17:19329178-19329200 CAGCCTGCCCAGCCCCCCAGGGG - Intronic
1145258406 17:21340335-21340357 CAGCCAGGACTAGCCCACTGGGG - Intergenic
1146385560 17:32369340-32369362 CGGCCAGGACAGGCCCCCATCGG + Exonic
1146916200 17:36679975-36679997 CGGCCAGCTCAGGCCCACAGCGG - Intergenic
1147144864 17:38479030-38479052 CAGCCAAGAGAGGCCCCCAGAGG - Intronic
1147218796 17:38916071-38916093 CATCCAGGACAGACCCATTGAGG - Intronic
1147449215 17:40493508-40493530 CAGCCAGGTCAGCTCCCCACTGG - Intronic
1147452519 17:40514657-40514679 CTGCCTGGGCTGCCCCACAGAGG + Intergenic
1147965648 17:44193047-44193069 CTGGCATGACAGTCCCACAGAGG + Exonic
1148357713 17:46986889-46986911 CAGGAAGGGCAGTCCCACAGAGG + Intronic
1148688296 17:49512898-49512920 CACCCAGGACAGCGCCACACTGG + Exonic
1148737780 17:49874480-49874502 CAGCCAGGGCTGCCCCTCTGTGG + Intergenic
1148837164 17:50471425-50471447 CAGCCAGGGTAGCCTCAAAGAGG + Intronic
1151544696 17:74785612-74785634 CAGCGGGGACTTCCCCACAGGGG + Intronic
1151986052 17:77544538-77544560 CAGCCAGAGCAGCCCCACGCGGG + Intergenic
1151994873 17:77602245-77602267 CCTCCAGGGCAGCCACACAGAGG - Intergenic
1152241254 17:79162422-79162444 CAGCCAGGCCCACCACACAGAGG + Intronic
1152368474 17:79870762-79870784 CAGCCAAGCCAGCACCGCAGCGG + Intergenic
1152420890 17:80192598-80192620 CAGCCTCGTCAGCTCCACAGAGG + Exonic
1152662474 17:81549123-81549145 CACCCAGGACGACCCCACACAGG + Intronic
1152892965 17:82892891-82892913 CCGCCACGACAGCCTCCCAGTGG - Intronic
1152895572 17:82909151-82909173 CAGCCAGGAGAGCCGCCTAGGGG - Intronic
1154353770 18:13609402-13609424 CCGCCCAGACAGCCCCTCAGAGG + Intronic
1156461081 18:37321677-37321699 CAGCCACGAGATCCCCAGAGGGG + Intronic
1157214544 18:45771726-45771748 CACCGGGGTCAGCCCCACAGTGG + Intergenic
1157851599 18:51058190-51058212 CAGCCAGGACAGCAGCAGAATGG + Exonic
1160543878 18:79640246-79640268 CAGCCACGACCGTCCCACATGGG + Intergenic
1160783615 19:889674-889696 CAGCCAGGACAGGGCCACAATGG + Exonic
1160924217 19:1535325-1535347 CCCCCAGGACAGCCCCTCTGGGG - Exonic
1161204430 19:3033693-3033715 CGGACAGGAGAGCCCCGCAGAGG - Intronic
1161526951 19:4762057-4762079 CACCCAGGGGAGCCCCTCAGAGG - Intergenic
1161704443 19:5812582-5812604 CAGCCAGGACAGCCTCGAACTGG - Intergenic
1162618603 19:11821713-11821735 CAGCCAGCACGGCCCCTCTGTGG + Intronic
1162906386 19:13826401-13826423 CCGCCAGGCCAGCCCTTCAGTGG - Intronic
1163023802 19:14497683-14497705 CAGGCAGCACAGTCCCACAGAGG - Intergenic
1163647139 19:18495848-18495870 CAGCCAGGGCAGGCCCACTGAGG + Intronic
1165120485 19:33555609-33555631 CCTCCAGCACAGCCCCACGGAGG + Intergenic
1166108753 19:40610386-40610408 CGGCCAGGACAGCCGGAGAGGGG - Intronic
1166827346 19:45617649-45617671 CAGCCAGGACAGAGCCACTGGGG + Exonic
1167520156 19:49950025-49950047 CACACAGGACAGCCCCTGAGGGG - Exonic
1167610647 19:50506362-50506384 GAGTCAGGTGAGCCCCACAGAGG - Exonic
1167638603 19:50668425-50668447 CAGCCAGGGCAGCAGCACCGAGG - Exonic
925331623 2:3063068-3063090 CAGCCAGGACACCACCCCTGCGG + Intergenic
926586794 2:14695506-14695528 CAGCCAGGTTGGCCTCACAGGGG + Intergenic
928181718 2:29072791-29072813 CAGCGAGGACAGCAGCCCAGAGG - Exonic
928425101 2:31171246-31171268 CAGCCAGGATAGAACCCCAGGGG + Intergenic
928952085 2:36822186-36822208 CAGCCAAGACTGTCCCAGAGGGG + Intergenic
929459465 2:42091625-42091647 CAGCCAGGATGGGCCCTCAGTGG + Intergenic
929963171 2:46511552-46511574 CAACCAGCACAGTCACACAGGGG - Intronic
932041391 2:68303429-68303451 AAGCCAGGTCAGCTCCAGAGAGG - Intronic
932093392 2:68826209-68826231 CTGCAGGGACAGCCCCAGAGAGG + Exonic
932605692 2:73163929-73163951 CAGCCAGCACTGCCACCCAGTGG + Intergenic
933991928 2:87640062-87640084 CAGAAAACACAGCCCCACAGAGG - Intergenic
936301916 2:111310756-111310778 CAGAAAACACAGCCCCACAGAGG + Intergenic
937091403 2:119208909-119208931 CAGCCAGGGCAGCCCCAGCGGGG - Intergenic
937366589 2:121266485-121266507 CAGTCAGGACAGACCATCAGTGG - Intronic
937376337 2:121338389-121338411 CAGCCCGCCCAGCCCCGCAGTGG + Exonic
938332277 2:130456225-130456247 CAGCCAGGATTGCCACCCAGGGG + Intergenic
938357532 2:130664443-130664465 CAGCCAGGATTGCCACCCAGGGG - Intergenic
938381326 2:130837837-130837859 CCGCCCCGACAGCCCCACACAGG - Intronic
938478009 2:131633876-131633898 CAGCCAGGATTGCCACCCAGGGG - Intergenic
939360112 2:141160532-141160554 CATCTGGTACAGCCCCACAGTGG + Intronic
946535695 2:220625656-220625678 CAGCCAGCACCACTCCACAGTGG - Intergenic
947252861 2:228127433-228127455 AAGCAATGGCAGCCCCACAGTGG + Intronic
947672373 2:231946452-231946474 CCGCCAGGACATCGCCAGAGTGG - Intergenic
947900732 2:233719285-233719307 TAGCCAGCACCGCCCCACAGAGG - Exonic
947904173 2:233747677-233747699 TAGCCAGCACTGCCCCACAGAGG - Intronic
948965504 2:241376545-241376567 CACCCTGCATAGCCCCACAGAGG + Intronic
1168826086 20:815253-815275 CAGCCAGTAGAGCCCCTCTGAGG + Intergenic
1171387784 20:24781679-24781701 GAGCCAGGCCAGCACCAGAGCGG - Intergenic
1171413212 20:24960260-24960282 CAGGCTGGCCAGCCCCCCAGAGG - Intergenic
1172527078 20:35606370-35606392 CAGCCAGTGGAGCCCCATAGTGG + Intergenic
1172671231 20:36635610-36635632 CAGCCTGGAGAGCTCCCCAGGGG + Intronic
1172837671 20:37883439-37883461 CAGCCAGGGCAGCCCAGCTGGGG + Intergenic
1173813289 20:45969422-45969444 CAGGCAGAGGAGCCCCACAGGGG - Intronic
1174040223 20:47694264-47694286 CAGCCAGGACAGCCACTGGGTGG + Intronic
1174375435 20:50123721-50123743 CAAACAGGACAGAACCACAGCGG - Intronic
1175162460 20:57019144-57019166 TGCACAGGACAGCCCCACAGCGG - Intergenic
1175215306 20:57389353-57389375 CCGGCACGACAGCCCCACAAAGG - Intergenic
1176084609 20:63290263-63290285 TAGCCAGGAGAGGCCCACAGAGG + Intergenic
1176258793 20:64168002-64168024 GCTCCAGGACAGCCCCACTGGGG + Intronic
1176853118 21:13936655-13936677 CAGACAGGGCAGCCAGACAGAGG + Intergenic
1177613754 21:23489786-23489808 CACCCAGCACTGCCACACAGAGG + Intergenic
1178891554 21:36524770-36524792 CAGGCAGGACACCTCCACATGGG - Intronic
1179137714 21:38695391-38695413 CAGCCTGGAGTACCCCACAGAGG + Intergenic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1180018409 21:45102927-45102949 GGGCCAGGTCAGCCTCACAGTGG + Intronic
1180098647 21:45574147-45574169 CAGCGAGGAGAGCCCGGCAGAGG - Intergenic
1180193845 21:46182143-46182165 GAGCCAGGCCAGCCCCATGGTGG - Intronic
1180567792 22:16690062-16690084 CAGCCAGGGCAGCGTCAAAGGGG - Intergenic
1181151577 22:20887369-20887391 CAGCCAGGAAAGAGCCAGAGAGG - Intronic
1181531610 22:23520651-23520673 CAGCCAGCACAGGGCCGCAGTGG + Intergenic
1181626429 22:24125218-24125240 CTGCCAGGGGGGCCCCACAGGGG + Intronic
1181628040 22:24134574-24134596 CAGCAATCACAGCCCCACACCGG - Intronic
1181801976 22:25353734-25353756 CAGAAAGGACAGCCCCGCAGAGG - Intronic
1183441340 22:37824785-37824807 CAGCCACACCAGCCCCACTGCGG - Exonic
1184660433 22:45963171-45963193 GAGCCAGGCCAGCCCCACACAGG + Intronic
1185043532 22:48517739-48517761 CAGGCAGGCCAGCCTCACCGCGG - Intronic
1185088213 22:48752164-48752186 CAGGGATGACAGCCCCCCAGAGG - Intronic
1185236328 22:49715669-49715691 GAGCAGGGTCAGCCCCACAGGGG + Intergenic
953250918 3:41245179-41245201 CAGCCAGGCCAGGGCCACATGGG + Intronic
953253067 3:41264042-41264064 CAGCCAGGACAGTCTCCCTGAGG + Intronic
953469768 3:43156760-43156782 CAGCAACAACAGCCCCAAAGTGG + Intergenic
954151866 3:48661939-48661961 CAGAAAGGACAGCCCCCCGGCGG - Exonic
954380223 3:50215329-50215351 CAGCCACGGTAGCCCCCCAGTGG + Intronic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
961585058 3:127915459-127915481 CAGCCAGCACAGGCCCATATTGG + Exonic
961816397 3:129552885-129552907 CAGCCAGGACATGCTCACAGAGG + Intergenic
961907402 3:130276858-130276880 CACCCAGGCCAGAACCACAGGGG - Intergenic
962375940 3:134858808-134858830 CAGCCAGGACAGCCCCACAGTGG + Intronic
963006603 3:140732171-140732193 CATCCTGGACAGCGCCACAGAGG + Intergenic
965546933 3:169925934-169925956 CACCCATGTCAGCCCAACAGTGG + Intronic
967990437 3:195126311-195126333 AGGCCAGGACAGCGCCAAAGAGG - Intronic
968728382 4:2258708-2258730 CAGCCAGGTCAGCCCATGAGGGG + Intronic
968907652 4:3462103-3462125 CAGCCAGGACTGAGCCACATCGG - Intergenic
968975934 4:3822102-3822124 CAGCCTGGACACCCCCACGCAGG + Intergenic
969447942 4:7256031-7256053 CAGCAAGGCCAGCCCCAGTGGGG - Intronic
970428102 4:15963785-15963807 ATGGCGGGACAGCCCCACAGAGG - Intronic
970627379 4:17902648-17902670 CAGCCAAGAAAGCACAACAGTGG + Intronic
972232680 4:37093567-37093589 TAGGCAGGACAGTCCCACAATGG + Intergenic
973219580 4:47710555-47710577 CAGCCAGGCTGGCCTCACAGGGG + Intronic
973328808 4:48891421-48891443 CAGCCATGGCAGCCCCACTCTGG - Intronic
975682019 4:76886503-76886525 CAGCCAGGACAGCTTCACCAGGG - Intergenic
978391909 4:108235940-108235962 CAGCCAGGACAGCTTCCCATGGG - Intergenic
981148059 4:141349155-141349177 CAGCCAGATGAGCCCCACAGGGG - Intergenic
985519732 5:368019-368041 CAGGCAGGCCAGCCCCATATGGG + Intronic
985678893 5:1245900-1245922 CAGCAAGGACAGCAGCACACAGG - Exonic
985800737 5:2004162-2004184 CAGACAGGCCAGCTCCACTGAGG - Intergenic
986041026 5:3994181-3994203 CTTCCAGGAAATCCCCACAGAGG + Intergenic
986714283 5:10511538-10511560 AAGCCAGGGCAGATCCACAGTGG + Intronic
987031662 5:13981624-13981646 CTACCAGGACAGCCCCTAAGAGG + Intergenic
987118153 5:14742663-14742685 CAGCAAGCACAGCCTCACCGGGG - Intronic
991668422 5:69023051-69023073 CAGCCAGCACTGGCTCACAGTGG - Intergenic
995714273 5:115066802-115066824 CAGCCAGTTATGCCCCACAGAGG - Intergenic
996259355 5:121446432-121446454 CAGCCACTACTGTCCCACAGAGG - Intergenic
996765323 5:127030220-127030242 CAGCCCTGACCTCCCCACAGCGG + Intronic
997441049 5:133908879-133908901 CAGACAGGACATCACCACACAGG + Intergenic
997878026 5:137566260-137566282 CCTCCAGGACACCCACACAGAGG + Intronic
999144821 5:149385513-149385535 CAGGCCTGACAGCCCCACATGGG - Intronic
1000253515 5:159516863-159516885 GAGCCAAGACAGCCCCACTAAGG - Intergenic
1001419935 5:171578770-171578792 TTGCAAGAACAGCCCCACAGTGG - Intergenic
1001751173 5:174132632-174132654 CAGCCAGGAGAGCCTGACACAGG + Intronic
1002184152 5:177446597-177446619 CCGCCAGGGCACCCTCACAGGGG - Intronic
1002923907 6:1594023-1594045 CAACCGGGAGAGCCCCAGAGAGG - Intergenic
1002942629 6:1731766-1731788 CAGCTAAGAGAGCCCCCCAGAGG + Intronic
1003095472 6:3139757-3139779 GAGCCACCACAGCCTCACAGAGG + Intronic
1003601293 6:7519823-7519845 CAGCCAGGACAGCTCTGCAAAGG - Intergenic
1004827659 6:19440938-19440960 CATAAAGTACAGCCCCACAGAGG + Intergenic
1005563886 6:27069448-27069470 CTGCCAGAACAGCCACCCAGAGG - Intergenic
1005775228 6:29124093-29124115 CAACCAGGACAGCACATCAGTGG - Intergenic
1005781291 6:29195329-29195351 CAACCAGGACAGCACATCAGTGG - Intergenic
1006102263 6:31692993-31693015 CAGCGAGGAGAGGCCCACTGGGG - Intronic
1007320978 6:41028564-41028586 CTGCCAGCGCAGCCCCGCAGCGG - Exonic
1007509074 6:42361782-42361804 CAGGCAGCTCTGCCCCACAGAGG + Intronic
1007573235 6:42908303-42908325 CAGCCAGATCAGCCTCAGAGAGG - Intergenic
1007925023 6:45643486-45643508 CAGACAGGAGAGCCCTCCAGAGG - Intronic
1007997584 6:46324989-46325011 CATCCAGGCCAGCCTGACAGTGG - Intronic
1012288363 6:97421539-97421561 CTGCCACCACAGACCCACAGAGG + Intergenic
1013589031 6:111604878-111604900 AAGCCAGGATAGTCCCAGAGGGG - Intronic
1013880121 6:114888136-114888158 CACTCAGGACAGCCCTGCAGTGG + Intergenic
1014246271 6:119073164-119073186 CAGCAAGGAAAGCCCAACAAGGG + Intronic
1014962604 6:127705644-127705666 CAGCCAGCACCGCCACAGAGGGG + Intergenic
1016464922 6:144315692-144315714 CAGCCAGCACAGCGGCACGGAGG - Intronic
1016997116 6:149968495-149968517 CTGCCAGCCCAGCCCCTCAGAGG + Intronic
1017001683 6:150001758-150001780 CTGCCAGCCCAGCCCCTCAGAGG - Intergenic
1017599956 6:156069680-156069702 CAACCAGGACAGCTCCAGAGTGG + Intergenic
1019288984 7:240821-240843 GCTCCAGGAAAGCCCCACAGAGG + Intronic
1019737166 7:2656294-2656316 CGGCCTGGACCGCCCCCCAGAGG - Intronic
1019979843 7:4613540-4613562 TAGGCAGAACAGCTCCACAGGGG - Intergenic
1020111524 7:5450763-5450785 CAGCCAGACCAGGCCCAGAGAGG - Intronic
1023523620 7:41074178-41074200 AAGCCAGGAAATCCCCGCAGTGG + Intergenic
1029741772 7:102495151-102495173 CAGCCAGGACACGGACACAGGGG + Intronic
1029759763 7:102594320-102594342 CAGCCAGGACACGGACACAGGGG + Intronic
1029777125 7:102690230-102690252 CAGCCAGGACACGGACACAGGGG + Intergenic
1030305850 7:108018387-108018409 CAGCCACGACAACCCTGCAGAGG - Intergenic
1034680821 7:152925953-152925975 CCTCCCGGGCAGCCCCACAGTGG + Intergenic
1035076423 7:156180652-156180674 GAGCCAGGGCAGCCCCGCAGAGG + Intergenic
1035136091 7:156704112-156704134 CATCCAGGAAAGCTACACAGAGG + Intronic
1035202901 7:157278385-157278407 CAGCCAGGCCACCCCCAGATGGG + Intergenic
1035243955 7:157550459-157550481 CTGTCAGGACAGCCCCACAGCGG + Intronic
1035458475 7:159024439-159024461 CAGCCATGACCTCCTCACAGTGG - Intergenic
1035739512 8:1915565-1915587 CTTTCAGGACAGTCCCACAGTGG + Intronic
1038373199 8:27012657-27012679 CACCCCCAACAGCCCCACAGGGG - Intergenic
1039704082 8:39989561-39989583 CTGTCAGGCCAACCCCACAGTGG + Intronic
1040495189 8:47960036-47960058 CGGCCAGGGCAGCACCGCAGCGG + Exonic
1040514781 8:48125963-48125985 CAGCCGGGCCAGCACCACAGGGG - Intergenic
1041562499 8:59235907-59235929 CAGCAATGACAGCCCCAATGGGG - Intergenic
1042459215 8:69043203-69043225 CAGGCAGCACAGCTCCACAAAGG + Intergenic
1043784818 8:84385708-84385730 CAGCTAGGAAAGCCATACAGTGG - Intronic
1046503712 8:115111291-115111313 CAGCAAAGAGAGACCCACAGTGG + Intergenic
1048878080 8:138852259-138852281 CAGCCAGGAGGCCACCACAGTGG + Intronic
1049030051 8:140028464-140028486 CAGTCATGAGAGCCCCACAAGGG + Intronic
1049180857 8:141221449-141221471 CAGCCCAGCCAGGCCCACAGAGG + Intronic
1049216209 8:141409511-141409533 CTGCCTGCACAGCCCCTCAGGGG - Intronic
1049266625 8:141671119-141671141 CCCCCAGGGCAGGCCCACAGCGG - Intergenic
1049372309 8:142273696-142273718 CAGCCCGGGCACCCCCACTGTGG - Intronic
1049854533 8:144853084-144853106 CAGCAATGACCGCCCCACTGTGG + Intronic
1052250680 9:26393973-26393995 CTTCCCGGACAGCCCTACAGAGG + Intergenic
1053303690 9:36969318-36969340 CAGCCAGGCCATCCTCCCAGAGG + Intronic
1053445471 9:38149991-38150013 CAGCCAGAACAGCTTCCCAGAGG + Intergenic
1055053439 9:72001931-72001953 GAGTCAGGCCAGCCCAACAGAGG + Intergenic
1055080012 9:72259391-72259413 CATCCAGGACAGGCCATCAGTGG - Intergenic
1056125306 9:83530880-83530902 CAGGCAGAACATCACCACAGGGG + Intronic
1056784592 9:89581131-89581153 CAGCCTGGACAGCCCTTCATTGG - Intergenic
1057071426 9:92103892-92103914 CACCCCCAACAGCCCCACAGGGG + Intronic
1057705467 9:97392173-97392195 CTGCCAGGACAGTCACAGAGGGG - Intergenic
1059463503 9:114450415-114450437 CAGCCAGGGCAGTTTCACAGTGG - Intronic
1059807222 9:117815478-117815500 CACCCAGGTCAAACCCACAGAGG - Intergenic
1060846026 9:126838470-126838492 AAGCCAGGACAGGTCCACCGTGG - Intergenic
1060918499 9:127404938-127404960 CAGCCAGGCCAGCCCCACGCTGG - Exonic
1061169785 9:128945965-128945987 CAGCCAGGACACCGGCATAGGGG + Exonic
1061248896 9:129415133-129415155 CAGCCAGCACAGGGCCGCAGTGG - Intergenic
1061940688 9:133882298-133882320 CAGCCTTCACAGCCCCAAAGGGG + Intronic
1062068746 9:134543811-134543833 CAGCCATGCCCGACCCACAGAGG - Intergenic
1062205283 9:135333118-135333140 CAGCCACGACAGGGCCAGAGAGG - Intergenic
1062496986 9:136836574-136836596 CTGCCAGGCCAGCCCCAGAATGG + Intronic
1185480708 X:444216-444238 GAGGCAGGACAGCCACAGAGAGG + Intergenic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1186496107 X:10014454-10014476 CCGCCAGGACAGCCCTAGAAGGG - Intergenic
1186837805 X:13455323-13455345 CACACAGGACAGCCCCACGGCGG + Intergenic
1187581271 X:20610055-20610077 CAGCCAAGGCTGCCCCTCAGGGG - Intergenic
1197563156 X:128048372-128048394 GAGGCAGGACAGCCTCACACTGG - Intergenic
1199146832 X:144379010-144379032 CAGCAGTGACAGCCTCACAGTGG + Intergenic
1199557251 X:149122809-149122831 AAGCAAGGGCAGCCCCAGAGAGG - Intergenic
1200063990 X:153496148-153496170 CAGCCAGGACAGCAGGAGAGAGG - Intronic