ID: 962377473

View in Genome Browser
Species Human (GRCh38)
Location 3:134870478-134870500
Sequence ATTCAGAAGCCCACTTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962377472_962377473 -7 Left 962377472 3:134870462-134870484 CCATCAACTGGGGAATATTCAGA 0: 1
1: 0
2: 1
3: 10
4: 164
Right 962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 187
962377465_962377473 21 Left 962377465 3:134870434-134870456 CCCCAGTTCACAAAGGGGAGTTT 0: 1
1: 0
2: 0
3: 17
4: 135
Right 962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 187
962377467_962377473 19 Left 962377467 3:134870436-134870458 CCAGTTCACAAAGGGGAGTTTTC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 187
962377466_962377473 20 Left 962377466 3:134870435-134870457 CCCAGTTCACAAAGGGGAGTTTT 0: 1
1: 0
2: 0
3: 11
4: 173
Right 962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 187
962377471_962377473 -3 Left 962377471 3:134870458-134870480 CCTGCCATCAACTGGGGAATATT 0: 1
1: 0
2: 1
3: 12
4: 126
Right 962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG 0: 1
1: 0
2: 1
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962377473 Original CRISPR ATTCAGAAGCCCACTTAGAA AGG Intronic
903206255 1:21784530-21784552 ATTCCGAAGCCCGCTTTTAACGG + Intergenic
905647326 1:39633483-39633505 CTTCAGAAGCTCTCTTAGAATGG + Intronic
907963348 1:59304825-59304847 ATTAACAATCTCACTTAGAAGGG - Intronic
909591547 1:77354479-77354501 TTTCAGTAGTCCACTTAGTAGGG + Intronic
911357011 1:96834968-96834990 TTTCAGGTGCCCACTTTGAAAGG - Intergenic
911740234 1:101378984-101379006 ATTCTCTATCCCACTTAGAATGG + Intergenic
914745918 1:150500933-150500955 ATTGAGAAGCCTTCATAGAAGGG + Intronic
916724614 1:167511682-167511704 ATTCTGAAGCCTACTTCTAAAGG - Intronic
917712918 1:177705374-177705396 ATACAGAAGCAGACTAAGAAGGG + Intergenic
917728731 1:177853201-177853223 ATTCAGAGGTCCACTTAGGAAGG - Intergenic
918592884 1:186259902-186259924 ATTAAGAAGCTCACTCAAAATGG - Intergenic
918856203 1:189759212-189759234 ACTTAGAAGCCAACTTACAAGGG + Intergenic
920084636 1:203406339-203406361 CTTCAGAGGCCCACTTAGGATGG + Intergenic
920724178 1:208418265-208418287 AATCAGAAGCCTTGTTAGAAGGG - Intergenic
921108295 1:212006353-212006375 ATTGAGAAGCCCAATTACATTGG - Intronic
921388671 1:214597142-214597164 ATTAAAAAACCCACTTACAATGG + Intergenic
1063459403 10:6205726-6205748 AATGAGAAGGCCACTTATAAAGG - Intronic
1063940268 10:11121272-11121294 ATTCACAAGCCCACAGAGACTGG - Intronic
1065267422 10:23992230-23992252 ATTCAGAAGTCCATTCAAAAAGG + Intronic
1068553448 10:58431881-58431903 ATTCAGAAGACCTCAGAGAAGGG + Intergenic
1070432572 10:76355944-76355966 ATTTGGAAACCCAATTAGAAGGG + Intronic
1070528455 10:77315488-77315510 AGTCAGAAGCAAAGTTAGAATGG + Intronic
1070651665 10:78241749-78241771 ATACAGAAGCCCACTTGAAGGGG - Intergenic
1071449039 10:85777170-85777192 ATTTAGATGCCCACTTATTAGGG - Intronic
1072444340 10:95485212-95485234 ATCCAGAAGCACATTTAGCATGG + Intronic
1073990026 10:109252160-109252182 ATTCAAAAGTCAACTTAGGATGG - Intergenic
1074296371 10:112193114-112193136 ATACAGAAAACTACTTAGAAAGG + Intronic
1075325893 10:121531939-121531961 CTAAATAAGCCCACTTAGAAAGG + Intronic
1077628958 11:3797823-3797845 ATTCACAAGCCCACTTCGAGAGG - Intronic
1077828152 11:5832603-5832625 ATACAGAATCTCAATTAGAAAGG + Intronic
1078652752 11:13210850-13210872 ATTCATAAGACCTCTTCGAAGGG + Intergenic
1078776627 11:14399922-14399944 ATTTAAAAGTCCAGTTAGAAAGG + Intergenic
1080133213 11:28820638-28820660 ATAGAGAAGCCCACTTAGCAAGG + Intergenic
1081769275 11:45637599-45637621 TTTCAGGAGCCCACAGAGAAAGG + Intergenic
1083818156 11:65149402-65149424 ATCCAAATGCCCCCTTAGAAAGG - Intergenic
1083893586 11:65609202-65609224 AATCAGAACCCCCCTTAGAGTGG + Intronic
1085373062 11:76029459-76029481 ATTCTGAATCGCATTTAGAATGG - Intronic
1085738420 11:79059191-79059213 ATTAAGAAACCTACTTTGAAAGG - Intronic
1087677950 11:101183910-101183932 AATCAGGGGCCCACTCAGAAGGG - Intergenic
1089355608 11:117850197-117850219 ATTCAGAAGACCACCAAGCAAGG - Intronic
1089569733 11:119397045-119397067 ATTCAGAAGTACAGTTAGACAGG - Intergenic
1090239543 11:125172291-125172313 ATTGAGAAGCCAACGTGGAAAGG - Intronic
1091063609 11:132488165-132488187 TTTCACAAGGCCTCTTAGAAGGG - Intronic
1097644966 12:62225455-62225477 GTTTAGAAGCACGCTTAGAAAGG - Intronic
1099271522 12:80516637-80516659 ATTCAGAAGTCCATTTACAAAGG - Intronic
1099706822 12:86164799-86164821 AGGCAGGAGCCCACTTAGCAGGG + Intronic
1099725352 12:86420030-86420052 TTTCAGAATCCTACTTAAAATGG - Intronic
1099791374 12:87339024-87339046 TTTCAGAAGCCTATTTACAAAGG + Intergenic
1100586978 12:95989527-95989549 ATGCAGAACCACACATAGAAGGG + Intronic
1101085340 12:101230087-101230109 ATTAAGAGGCCAATTTAGAAAGG + Intergenic
1101265815 12:103085861-103085883 ATTCAGCAGCCTAATTACAAAGG + Intergenic
1105987683 13:25584754-25584776 ATTTAGAAGACCACGGAGAATGG + Intronic
1106171602 13:27293322-27293344 ATGCAGACGCCCACTTAGAATGG + Intergenic
1107007914 13:35635500-35635522 ATTCAAAAGCCAAATTAAAATGG + Intronic
1107632234 13:42354365-42354387 GTTCAGAAGCACAGATAGAAAGG - Intergenic
1108900646 13:55403480-55403502 AATCAGAAGCCCTCTTCAAATGG + Intergenic
1109173797 13:59129659-59129681 TTACAGAAGCACACTTACAAAGG + Intergenic
1109293977 13:60507524-60507546 ATTAAGAAACTCACTCAGAATGG + Intronic
1110030842 13:70611207-70611229 TTTCAGTAGCTCACTGAGAAGGG - Intergenic
1112073970 13:95887891-95887913 TTTCAGAAGCCCCTTTAGAAAGG - Exonic
1113526603 13:110983895-110983917 ATTCATATGCCTACTTATAAAGG + Intergenic
1113661913 13:112113550-112113572 ATTCAGTGGGGCACTTAGAAAGG + Intergenic
1114172103 14:20282867-20282889 ATTCAGAAACTCACTCAAAACGG + Intronic
1116979695 14:51155219-51155241 GTTCATAAGCCTCCTTAGAAGGG - Intergenic
1117092388 14:52264263-52264285 ATTTAGAAGCATAGTTAGAATGG + Intergenic
1117294957 14:54370787-54370809 ATCCTGAAGCCCACCCAGAAAGG + Intergenic
1121175729 14:91889405-91889427 ATTCAGAAGGGCATTTGGAAAGG - Intronic
1121976005 14:98404714-98404736 TTTGAGAAGCCAACTTTGAAAGG + Intergenic
1123952940 15:25301156-25301178 ATTGAGAAGGCAACTTAAAAAGG + Intergenic
1126887024 15:53162146-53162168 AATCAGAAGCCCAGGAAGAATGG + Intergenic
1127281323 15:57496111-57496133 ATTCTAAAGCTCACTTAGACAGG + Intronic
1127439852 15:58995423-58995445 ACACAGGAGCCCACTTGGAAAGG - Intronic
1128150382 15:65359817-65359839 ACTCAGAAGCCTGCTGAGAAAGG + Intronic
1131632949 15:94198787-94198809 ACTCAGTAGCTCACTGAGAAAGG + Intergenic
1131707811 15:95017420-95017442 CTCCAGAAGCCTACTCAGAATGG - Intergenic
1137900512 16:52262803-52262825 ATTCTGAAGACAACTTATAAAGG + Intergenic
1140155763 16:72425445-72425467 ATTCAGAAGTTCACCTAGAAAGG - Intergenic
1140770145 16:78195895-78195917 ATTCAAAAGCCCAGTTGGAACGG - Intronic
1141086240 16:81097244-81097266 ATCCAGAAGCTTACTTAAAAAGG + Intergenic
1143890926 17:10101826-10101848 ACTGAGAAGCCAACTTAGATGGG - Intronic
1146191706 17:30773680-30773702 ACACAGAAGCCTACTTAGAAGGG - Intronic
1146233505 17:31134749-31134771 ATGGAGAAGCCCAAGTAGAAAGG - Intronic
1146336877 17:31980339-31980361 ACACAGAAGCCTACTTAGAAGGG - Intronic
1147507243 17:41031170-41031192 ATACAAAAACCAACTTAGAATGG + Intergenic
1149337363 17:55649679-55649701 GTAAAGAAGCCCACTCAGAAGGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1154989039 18:21582589-21582611 ATTGAGAAGCCAAGTTTGAAGGG + Intronic
1156464632 18:37341094-37341116 ATTCAGTAGGGCACTTAGATAGG + Intronic
1159235164 18:65662097-65662119 ATTCAGAAGCTTCTTTAGAAGGG + Intergenic
1159681165 18:71354328-71354350 ATTGACAAGCCCCCTTAGAAAGG + Intergenic
1159965442 18:74590875-74590897 ATTCAAATGCCTACTTACAATGG - Intergenic
1162242145 19:9363533-9363555 ATGCACAAGCCCACTCAGATAGG - Intronic
1168651306 19:58094094-58094116 GTTCAGAAACCCACTTAAAAAGG + Intronic
927825580 2:26307467-26307489 CTACAGAAGCGCACTCAGAAAGG + Intergenic
932563397 2:72891138-72891160 ATTCAAAAGCCCACTGAACATGG - Intronic
932860133 2:75282836-75282858 ACTCAGGAGCCCACTTTAAAAGG + Intergenic
935720031 2:105971820-105971842 ATGCAGAAGCCCACTGAGCTGGG + Intergenic
937339779 2:121083804-121083826 ATCCAGAGGCACACTTAGAAGGG + Intergenic
938967506 2:136401584-136401606 TGTCAGAAGCACACTTAGGAAGG + Intergenic
939433989 2:142149500-142149522 ATGTAGAAGACCAATTAGAAAGG - Intergenic
939577793 2:143917097-143917119 ATTTAGAAGCCAACTTAAAAGGG - Intergenic
939596166 2:144125583-144125605 ATTCCAAAGCACACTGAGAATGG - Intronic
941238620 2:163009222-163009244 ATTTACAAGCCCAATAAGAAGGG - Intergenic
941792013 2:169562643-169562665 AGTCAGAAACCCACTGAAAATGG - Intronic
942018736 2:171844440-171844462 ATTCACAATCCCAGTTAAAAGGG + Exonic
943429649 2:187783282-187783304 CATCAGAAGCCTATTTAGAACGG - Intergenic
944162022 2:196672733-196672755 ATTCAGAAGTTCACTTTGGAGGG - Intronic
944482227 2:200169611-200169633 ATACACATGCACACTTAGAATGG - Intergenic
944961642 2:204881628-204881650 ATGCTGAAGCCAACTGAGAAAGG + Intronic
945443393 2:209907430-209907452 ATTCATAAGCTCTCTTAGCACGG - Intronic
945696397 2:213111351-213111373 ATGCAGAAGCGTACTTAAAATGG - Intronic
947241268 2:227996942-227996964 ATCCAGAAGCCCAGTGAGATTGG + Intronic
947418195 2:229920417-229920439 AGTTAGACGTCCACTTAGAACGG + Intronic
1169576475 20:6967808-6967830 ATTCAGATGCACAATAAGAAAGG - Intergenic
1170253059 20:14307247-14307269 ATTCAGAACCACACATACAAAGG - Intronic
1170321956 20:15110081-15110103 ACTCACTAGACCACTTAGAATGG - Intronic
1170517399 20:17145641-17145663 ATGCAGAAGCCTTCTGAGAATGG + Intergenic
1171170704 20:23012831-23012853 ATTCTGAAGCTTACTTTGAAAGG + Intergenic
1173263574 20:41458439-41458461 ACTCAGGAGCCAACTTAGAGAGG - Intronic
1174879710 20:54265869-54265891 ATTCATAAACCCACTTAAACAGG - Intergenic
950557347 3:13703604-13703626 ATTGAGAAGGCCACATAGAGGGG + Intergenic
951052347 3:18108375-18108397 ATACAGGAGAGCACTTAGAATGG - Intronic
952558279 3:34558816-34558838 ATTAAAAAGCCAACTTGGAAGGG + Intergenic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
956278727 3:67532584-67532606 TTTCAGAAACTCACTAAGAAAGG - Intronic
960886230 3:122398015-122398037 ACTCGGGAGCCAACTTAGAAGGG + Intronic
961001522 3:123377329-123377351 ATGCAGAAGCCCTGTTAGGATGG - Intronic
962377473 3:134870478-134870500 ATTCAGAAGCCCACTTAGAAAGG + Intronic
964494218 3:157271227-157271249 TTTCTGAAGCCCCTTTAGAAAGG + Intronic
969743908 4:9054747-9054769 ATGCAGAATGCCACTAAGAAAGG + Intergenic
971100331 4:23459355-23459377 TTTCTGAAGCCCATTCAGAAGGG - Intergenic
971485840 4:27159238-27159260 ATTCATAACCCCACTGATAATGG - Intergenic
973862491 4:55079135-55079157 ATTCAGAATACCACAAAGAAAGG - Exonic
974633976 4:64534605-64534627 ATTCAGAATCCCTACTAGAAAGG + Intergenic
974990590 4:69083254-69083276 ATTCTGCAGCCCACTAATAAAGG + Intronic
975072058 4:70153991-70154013 ATTAAGAAGCACCCATAGAATGG + Intronic
975938604 4:79612619-79612641 ACTCAGAAGTCCACTTGAAAGGG + Intergenic
980070234 4:128235879-128235901 ATTTAGAAGCCCTCCTGGAAGGG - Intergenic
980965867 4:139520497-139520519 ATTCATAACCCAACTAAGAAGGG + Intronic
982195082 4:152903773-152903795 ACTCAGTAGCCCACTAACAAAGG - Intronic
983758272 4:171370034-171370056 ATTCTGAAGCCCACGGATAATGG + Intergenic
983975669 4:173930951-173930973 AGACAGAAGCCCGCTAAGAATGG - Intergenic
986994073 5:13586239-13586261 ATTCAGAGGACTACTTAGGATGG - Intergenic
987692206 5:21281789-21281811 ATTCAGAAGACCCCACAGAAGGG + Intergenic
987693575 5:21299673-21299695 ATTAAGAAGTCCACATAGCACGG - Intergenic
989093285 5:37756805-37756827 ATTCAGAAAACTACTTAGAATGG - Intergenic
989529814 5:42494926-42494948 ATTTAGCATCCCCCTTAGAAGGG + Intronic
989966194 5:50468601-50468623 ATTAAGAAGCTCACTCAAAACGG - Intergenic
990012616 5:51018766-51018788 AGTCAGATGCACATTTAGAAGGG + Intergenic
991746691 5:69749873-69749895 ATTAAGAAGTCCACATAGCACGG + Intergenic
991748154 5:69768270-69768292 ATTCAGAAGACCCCACAGAAAGG - Intergenic
991751014 5:69805369-69805391 ATTAAGAAGTCCACATAGCACGG - Intergenic
991798293 5:70329816-70329838 ATTAAGAAGTCCACATAGCACGG + Intergenic
991799736 5:70348115-70348137 ATTCAGAAGACCCCACAGAAAGG - Intergenic
991826069 5:70625185-70625207 ATTAAGAAGTCCACATAGCACGG + Intergenic
991828861 5:70661923-70661945 ATTCAGAAGACCCCACAGAAAGG + Intergenic
991830301 5:70680264-70680286 ATTAAGAAGTCCACATAGCACGG - Intergenic
991890628 5:71329132-71329154 ATTAAGAAGTCCACATAGCACGG + Intergenic
991892092 5:71347546-71347568 ATTCAGAAGACCCCACAGAAAGG - Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998188963 5:140006015-140006037 TGTCAGAAGACCAGTTAGAAAGG + Intronic
998779335 5:145639113-145639135 CTTTAGAAGACCACTTACAAAGG + Intronic
999021818 5:148174184-148174206 AGTTAGAATCCCACTTAGACAGG - Intronic
1001023994 5:168207685-168207707 ATTCAGCTGCCAACTTACAATGG - Intronic
1003424384 6:5987938-5987960 GTGGAGAAGCCCACATAGAAAGG - Intergenic
1004140824 6:13015170-13015192 CTTCAGAGGCCGACTAAGAACGG - Intronic
1004179702 6:13370537-13370559 TTTCAGAAGCCCACCGAGAGAGG - Intronic
1004396017 6:15247289-15247311 TTTCAGAAGCCCAGTTAACAGGG - Intronic
1004872738 6:19923520-19923542 AGTAAGAAGCCCACCTAGAAGGG + Intergenic
1005557332 6:27000263-27000285 ATTAAGAAGTCCACATAGCACGG + Intergenic
1008438440 6:51503920-51503942 ATGGAGAAGCCCACATAGCAAGG + Intergenic
1011284744 6:85711034-85711056 ATTCAGAAGCCAACTTGAAGAGG - Intergenic
1012355258 6:98306626-98306648 ATTCAGAATAGCACTTAGAATGG + Intergenic
1012582208 6:100882478-100882500 ATTCTGAAGCTCACTTAATAGGG + Intergenic
1012957269 6:105584671-105584693 ATAGAGAAGCCCACTTGGCAAGG + Intergenic
1013405691 6:109840925-109840947 TTTCAGGAGCACACTTAGAATGG + Intergenic
1015339698 6:132084341-132084363 GTTCAGAAGGACACCTAGAAAGG - Intergenic
1015421629 6:133017168-133017190 CATCAGAAGCCCAATTAGGAAGG + Intergenic
1018559006 6:165081769-165081791 ATTCAGAAGCACACATTGTATGG + Intergenic
1021192801 7:17641996-17642018 ATTTAGAAGTACACTTAGTAAGG + Intergenic
1021383192 7:19993939-19993961 AATCAGAATCCCACTTTAAATGG + Intergenic
1022020004 7:26389903-26389925 ATCCACAATCCCACCTAGAATGG - Intergenic
1022374975 7:29804785-29804807 ATTCATAAGCCCTCTTACATGGG - Intergenic
1022908078 7:34875378-34875400 ATTGAGAAGCCCTCTTCTAAGGG + Intronic
1023641947 7:42268176-42268198 ATTCAGCAGTCCAGTGAGAATGG - Intergenic
1024957860 7:54944312-54944334 ATTCAAAAGTGCACTCAGAAAGG + Intergenic
1024970725 7:55067286-55067308 ATTCAGAAGCACAGTGTGAAGGG + Intronic
1027425235 7:78055393-78055415 ACTCAGAAGCACACTGACAAGGG - Intronic
1028165754 7:87536932-87536954 GTTCAGATGTCCCCTTAGAAAGG - Intronic
1029147838 7:98459180-98459202 ATTCACAAGCACCCTTCGAATGG - Intergenic
1035606287 8:931709-931731 TTTCAGCAGCCCAGTAAGAAGGG - Intergenic
1037794749 8:21983459-21983481 ATTAAGAATCCAACTTAAAAAGG - Intronic
1041215257 8:55594173-55594195 ATCCAGAAGCCCATGTAAAAAGG + Intergenic
1041679117 8:60568900-60568922 CTTGAGAATCCCATTTAGAAAGG - Intronic
1043499046 8:80835061-80835083 AGTCAGCAGCACACTTAGGATGG + Intronic
1044746126 8:95373012-95373034 ATTAAGAATCTCACTCAGAATGG - Intergenic
1047031344 8:120884907-120884929 ATTCAGAAGCCAAATTGGAAAGG + Intergenic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1048487201 8:134859401-134859423 GTGCAGAAGCCCATTAAGAATGG + Intergenic
1056951077 9:91041221-91041243 ATTCACCAGGCCACTCAGAATGG - Intergenic
1057305387 9:93909392-93909414 ATTCAGAGGCCCACGGAGCAGGG - Intergenic
1057791765 9:98129413-98129435 ATCCTCAAGCACACTTAGAAAGG + Intronic
1058982884 9:110186609-110186631 TTCCAGAAGCCCATTTAAAATGG + Intergenic
1060127221 9:121059800-121059822 ATGGAGAAGCCCACGTAGAAAGG + Intergenic
1186242729 X:7587413-7587435 ATTCAGAGGCCCCCTGTGAAGGG - Intergenic
1186622708 X:11258228-11258250 AATCAGCATCCCACTTAGCACGG - Intronic
1186796061 X:13047617-13047639 CTTGAAAAGCCCACTGAGAAGGG - Intergenic
1187570913 X:20500498-20500520 ATTCAGAAGCCCCTTTGCAAAGG + Intergenic
1192422231 X:71043992-71044014 AATCAGAAGCCCTTCTAGAAGGG - Intergenic
1197607298 X:128598911-128598933 ATTCAGAATGCCTCTTAAAATGG + Intergenic
1200375692 X:155777418-155777440 ATTTAGAAACACACTGAGAAAGG - Exonic