ID: 962377490

View in Genome Browser
Species Human (GRCh38)
Location 3:134870602-134870624
Sequence TATCTAATGCTGCCCCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962377487_962377490 12 Left 962377487 3:134870567-134870589 CCGTGGACACAGATCAGCACCAT 0: 1
1: 0
2: 0
3: 11
4: 162
Right 962377490 3:134870602-134870624 TATCTAATGCTGCCCCAGATTGG 0: 1
1: 0
2: 0
3: 8
4: 83
962377489_962377490 -7 Left 962377489 3:134870586-134870608 CCATGAACGCTGGCGTTATCTAA 0: 1
1: 0
2: 0
3: 0
4: 27
Right 962377490 3:134870602-134870624 TATCTAATGCTGCCCCAGATTGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962377490 Original CRISPR TATCTAATGCTGCCCCAGAT TGG Intronic
902062241 1:13655203-13655225 TATCTAATGCTGGATCTGATTGG - Intergenic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
905933785 1:41807754-41807776 CATGAAATGCTTCCCCAGATGGG - Intronic
914660822 1:149789656-149789678 AATCTAATGTTGCCACTGATTGG - Intronic
917526394 1:175792125-175792147 TGTCTCATGTTGACCCAGATGGG - Intergenic
920697044 1:208188917-208188939 TATGTACTCCAGCCCCAGATGGG + Intronic
1064168555 10:13007894-13007916 TCTCTTATCCTGCCCCAGCTTGG - Intronic
1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG + Intergenic
1070870231 10:79744939-79744961 TATCTCAGGCTGCCTCAGTTGGG - Intergenic
1071637150 10:87267159-87267181 TATCTCAGGCTGCCTCAGTTGGG - Intergenic
1071658095 10:87470795-87470817 TATCTCAGGCTGCCTCAGTTGGG + Intergenic
1072730551 10:97843086-97843108 TTTCCAATGCAGCCGCAGATTGG + Intergenic
1076523960 10:131099139-131099161 TCTCAAATGCTGCCCCAAACAGG + Intronic
1088029386 11:105227738-105227760 TATCTACTGCTGCCCTCCATAGG - Intergenic
1092884488 12:12913267-12913289 TCTCTAGTGCTGCCTCACATTGG + Exonic
1093611822 12:21170039-21170061 AATTTAATGCAGCCCCAGAAAGG - Intronic
1097308136 12:58091338-58091360 AATCTAATGCTGCTGCTGATCGG + Intergenic
1097809919 12:64007407-64007429 AATCTAATGCTGCGGCTGATCGG + Intronic
1098368170 12:69728092-69728114 TATCTAAAGGTGCTTCAGATAGG - Intergenic
1101741370 12:107502706-107502728 AATCTAATGCTGCCACTGATCGG - Intronic
1102949333 12:117019308-117019330 CATCTAATGCTGGTCCAGAAAGG + Intronic
1104455496 12:128908226-128908248 TCTCTATTGCTGCTCCATATTGG + Intronic
1109042110 13:57352262-57352284 TCTCTCATGCTGCCCCAGCAGGG + Intergenic
1110764410 13:79266469-79266491 GCTCCAATGCTGCCTCAGATGGG - Intergenic
1120868657 14:89317840-89317862 AATCTAATGCTGCAGCTGATGGG - Intronic
1130361198 15:83188093-83188115 TGTCTAATGCTGTCAAAGATTGG - Intronic
1132130737 15:99276001-99276023 AATCTAATGCTGCTGCTGATGGG - Intronic
1135906432 16:26516281-26516303 TAACAAATGCTGCCAGAGATTGG + Intergenic
1144190201 17:12838699-12838721 TCACTCTTGCTGCCCCAGATTGG + Intronic
1146120894 17:30193479-30193501 AATCTAATGCTGCCGCTGATGGG - Intergenic
1150396260 17:64824302-64824324 TATGTAATTCTGCCCCAGTGTGG + Intergenic
1151331637 17:73413171-73413193 AATCGAATGCTGCCACTGATGGG - Intronic
1158133879 18:54184279-54184301 AATTTAATGCTGCCTCTGATTGG - Intronic
1162175406 19:8826539-8826561 AATCGAATGCTGCCACTGATCGG + Intronic
1164291639 19:23874722-23874744 AATCTAATGCTGCTGCTGATCGG + Intergenic
930887448 2:56342938-56342960 AATCGCATGCTGCCCCAGGTGGG + Exonic
931367878 2:61635251-61635273 AATGAATTGCTGCCCCAGATAGG - Intergenic
931591716 2:63891164-63891186 TCTCTAATACTGCTCCAGGTGGG - Exonic
931707502 2:64959424-64959446 TATCTAATGCTGCCCATCATTGG + Intergenic
941403778 2:165063538-165063560 AATCTAATGCTGCTGCTGATGGG + Intergenic
944920505 2:204408109-204408131 AATCTAATGCTGTCCAAAATTGG + Intergenic
1173073478 20:39793130-39793152 TATCTCATCCTGCCCCATCTAGG + Intergenic
1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG + Intergenic
1177416441 21:20799284-20799306 AATCTAATGCTGCCACTGATCGG - Intergenic
1179134752 21:38669633-38669655 TTTCTGATGCTGTGCCAGATGGG - Intergenic
1181994222 22:26862264-26862286 TTTCAAATGCTGGCCCAGAAAGG + Intergenic
1184320930 22:43741740-43741762 TACCGAATCCTGCCCCAGAGTGG - Intronic
1185189661 22:49427259-49427281 TATATAATTCTGCCCCAGGTTGG + Intronic
959176444 3:102918485-102918507 AGTCTAATGCAGCCCCATATTGG - Intergenic
961534226 3:127559694-127559716 TATCTCAAGCTGCCCCGGGTTGG + Intergenic
962377490 3:134870602-134870624 TATCTAATGCTGCCCCAGATTGG + Intronic
962970500 3:140396657-140396679 TATCCAAATCTGGCCCAGATGGG - Intronic
963322327 3:143822390-143822412 TATCGAGTTCTGCCCCAGGTTGG - Intronic
964553621 3:157911838-157911860 TCTCTAATGATGTCCAAGATAGG - Intergenic
967680395 3:192355668-192355690 TATGTGAATCTGCCCCAGATTGG + Intronic
967880005 3:194295074-194295096 TATTTAAGGCTGCCCCAGAGAGG - Intergenic
972238902 4:37167560-37167582 TGTCTAATGCTGCCTATGATGGG - Intergenic
977539197 4:98295320-98295342 TAACTAATGATGCCCCAGGAAGG + Intronic
981346208 4:143679657-143679679 GAGCTAATTCTTCCCCAGATTGG + Intronic
981544859 4:145883518-145883540 TATCTTATGCTCCCTGAGATTGG + Intronic
985034262 4:185822230-185822252 TATCTAGTGTTTCCCCAGTTGGG + Intronic
988496716 5:31751652-31751674 TATTTAATGCAGCACCAGCTGGG - Intronic
989385980 5:40854991-40855013 TATCTAATAATACCCAAGATTGG - Exonic
993621495 5:90173571-90173593 GTTCTACTGCTGCCCCAGAAGGG + Intergenic
994911895 5:105920661-105920683 TATCTAATTCTCCCACTGATGGG + Intergenic
994933420 5:106218915-106218937 TATAAAGTGCTGCCTCAGATGGG + Intergenic
998109060 5:139487213-139487235 CATCTAATGCCGCCACTGATCGG + Intergenic
998232711 5:140371563-140371585 TATCCAAAGCAGCCCCAGACAGG - Exonic
1000423529 5:161063928-161063950 TATATAATGCTGACTCTGATTGG - Intergenic
1006812374 6:36828160-36828182 TTTCTTAAGCTCCCCCAGATGGG - Intronic
1009028770 6:58031926-58031948 TTACTAATGCTGCCAGAGATAGG + Intergenic
1012118078 6:95330166-95330188 TATCTAATGCTGCATAAGAAAGG + Intergenic
1013242036 6:108255156-108255178 TATCTAATCCATCCCCAGAATGG - Intronic
1014949080 6:127534007-127534029 TATCTTTTGCAGCCCAAGATAGG - Intronic
1016944902 6:149521675-149521697 TATGGAATGCTGACCCAGAAAGG + Intronic
1023582641 7:41699456-41699478 TCTCCAATGTGGCCCCAGATTGG + Intronic
1024922002 7:54567728-54567750 TATTAAATGCTTCCCCAAATAGG - Intronic
1030315426 7:108109484-108109506 TATGTAATGCTGCCACATAGTGG - Intronic
1034635118 7:152561059-152561081 AATCTAATGCCGCCACTGATTGG - Intergenic
1035791697 8:2312087-2312109 AATCTAAGGCTGCCGCTGATCGG + Intergenic
1035801108 8:2409618-2409640 AATCTAAGGCTGCCGCTGATCGG - Intergenic
1036445414 8:8817832-8817854 AATGTAATGCTGCCGCTGATCGG + Intronic
1038926432 8:32145174-32145196 TATCTAATGACGGCCCAGAAAGG + Intronic
1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG + Intergenic
1047663794 8:127067410-127067432 TATCAAATCCTGCACCAGAGCGG - Intergenic
1049773980 8:144396297-144396319 TGGCTGATGCTGCCCCAGCTGGG - Intronic
1057078231 9:92152171-92152193 TCTCAAATGCTGCCCCAAACAGG + Intergenic
1058940123 9:109805633-109805655 TATTTAGAGCTGCCCCAGTTTGG + Intronic
1060118430 9:120965226-120965248 TATATAATGCAGTCCCAGCTGGG + Intronic
1188065920 X:25659162-25659184 AATCTAATGCTGCCACTGATCGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1198752958 X:139953725-139953747 TATCCTATGTGGCCCCAGATGGG + Intergenic