ID: 962379074

View in Genome Browser
Species Human (GRCh38)
Location 3:134882523-134882545
Sequence GACGCTGATGCTTCATAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962379074_962379084 27 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379084 3:134882573-134882595 GAGGAATCAACTTGTGGGTAGGG 0: 1
1: 0
2: 1
3: 7
4: 122
962379074_962379081 22 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379081 3:134882568-134882590 ACCATGAGGAATCAACTTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 113
962379074_962379086 29 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379086 3:134882575-134882597 GGAATCAACTTGTGGGTAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 142
962379074_962379083 26 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379083 3:134882572-134882594 TGAGGAATCAACTTGTGGGTAGG 0: 1
1: 0
2: 3
3: 6
4: 177
962379074_962379080 21 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379080 3:134882567-134882589 AACCATGAGGAATCAACTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 130
962379074_962379079 8 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379079 3:134882554-134882576 CATAACACTGTTTAACCATGAGG 0: 1
1: 0
2: 1
3: 3
4: 114
962379074_962379085 28 Left 962379074 3:134882523-134882545 CCCAATTATGAAGCATCAGCGTC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962379085 3:134882574-134882596 AGGAATCAACTTGTGGGTAGGGG 0: 1
1: 0
2: 2
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962379074 Original CRISPR GACGCTGATGCTTCATAATT GGG (reversed) Intronic
911961664 1:104311734-104311756 GCCGCTGATACTTCCTAAATAGG - Intergenic
917717022 1:177748641-177748663 GAAGCTGATGACTCATGATTTGG + Intergenic
920453684 1:206080747-206080769 CACGCTGATGCTTCCTACTGAGG - Intronic
921825241 1:219665024-219665046 GACTCTGTTTGTTCATAATTCGG - Intergenic
1068191880 10:53663079-53663101 GACTCTGATGCTTTAGCATTTGG - Intergenic
1068545211 10:58336651-58336673 GATGCTAAGGCTTCAAAATTAGG - Intronic
1075708368 10:124516578-124516600 AAAGCTGTTGGTTCATAATTTGG + Intronic
1079740584 11:24054748-24054770 GACTCTGATCTTTAATAATTTGG - Intergenic
1080090890 11:28347636-28347658 GAAAGTGATCCTTCATAATTTGG + Intergenic
1081714102 11:45236342-45236364 GGGGCTGATGGGTCATAATTAGG - Intergenic
1085898663 11:80670524-80670546 AAGGCAGATGCTTCATATTTGGG + Intergenic
1087387312 11:97488214-97488236 AACGGTCTTGCTTCATAATTCGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1103055795 12:117819141-117819163 GAGCCTGATGCTACATATTTTGG - Intronic
1106907935 13:34428478-34428500 TACACTGATGCATCACAATTTGG + Intergenic
1109580477 13:64325652-64325674 GAGAATGAGGCTTCATAATTTGG - Intergenic
1112397650 13:99047822-99047844 GAGGCTGATGCTTCAAGATTAGG - Intronic
1118475483 14:66112283-66112305 GAAGCTTAGACTTCATAATTTGG + Intergenic
1126226590 15:46277863-46277885 CACGTGGCTGCTTCATAATTTGG + Intergenic
1127319703 15:57831176-57831198 GACGCTGATGATTCTTATTTAGG + Intergenic
1131626622 15:94127464-94127486 ATCACTGATGCTTCATAATGAGG + Intergenic
1157233688 18:45943090-45943112 GACACAGATACTGCATAATTGGG - Intronic
1166472057 19:43086949-43086971 GAAGCTAATGTTTCACAATTGGG + Intronic
1167172649 19:47843476-47843498 GCCCCTGATCCTTCATAAATTGG - Intergenic
1167770866 19:51516660-51516682 GAAGATTATGCTTCATAATCTGG + Intergenic
925327464 2:3034864-3034886 GACCCTGGTGCTTCCTCATTAGG - Intergenic
930387266 2:50712664-50712686 GATGATGATGCTTCTGAATTAGG - Intronic
937269492 2:120639349-120639371 GAGGGTGATGCTCCATCATTCGG - Intergenic
940695792 2:156976616-156976638 GACGATGATACTTAATAATAAGG - Intergenic
941007493 2:160262885-160262907 GAAGCTGAGGCTTCATAAGGGGG - Intronic
943992216 2:194711107-194711129 TACGGTGATTCTTCATGATTTGG - Intergenic
945009320 2:205444581-205444603 GCCACTGAAGCGTCATAATTGGG + Intronic
953440386 3:42911048-42911070 GACTCTGCTGCTTCATACCTAGG + Intronic
953508620 3:43511954-43511976 GACTCTGCTGCTTTAGAATTTGG - Intronic
954937741 3:54342574-54342596 GAAGCTGATGCTTCAGAGCTTGG + Intronic
955839349 3:63095995-63096017 GACTCTGCTTCTTCATAACTTGG + Intergenic
956791439 3:72683178-72683200 GACTCATATGCTTCCTAATTGGG - Intergenic
957282993 3:78177841-78177863 GACGCTAATTTTTCATCATTGGG + Intergenic
957632391 3:82733765-82733787 GACTCGCATGCTGCATAATTGGG + Intergenic
958459180 3:94372393-94372415 GACTCTGATGCTTGATTAATAGG - Intergenic
958992392 3:100861990-100862012 CATGCTGATGCTTCTTATTTTGG + Intronic
962379074 3:134882523-134882545 GACGCTGATGCTTCATAATTGGG - Intronic
969928188 4:10604954-10604976 GCAGATGATGCTTCATAATGTGG + Intronic
976282869 4:83342337-83342359 GACCCTAATGTTTCATAATATGG - Intergenic
976712364 4:88085965-88085987 TGAGCTGATGCTTCAGAATTTGG + Intergenic
980527473 4:134011232-134011254 GAAGCTGATGCTACTTATTTTGG - Intergenic
981794195 4:148576983-148577005 GATGATGATGCTGCATAACTGGG + Intergenic
982482684 4:155931947-155931969 GTTACTGATGCTTCATAATGTGG + Intronic
986159405 5:5212461-5212483 TATTCTGAAGCTTCATAATTCGG + Intronic
987471600 5:18337544-18337566 GATGCTGTTGCTTCATTATCTGG - Intergenic
990779343 5:59341381-59341403 GACTCTGATGCTTCATGACAGGG - Intronic
994856519 5:105128127-105128149 GACGCTCATCCTTTATCATTTGG - Intergenic
996896814 5:128494134-128494156 GACACTGCTGCTTTATAAATAGG - Intronic
997911965 5:137883876-137883898 AATGCTTATGCTTCATTATTTGG - Intronic
1001692487 5:173643437-173643459 GAAGCTGATGCAACAGAATTGGG + Intergenic
1002012878 5:176298101-176298123 GGCACTGAAGCTTCTTAATTCGG - Intronic
1002214960 5:177624634-177624656 GGCACTGAAGCTTCTTAATTCGG + Intergenic
1008302329 6:49856343-49856365 GACCTTCATGCTTCATAATAAGG - Intronic
1010175944 6:73028170-73028192 GACTCTGCTGCTCCATATTTTGG - Intronic
1011278422 6:85652244-85652266 GTCGCTGTTGGTTCACAATTGGG + Intergenic
1015131705 6:129818518-129818540 GATGCTGATGATTCATAACCAGG + Intergenic
1021294421 7:18887191-18887213 GATACTGATGCTTGTTAATTTGG - Intronic
1034061416 7:148094677-148094699 GACCCTGAAGTTTCATAATATGG + Intronic
1037496256 8:19443826-19443848 GTCCCTGATGCTGCAAAATTTGG - Intronic
1039327381 8:36500409-36500431 GACGCTGGTGCTTCCTTATGTGG - Intergenic
1049183416 8:141235294-141235316 GACGCTCATGATTTATAAATGGG - Intronic
1054821754 9:69529091-69529113 CAATCTGAAGCTTCATAATTAGG - Intronic
1056436980 9:86583951-86583973 TACTTTCATGCTTCATAATTCGG - Intergenic
1060515446 9:124262902-124262924 AACCCTCATGCTTCAGAATTAGG + Intronic