ID: 962379430

View in Genome Browser
Species Human (GRCh38)
Location 3:134885672-134885694
Sequence GAGAACATTTGGAAAACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962379424_962379430 26 Left 962379424 3:134885623-134885645 CCAAGGAGTTTTGTGGAACATAA 0: 1
1: 0
2: 1
3: 12
4: 175
Right 962379430 3:134885672-134885694 GAGAACATTTGGAAAACTTCTGG 0: 1
1: 0
2: 1
3: 27
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962379430 Original CRISPR GAGAACATTTGGAAAACTTC TGG Intronic
901619189 1:10568701-10568723 GAGGATATTTGGAAAAATTAAGG + Intronic
902134958 1:14297209-14297231 GAGAAGATTCAGAGAACTTCAGG - Intergenic
903759503 1:25687984-25688006 GAAAACATTTAGATGACTTCGGG - Intronic
904207927 1:28866779-28866801 GTGAAGATTTGGAGAGCTTCAGG - Intergenic
905986434 1:42287514-42287536 GAGAAGAGTTGGAGAAGTTCTGG - Intronic
906914106 1:49989790-49989812 GAGAATATTTTAAAAATTTCTGG - Intronic
907095780 1:51779454-51779476 GATAACATTGGAAAAACTTCTGG + Intronic
907263003 1:53236002-53236024 GAAAACATTTTGAAAACTGTAGG + Intronic
908095316 1:60731413-60731435 GAGGCTATTGGGAAAACTTCAGG - Intergenic
909542549 1:76807062-76807084 GAAAAGATTTGGAAAACTCTTGG + Intergenic
910102113 1:83588736-83588758 TAAAACATTAGGGAAACTTCAGG - Intergenic
912135153 1:106652065-106652087 GAGAACCTTCCTAAAACTTCAGG + Intergenic
912647033 1:111402898-111402920 AATGACATGTGGAAAACTTCCGG - Intergenic
913783764 1:122423802-122423824 GTGGACATTTGGAGAGCTTCAGG + Intergenic
914768521 1:150661631-150661653 GTGAAGCTTTGGAAAACTTTAGG + Intronic
916929971 1:169566767-169566789 GAAAATATTTGTAAAATTTCTGG + Intronic
917058165 1:171006543-171006565 GAGAACATTTAAAGAAATTCTGG + Intronic
917213199 1:172651307-172651329 GAGAACATTCTGAAAGCTTCTGG + Intergenic
917559026 1:176125329-176125351 GAAAACATTGGGGAAACTTGGGG - Intronic
919127597 1:193414807-193414829 CAGTACATTTGGAAAACTACAGG - Intergenic
919583836 1:199410747-199410769 GGGCACATTTGGAGAACTGCTGG - Intergenic
920134716 1:203760453-203760475 GAGAACTTCTGGAAAGTTTCTGG + Intergenic
921543148 1:216443628-216443650 ATGAACATTTGGATAATTTCTGG - Intergenic
921920923 1:220668212-220668234 CTGAAAATTTGGAAAAATTCTGG - Intergenic
923979066 1:239299936-239299958 GAGAATTTTTGGACAATTTCAGG + Intergenic
924128499 1:240880931-240880953 GAAAAATTTTGGTAAACTTCTGG + Intronic
924502716 1:244652550-244652572 GGAAGCATTTGGAAAACTTAGGG + Intergenic
1063023614 10:2155455-2155477 GAGACCATAAGGAAAACTTCTGG - Intergenic
1063092787 10:2882477-2882499 GACAACATTAGGAAGACCTCGGG + Intergenic
1063301472 10:4852988-4853010 AAGAACATTTAGGAAACCTCAGG + Intergenic
1066147125 10:32572544-32572566 ATGAACATTTTCAAAACTTCTGG - Intronic
1066690869 10:38026693-38026715 GAAAACATAAGGAAAACTTTGGG - Intronic
1067001874 10:42622901-42622923 GAAAACATAAGGAAAACTTTGGG + Intronic
1067387370 10:45828604-45828626 GAGCACATTTGGAGAACCACTGG - Intronic
1067590481 10:47504764-47504786 GAGCACATTTGGAGAACCACTGG - Intronic
1067637604 10:48012851-48012873 GAGCACATTTGGAGAACCACTGG - Intergenic
1067852582 10:49763306-49763328 AAGAACTTTTGGGAGACTTCAGG - Intergenic
1069050975 10:63793713-63793735 GAAAACATTGGGGAAACTCCAGG + Intergenic
1070134200 10:73677294-73677316 GAGCACATTTGGAGAACCACTGG - Intronic
1070740026 10:78896850-78896872 GAGAACGTTTGGGAAACTCTGGG + Intergenic
1071339965 10:84636826-84636848 GAGAACACTTGGTAATCTCCTGG + Intergenic
1071607513 10:87007109-87007131 GAGCACATTTGGAGAACCACTGG + Intergenic
1072626460 10:97115481-97115503 GAGAACATTTGCAAACTTACAGG - Intronic
1072875608 10:99169770-99169792 GAGAACATTTGAAAAATTAGGGG - Intronic
1073093656 10:100966980-100967002 GATTCCATTTGGAAACCTTCTGG - Intergenic
1074452592 10:113571332-113571354 GAGAACATGTGGACAACGGCTGG - Intronic
1074602952 10:114934029-114934051 GAGAACACCTGGAAAACCACCGG + Intergenic
1075299537 10:121309466-121309488 GAAAACATTTGGAAGGATTCGGG + Intergenic
1076011397 10:126991870-126991892 CAGCAGATTTGGAAAACTTCTGG + Intronic
1076431102 10:130402942-130402964 GAGGAAATTTGGAAAACCTGGGG - Intergenic
1078571175 11:12459084-12459106 GCCAACATCCGGAAAACTTCAGG - Intronic
1078986136 11:16600847-16600869 GATCACATTTGAAAAACCTCAGG + Intronic
1079699920 11:23532508-23532530 GAGAAAATGAGGAAAAATTCTGG - Intergenic
1079810288 11:24990244-24990266 TTAAACAGTTGGAAAACTTCAGG - Intronic
1080296457 11:30735415-30735437 GAGTATATGTGAAAAACTTCTGG + Intergenic
1080717369 11:34817389-34817411 GAGAAGATTTGGAAGAGTTGAGG - Intergenic
1081051341 11:38345262-38345284 GACAACCTTTGGAAAATATCAGG + Intergenic
1081077458 11:38694356-38694378 GAGAACATTTTCTAGACTTCAGG + Intergenic
1081704356 11:45172271-45172293 AAGGAGATTTAGAAAACTTCTGG - Intronic
1082676333 11:56109162-56109184 GAGAAAAATGGAAAAACTTCAGG - Intergenic
1083243244 11:61405329-61405351 TAGTACACTTGGAAAACCTCTGG - Intronic
1085734083 11:79024145-79024167 GAGAAAGTTTGGAAAAGGTCTGG + Intronic
1085866193 11:80296666-80296688 GAAAACATTGGGAAAACATTGGG + Intergenic
1087204612 11:95380983-95381005 GAGAATATTGGGCAAACTACAGG + Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088392320 11:109328176-109328198 GGGAACAATTAGAAATCTTCAGG + Intergenic
1088589472 11:111390978-111391000 CAGAAAATTTGGCAGACTTCTGG + Intronic
1090639457 11:128717933-128717955 GGGAACATCTGGAGGACTTCTGG - Intronic
1090648317 11:128784343-128784365 GAGGACATTTGTAACACTGCTGG + Intronic
1091540084 12:1452345-1452367 GAGAATATTTTGAAAGCCTCAGG - Intronic
1092035787 12:5333304-5333326 GAGCACATTGGGAAGACATCAGG + Intergenic
1093728538 12:22543093-22543115 GAGAACATTTAGGAAACATCAGG + Intronic
1095654732 12:44655619-44655641 GTTAATGTTTGGAAAACTTCAGG - Intronic
1097085306 12:56463665-56463687 GAAAGCAGTTGGAAAACTTGAGG - Intronic
1097363346 12:58682323-58682345 GACAACATTGAGAAAACTTGTGG + Intronic
1098207413 12:68126658-68126680 GAAAACATTGGGGAAACTCCAGG - Intergenic
1098840618 12:75473695-75473717 CAGAACTTTTCTAAAACTTCTGG + Intergenic
1099068031 12:78008064-78008086 AAGAACATTTGCAACACATCAGG - Intronic
1099150583 12:79107500-79107522 GACAACATTTTTTAAACTTCTGG - Intronic
1099834225 12:87886956-87886978 GTGAACAGTTGGAAACATTCTGG + Intergenic
1099899899 12:88695186-88695208 GAGATCATTTGGAAACTTTAAGG - Intergenic
1099902906 12:88734793-88734815 AAGAACATTTAGAAAACTCAAGG - Intergenic
1099933028 12:89095411-89095433 GATGACATTTTGAAAACCTCTGG + Intergenic
1100033582 12:90222805-90222827 GAAAATATTTAGAAATCTTCTGG - Intergenic
1100935132 12:99655822-99655844 GACAATATTAAGAAAACTTCTGG + Intronic
1101162123 12:101988626-101988648 GAAAACATTGGGGAAACTCCAGG - Intronic
1104199658 12:126576109-126576131 GAGAAATTTTGGATAAATTCAGG - Intergenic
1104240885 12:126988247-126988269 GAAAACCTCTGGAAAACTCCAGG - Intergenic
1105142857 13:17136562-17136584 GTGAACATTAGGACAGCTTCAGG + Intergenic
1106188680 13:27431007-27431029 GAAAACATTGGAAAAACTTCTGG - Intronic
1106213329 13:27671536-27671558 GAGAACATTTTAAATATTTCTGG - Intergenic
1107713297 13:43172012-43172034 GATAACATTTGGAAAATTGCAGG + Intergenic
1110543690 13:76733560-76733582 GAGATAACTTGGTAAACTTCAGG + Intergenic
1112103286 13:96213669-96213691 GAGAAAACTAGGAAAACTCCTGG + Intronic
1112720396 13:102237272-102237294 GAGAACATCTGAAAAACGTGAGG + Intronic
1112723468 13:102274087-102274109 GATATCATGTGGAAAACTGCTGG + Intronic
1112952261 13:105014330-105014352 GAGACTATTTGGAAAATTTGAGG + Intergenic
1114892274 14:26940522-26940544 TAGAACATTTGGATAATGTCTGG + Intergenic
1114997140 14:28368382-28368404 GAGAACATTTAGAAAGCTCTTGG + Intergenic
1115148320 14:30253312-30253334 AAGCACATTTGGCAAACTTGTGG + Intergenic
1115374581 14:32660380-32660402 GAGAACAGCTGGACAACATCTGG + Intronic
1116454540 14:45104118-45104140 GAGAACATATCAAAAACTTCAGG - Intronic
1116669955 14:47828621-47828643 GAGATCATTTTGGAAACTTAAGG - Intergenic
1118497293 14:66320627-66320649 GAAAACATGGGGAAAACTTCAGG + Intergenic
1120057161 14:79937895-79937917 GAGAACTGTTGGAAAACATGTGG + Intergenic
1120295808 14:82638861-82638883 CAGAATATTTGGAAAAGTTATGG + Intergenic
1120414000 14:84195657-84195679 GAGGACATTTGGAAATGTTTAGG + Intergenic
1120471929 14:84936559-84936581 AAGAAAAGTTGTAAAACTTCTGG + Intergenic
1123225474 15:17020385-17020407 GAGGATATTTGGAAAGCTTTGGG + Intergenic
1123264442 15:17697896-17697918 GTGAATATTTGGAGAACTTTGGG + Intergenic
1125022563 15:34999684-34999706 GGAAACATTTGGAAGACTTTAGG + Intergenic
1125093557 15:35824963-35824985 GAGAACATTTGGAAAAAGCAAGG + Intergenic
1126916603 15:53473184-53473206 GAGAACATTTTGAGAACATCTGG - Intergenic
1127155389 15:56119273-56119295 GAGAACACTAGGGAAACTCCAGG - Intronic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1127832216 15:62760935-62760957 GAGAGCATAAGGAAAGCTTCTGG - Intronic
1130636976 15:85631893-85631915 AAGAAAATTTGGGAAACTACAGG + Intronic
1133629554 16:7606632-7606654 CAGAACATTTGGAAAATTACAGG + Intronic
1134403225 16:13931592-13931614 GACAACATTTGGATATCTACAGG - Intronic
1134661455 16:15987591-15987613 GACAACATTTGGAAACATCCTGG - Intronic
1135649247 16:24191290-24191312 GGGAGCATTTGGAAAACATGAGG - Intronic
1136870837 16:33806454-33806476 AAAAACATTTGAAAAAATTCAGG - Intergenic
1137794434 16:51203417-51203439 CAGAAAATGTGGAAATCTTCAGG + Intergenic
1138162401 16:54766750-54766772 GAGAACATGTGGAAACATGCAGG + Intergenic
1138186600 16:54982176-54982198 GAGAAGATTTGGAAAAGGTGGGG + Intergenic
1138751065 16:59421679-59421701 GATAACATTGGAAAAACTTCTGG - Intergenic
1140482615 16:75269993-75270015 GAGATGATTTGGAATTCTTCTGG + Intergenic
1140524140 16:75608228-75608250 GAAAACAATTGGAAGCCTTCAGG - Exonic
1140652723 16:77106281-77106303 GAGAACATTTTTAAGACATCAGG + Intergenic
1140777387 16:78262632-78262654 GAGAACAGTTGGAGAAGGTCAGG + Intronic
1140825098 16:78698865-78698887 CAGAACATTAAGAAAACTTAAGG - Intronic
1203101335 16_KI270728v1_random:1309604-1309626 AAAAACATTTGAAAAAATTCAGG + Intergenic
1145256744 17:21329142-21329164 AACAAAATTTGGAAGACTTCAGG - Intergenic
1145319869 17:21758808-21758830 AACAAAATTTGGAAGACTTCAGG + Intergenic
1145749219 17:27343242-27343264 GAGCACATTTGGAAACCTCTGGG + Intergenic
1149120121 17:53152571-53152593 GAGAACATTGCCAACACTTCCGG + Intergenic
1149357837 17:55861719-55861741 CATAACATTTGGATAACTTTGGG + Intergenic
1150357122 17:64496433-64496455 GAGAACGTATTAAAAACTTCTGG - Exonic
1151198390 17:72448481-72448503 GTGAAAACTTGGAAAACTACTGG + Intergenic
1151770892 17:76160182-76160204 GAGAATAGTTAGAAAACTTAGGG - Intronic
1151862544 17:76775821-76775843 AAGAAAATTTGAAACACTTCTGG + Intronic
1152544440 17:80993641-80993663 GATGACGTTTGGAAAACTTAAGG + Intronic
1153492890 18:5667897-5667919 GAAAACATTTGAAATATTTCAGG + Intergenic
1154355045 18:13618664-13618686 GAAAACATTTGGAAATCCTAGGG + Intronic
1155012911 18:21799639-21799661 GAGAAAACTTGGAATACTTAAGG + Intronic
1155154851 18:23149657-23149679 GAGCACATTCTGAAAACTACTGG - Intronic
1156656390 18:39293388-39293410 TAGCACATTTGGAATTCTTCTGG + Intergenic
1158568018 18:58571716-58571738 GAAAATATTTGGAAATCTTTAGG + Intronic
1158899132 18:61946258-61946280 GAGGACATTGTGAAATCTTCAGG - Intergenic
1159052396 18:63433583-63433605 GAGATCATTTGGCAACCTTGAGG - Intergenic
1159762498 18:72445650-72445672 GAGAATGTTTGGAAAAATACTGG + Intergenic
1159901266 18:74048837-74048859 TAAAACACTTGGAAAACTACAGG - Intergenic
1160000697 18:75018822-75018844 TTGCAAATTTGGAAAACTTCAGG + Intronic
1163411601 19:17158370-17158392 GAGACCAGTTCGAGAACTTCAGG + Intronic
1168594097 19:57661078-57661100 GAGAATAACTGGAAAACTTTTGG - Intergenic
925482132 2:4286933-4286955 GAGAACATCTAGGAAACTTAAGG + Intergenic
925625341 2:5837392-5837414 GAGAACATTTTGAAAATATTTGG + Intergenic
927330062 2:21852064-21852086 GATAATGTATGGAAAACTTCAGG - Intergenic
928208827 2:29308358-29308380 TAGAACATTAGGAAAAATGCAGG - Intronic
928651151 2:33405033-33405055 GAGAATGTTTGGGGAACTTCAGG + Intergenic
928709203 2:33985886-33985908 GAGAACACTTGGAAAGATTAAGG + Intergenic
929513071 2:42580930-42580952 CAGAACATTTCAAAAGCTTCAGG - Intronic
929595875 2:43175435-43175457 TAGCACCTTTTGAAAACTTCTGG + Intergenic
929980868 2:46679035-46679057 CAGAGCACTTGGAGAACTTCTGG + Intergenic
930155112 2:48098920-48098942 GAGAAAATTTAGGAAACTTATGG + Intergenic
931069177 2:58625153-58625175 GAGCACAATTAGAAAACTACTGG - Intergenic
931259093 2:60601058-60601080 AAGTACATTTGGAGAACTTCTGG + Intergenic
931335119 2:61333287-61333309 GAAAAAATTTGAAACACTTCTGG - Intronic
932958742 2:76387346-76387368 TAGAAATATTGGAAAACTTCTGG + Intergenic
933286702 2:80392119-80392141 GAGAACATTTAGAAACCTGTTGG + Intronic
933879008 2:86649201-86649223 GAGAACCCTTTGAAAATTTCTGG - Intronic
935185353 2:100726804-100726826 GAGAACATCTTAAAAACTGCTGG + Intergenic
935201578 2:100861305-100861327 GAGAACACTTGGAAAACTTTAGG + Intronic
935889536 2:107661091-107661113 GTGATCATTTTGAAAAATTCTGG - Intergenic
936548990 2:113418460-113418482 GAGAACATTTGGCACATTTGGGG + Intergenic
937006634 2:118522494-118522516 GAGAGCATTTGGAAATGTCCAGG + Intergenic
937722241 2:125114872-125114894 GAGAATATTTGGAAAAGTAATGG + Intergenic
938545585 2:132326983-132327005 GAGAACATTTTCAAAACCTTGGG - Intergenic
940425804 2:153530942-153530964 GAAAACATTGGAGAAACTTCAGG + Intergenic
940493714 2:154398295-154398317 GAGGACTTTTGGAAATCCTCTGG + Intronic
941314112 2:163970763-163970785 GAGATAACTTGGATAACTTCCGG - Intergenic
941391189 2:164916996-164917018 GATAAAATATGTAAAACTTCTGG + Intronic
941587317 2:167377017-167377039 CACAACATTTTGAAAACCTCTGG - Intergenic
941780262 2:169436820-169436842 GAAAACATCGGGAAAACTCCAGG + Intergenic
942768084 2:179481137-179481159 CAGAGCATTTGGAAAACACCAGG - Intronic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
943376532 2:187084579-187084601 GAGAACATTTAGAATATTTGTGG - Intergenic
943415022 2:187591071-187591093 GAGATCATTTGGAAACTTTAAGG - Intergenic
943565505 2:189511053-189511075 GAGAACATTCAGATAAGTTCAGG + Intergenic
945144103 2:206718147-206718169 GTAAACATTTGGCAAATTTCTGG - Intronic
945206100 2:207334236-207334258 GAGAAAAGTTGGAAAAATTCTGG - Intergenic
945541255 2:211089853-211089875 CCTAATATTTGGAAAACTTCAGG - Intergenic
948326528 2:237126304-237126326 GAGCACATTTAGAAAGCTACTGG + Intergenic
1169661152 20:7979821-7979843 AAAAACATTTGAAACACTTCTGG - Exonic
1169874290 20:10280011-10280033 GAAATCATTTGGAAAACCTGAGG + Intronic
1171603510 20:26789443-26789465 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171639687 20:27331966-27331988 GAGGACATTTGGAGCGCTTCAGG + Intergenic
1171656672 20:27586552-27586574 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171664171 20:27698724-27698746 GAGGACATTTGGAGCGCTTCAGG + Intergenic
1171667326 20:27746311-27746333 GAGGACATTTGGAGCGCTTCAGG + Intergenic
1171675604 20:27870386-27870408 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171677381 20:27897126-27897148 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171687521 20:28049057-28049079 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171690561 20:28094606-28094628 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171694045 20:28146452-28146474 GTGAACATTTGGATTGCTTCAGG + Intergenic
1171874447 20:30559758-30559780 GAGAACATTTTCAAAACCTTGGG - Intergenic
1171966270 20:31533199-31533221 TTGAACATTTTTAAAACTTCAGG + Intronic
1172169069 20:32917949-32917971 CAGTACATTTGGAAAACCCCTGG - Intronic
1173212864 20:41050458-41050480 GAGAACATTTCCAAAATTCCAGG - Intronic
1174714435 20:52742443-52742465 GACAACATTTGATGAACTTCAGG + Intergenic
1175961509 20:62639167-62639189 GCGGACATTTGGACAACTCCAGG + Intergenic
1182114593 22:27748721-27748743 GAGAAAGTTTTTAAAACTTCAGG + Exonic
1184805324 22:46791707-46791729 GAGTAAATTTGGAAAACTGATGG - Intronic
951076730 3:18402493-18402515 GAGGGTATTTGGAAAACTTTTGG - Intronic
951451219 3:22840930-22840952 TAGAGCACTTGGAAAACATCTGG + Intergenic
951872354 3:27378061-27378083 AAGAATATTTAGAAAAATTCTGG + Intronic
952122071 3:30257410-30257432 GAGAGTATTTGGAAACTTTCTGG - Intergenic
952728013 3:36608783-36608805 AAGAACATTTGAAAAAATCCTGG - Intergenic
955463587 3:59212570-59212592 GAGAACATTTGGAAAAGGTAAGG - Intergenic
956441891 3:69288671-69288693 CAGAACTTGAGGAAAACTTCGGG - Intronic
957763094 3:84585447-84585469 GGCAACATTTGCAAAACTACTGG + Intergenic
957848789 3:85778106-85778128 GAAAACATTTGGAAATGTTTAGG + Intronic
958039693 3:88211679-88211701 GAGCACAGCTGGAAAATTTCAGG + Intergenic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
959360492 3:105384087-105384109 GAGAAAATTTGGAGAAAATCTGG + Intronic
960328822 3:116331331-116331353 GAGAACATTTGAAAAAATAATGG + Intronic
960899001 3:122535303-122535325 GAGAACATAGGCAAAACTTGGGG - Intronic
962379430 3:134885672-134885694 GAGAACATTTGGAAAACTTCTGG + Intronic
962546872 3:136445504-136445526 GGGAAGATTTGAAAAAGTTCTGG + Intronic
963219683 3:142795208-142795230 GTGAACTTTGGGACAACTTCAGG + Intronic
964012686 3:151910025-151910047 GAAAACAAGTGGAAAATTTCAGG - Intergenic
964086013 3:152819331-152819353 GAGAAAATTTAGACAACTTTGGG - Intergenic
964850345 3:161089206-161089228 GATAATATATGCAAAACTTCTGG + Intronic
965694657 3:171394930-171394952 GAGAACATGTCTAAAACTCCGGG + Intronic
966268853 3:178081012-178081034 GAGCACATTTGGAGAACATATGG - Intergenic
969632388 4:8346277-8346299 GAGGGCCTTTGGAAATCTTCTGG - Intergenic
971125382 4:23748305-23748327 GAGGAAATATGGAAAACTTGAGG - Intergenic
971190497 4:24424043-24424065 GAGAAGAAATGGAAAACTTGGGG + Intergenic
972022893 4:34336986-34337008 GAAAACCTAGGGAAAACTTCTGG - Intergenic
972589240 4:40468549-40468571 GAGCACAGTTGGAAACCTTCTGG + Intronic
973073533 4:45895129-45895151 GAGAACATTTTGAAGATTGCTGG - Intergenic
973227622 4:47803759-47803781 GAAAACATTGGGGAAACTTTAGG + Intronic
974273652 4:59686970-59686992 GAAAACAGTGTGAAAACTTCTGG + Intergenic
974780284 4:66544974-66544996 GAGAGAATCTGGAAAACTACTGG + Intergenic
975179558 4:71328905-71328927 GAAAACATTGGGGAAACTCCAGG - Intronic
975488141 4:74957873-74957895 GAGGCCATTTGGAATACTGCAGG - Intronic
975645354 4:76540461-76540483 GGGAAGCTTTGGAAAACTTTAGG + Intronic
976962542 4:90996906-90996928 AAGGACATTTGGATTACTTCTGG + Intronic
977180090 4:93863514-93863536 GATATCATTGGAAAAACTTCTGG + Intergenic
977789400 4:101080969-101080991 GACAACATTTTGAAAATTTTGGG - Intronic
977925355 4:102694392-102694414 AAGAACATCAGGAAAACTACTGG - Intronic
978839566 4:113194287-113194309 GAGTCCATTTGGAAAAGTTGAGG - Intronic
979314237 4:119241847-119241869 TGGAACAACTGGAAAACTTCAGG - Intronic
980570065 4:134603232-134603254 GAGAACATTTGAAAATATTGGGG - Intergenic
980622906 4:135332532-135332554 GAGAACACTTTAAAAACTTAAGG + Intergenic
981788226 4:148504830-148504852 GAGAACATTTGGGAGACCCCTGG - Intergenic
982079821 4:151778417-151778439 GAGAACATTTGAAGATGTTCTGG + Intergenic
982082144 4:151800836-151800858 GAGATCATTTGGAGAAGTCCAGG - Intergenic
982157114 4:152534858-152534880 GAGAACATCAGCAAAACTCCAGG + Intronic
982227420 4:153178899-153178921 GACAACTTTCAGAAAACTTCTGG - Intronic
983196831 4:164815885-164815907 GATCACTCTTGGAAAACTTCAGG - Intergenic
984468395 4:180130578-180130600 GAGCCCATTTTGAAAACTTCAGG + Intergenic
986292607 5:6411995-6412017 GAGAACCTTTAGAAATCTCCCGG - Intergenic
986588370 5:9342948-9342970 CAGCACATTTGGAAAATTACAGG + Intronic
987326444 5:16815986-16816008 GAAAACATTTGGCAAACATTAGG + Intronic
987497207 5:18662500-18662522 GAGACCATTATGCAAACTTCTGG - Intergenic
987590411 5:19918411-19918433 TAGAACCTTTGGAAAAATCCAGG + Intronic
987780240 5:22424362-22424384 GACAACATGTGAAAAACTCCAGG + Intronic
987804924 5:22752447-22752469 GAAAACATGTGGAAAGTTTCTGG - Intronic
988392871 5:30658524-30658546 GAGCATATTTTGAAAATTTCAGG + Intergenic
988437112 5:31189659-31189681 TATCACATTTGGAAATCTTCTGG + Intergenic
989708368 5:44365935-44365957 GACCACAGTTGGAAAATTTCTGG + Intronic
990536129 5:56724454-56724476 GAGATCATTTGGACACATTCGGG - Intergenic
992538252 5:77734332-77734354 AAGAAAATTTGAAAACCTTCTGG + Intronic
993786776 5:92148612-92148634 GAAATCATTTGGAAAACTCCAGG - Intergenic
993955607 5:94228736-94228758 GAGAGCATTTGAAAAACTCATGG - Intronic
994368275 5:98941040-98941062 TGAAACATTTGGAAAACTTAAGG + Intergenic
994782500 5:104110035-104110057 GAGAATATTTGGAAAAATAATGG - Intergenic
995828559 5:116329084-116329106 GAGATCATTTTGAAAATTTAAGG - Intronic
996522582 5:124443695-124443717 GAGAACATTTGTGAAAGTCCTGG + Intergenic
996756484 5:126941069-126941091 GAGAAAATTTTGTAAACTTGTGG - Intronic
996915087 5:128702899-128702921 GAAAAGATTTGGAAAACTCTTGG + Intronic
997026154 5:130064265-130064287 GAGAATATGTGCAAAACATCTGG - Intronic
997114429 5:131111346-131111368 GAAAACGTTTTGAAAACTCCAGG + Intergenic
998624918 5:143835532-143835554 AAAAGCATTTGGAAAACTCCAGG - Intergenic
998980619 5:147698143-147698165 GAGATCATTTGGAAACTTTAGGG + Intronic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
1000018220 5:157297050-157297072 AATAACATTTTGAAAAATTCTGG + Intronic
1000513339 5:162210010-162210032 GAGAGCATTTGCAAAGCTTTCGG + Intergenic
1001024740 5:168214555-168214577 GATAAAATTAGGAAAACTCCAGG + Intronic
1001222698 5:169915990-169916012 GAGAACATTTGTAATATTTCTGG - Intronic
1001249977 5:170139705-170139727 GACAACATTTGGGGAACTTGGGG - Intergenic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004772699 6:18802154-18802176 GAGAGCATATGAAAAACCTCTGG - Intergenic
1004961512 6:20795050-20795072 GAGCACCTTTGGAAAAATTCTGG + Intronic
1007441337 6:41863618-41863640 GAGAACATTAAGACAAATTCAGG - Intronic
1007710549 6:43820781-43820803 GACAGCATTCGGAGAACTTCCGG + Intergenic
1008100401 6:47384626-47384648 GAAAACATTGGGGAAACTCCAGG - Intergenic
1009356062 6:62747118-62747140 GAGAGCAATTGGAAGACTTTTGG - Intergenic
1009843642 6:69108732-69108754 GAAAAGATTTGGAAAAATGCTGG + Intronic
1009997050 6:70907417-70907439 GAGAGCATTGGAAAGACTTCAGG + Intronic
1010899729 6:81411389-81411411 GAGAAAATTTAGAAAACATATGG + Intergenic
1011175421 6:84554281-84554303 CAAAACATTTGGAAAATGTCTGG + Intergenic
1011774383 6:90712204-90712226 GGCAAAATTTGGAAACCTTCAGG + Intergenic
1012381259 6:98622290-98622312 GTTAACATTTGGAAAATTTTTGG - Intergenic
1012543371 6:100389307-100389329 GACAACATGTGGAAAGCCTCAGG - Exonic
1012799645 6:103808686-103808708 GGGAAGTATTGGAAAACTTCTGG - Intergenic
1014727974 6:124995947-124995969 AAAAACATTTGGAATATTTCTGG + Intronic
1014905220 6:127018012-127018034 TAGAACACTTGGAAAACTACTGG - Intergenic
1015253986 6:131157073-131157095 AAGAACATTTAGTAAACTCCAGG - Intronic
1016468744 6:144352897-144352919 GAGAAAATTTAGAAAACTACTGG - Intronic
1016507813 6:144804032-144804054 TAGAACATGAGGATAACTTCAGG - Intronic
1016712644 6:147191312-147191334 GAGAAAAATTGTAAATCTTCAGG - Intergenic
1016928102 6:149373906-149373928 GAGAAGCTTTGAAAAACTACTGG + Intronic
1017802416 6:157909220-157909242 GAGAATATTTTGAAAACTTGAGG + Intronic
1018167016 6:161107730-161107752 GGGAACATTTAGAAAAATTTTGG + Intronic
1018909201 6:168092272-168092294 GAGAACATTTTGCAAAGTCCTGG - Intergenic
1019269183 7:136920-136942 GTGAACGTTTGGAGAAATTCTGG + Intergenic
1019660975 7:2223876-2223898 AGGAACAATTGGAAAACTACTGG + Intronic
1020062569 7:5163530-5163552 GAGAAAATCTAGATAACTTCAGG + Intergenic
1020165585 7:5805167-5805189 GAGAAAATCTAGATAACTTCAGG - Intergenic
1021623529 7:22570992-22571014 GAGAACATTTCCAAAAGTGCAGG - Intronic
1022343417 7:29489352-29489374 AAGAACAGTTTGAAAACTTGAGG - Intronic
1022952610 7:35352827-35352849 AAGCAAATTTGGAAAACATCTGG - Intergenic
1024797826 7:53038640-53038662 GAGAACATTTGTAGAAGTTAAGG + Intergenic
1025309282 7:57908682-57908704 GAGAACATTTGGAGCGCTTTGGG - Intergenic
1027996541 7:85432883-85432905 GAAAACATTGGGGAAACTCCAGG + Intergenic
1028267073 7:88738893-88738915 GAGCACATTTGGCAAAATTATGG - Intergenic
1028317308 7:89419493-89419515 GAGGTAATTTTGAAAACTTCTGG - Intergenic
1028387568 7:90274862-90274884 GAGAAGATTTGGAGAACTCTTGG + Intronic
1028711209 7:93910783-93910805 CACAACATTTGGAAACCTTAAGG - Exonic
1029653121 7:101907097-101907119 GAGAACATTTGGGAAATATGAGG + Intronic
1030295707 7:107924571-107924593 AAGAACATTTCAAAAAATTCTGG + Intronic
1030901240 7:115127035-115127057 TAGAAAATATGGAAAAATTCAGG - Intergenic
1033261416 7:139847183-139847205 GGGAAAATTTGAAAAATTTCTGG - Intronic
1036496335 8:9273100-9273122 GAGAACATTTGTATAACCACTGG - Intergenic
1036518010 8:9463287-9463309 GAGAAAATTTAGAAAATTTGAGG - Intergenic
1038122137 8:24629261-24629283 GGGAAGAATTGGAATACTTCGGG - Intergenic
1038569791 8:28650984-28651006 AAGAAAATTTGAAACACTTCTGG - Intronic
1039343778 8:36681261-36681283 GAGAACATCTGCAAAAAATCAGG + Intergenic
1039493348 8:37964162-37964184 CAGAACCTGTGGAAAACCTCTGG - Exonic
1041501523 8:58543852-58543874 CTGAACATCTGGAACACTTCTGG + Intergenic
1041620609 8:59963811-59963833 GAGAACATTTTGTAAAATTGGGG - Intergenic
1042189646 8:66172672-66172694 CAGAACCTTTGGGAAACTGCTGG - Intronic
1042449863 8:68931922-68931944 GAGAACATGGGGAATACTCCAGG - Intergenic
1042862716 8:73330024-73330046 GAGGAGATTTGGAGAACTTCTGG - Intergenic
1043083488 8:75796932-75796954 AAGAACATAAAGAAAACTTCTGG + Intergenic
1043230406 8:77793253-77793275 GAAGACAATGGGAAAACTTCAGG + Intergenic
1043352926 8:79382514-79382536 GAAGACATTTGGAAAACATGTGG - Intergenic
1044688935 8:94857439-94857461 GAGAACATTGGGAAAAATGAAGG + Intronic
1046048330 8:108988951-108988973 GAGAAAATTTTGAAAACATTAGG + Intergenic
1046056869 8:109088611-109088633 CAGAATATTTGGAGAATTTCTGG + Intronic
1047044327 8:121034560-121034582 GAAAACACTTTGAACACTTCTGG + Intergenic
1049903951 9:198390-198412 GAGAACATTTGGCACATTTGGGG - Intergenic
1050259151 9:3822951-3822973 AAGAACACATGGAAGACTTCTGG - Intergenic
1051838969 9:21372827-21372849 GAAAAAATTTGCTAAACTTCAGG + Intergenic
1053746963 9:41208691-41208713 GAGAACATTTGGCACATTTGGGG - Intergenic
1053939269 9:43213672-43213694 GTGGACATTTGGAACACTTGAGG + Intergenic
1054432029 9:65173008-65173030 GTGGACATTTGGAACACTTGAGG + Intergenic
1054480323 9:65656668-65656690 GAGAACATTTGGCACATTTGGGG + Intergenic
1054681382 9:68222590-68222612 GAGAACATTTGGCACATTTGGGG + Intergenic
1054915166 9:70488962-70488984 GTGAATATTTGGAATATTTCAGG + Intergenic
1055235827 9:74122060-74122082 GAGAACATTTCAAAAATTGCAGG + Intergenic
1056021471 9:82442231-82442253 GAGACCATTTGCAAAACTGAGGG - Intergenic
1056237609 9:84610761-84610783 GAGGCCATTTGGAACACTACAGG - Intergenic
1056307982 9:85309789-85309811 GAAAACATTTTGAAAACTGGTGG - Intergenic
1057808127 9:98235575-98235597 GAGAAGGATTGGAAGACTTCAGG - Intronic
1057825395 9:98369091-98369113 GAGGACCTTTTGAAAACTACTGG - Intronic
1059162519 9:112048722-112048744 GAGAAAATTTAAAAAGCTTCAGG + Intronic
1059600864 9:115777163-115777185 GAGAACATTTGGACACATTGTGG + Intergenic
1060341841 9:122784343-122784365 GAAAGGATCTGGAAAACTTCAGG - Intergenic
1202783094 9_KI270718v1_random:19471-19493 GAGAACATTTGGCACATTTGGGG - Intergenic
1203396366 Un_KI270519v1:17101-17123 GTGAATATTTGGAGAACTTTCGG + Intergenic
1203397697 Un_KI270519v1:42289-42311 GTGGACATTTGGAACACTTGGGG - Intergenic
1186329946 X:8521190-8521212 GAGTACATTTTGAAAACATCAGG - Intergenic
1187149753 X:16670619-16670641 AGGAACATTGGGAAAACTCCAGG - Exonic
1187610253 X:20935316-20935338 GAAAACATTGGGGAAACTCCAGG - Intergenic
1187942366 X:24394454-24394476 GATGACATTTGGAAAAGGTCTGG + Intergenic
1189058374 X:37725282-37725304 GAGAACACTTAGCAAATTTCAGG - Intronic
1189578251 X:42378496-42378518 GATCACATTTGGAAAAATTGAGG + Intergenic
1189633078 X:42975618-42975640 GAGAAGAATTGGAAAACTAGAGG + Intergenic
1191231271 X:58097981-58098003 AAGGACAGTTGGGAAACTTCAGG + Intergenic
1192484275 X:71511619-71511641 GAGAACTGTTGGAAACTTTCTGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1192821536 X:74651248-74651270 GAGAATATTTGCAAGACTTATGG - Intergenic
1193205741 X:78745733-78745755 CAGAAGAATTGGAAAACTTATGG + Intergenic
1194584959 X:95720482-95720504 GGGAAGTCTTGGAAAACTTCAGG - Intergenic
1194859166 X:98974254-98974276 TAGAACTTTTGGCAAACTTATGG + Intergenic
1195141280 X:101962902-101962924 GAAAAGATTTGGGAAAATTCAGG + Intergenic
1199371019 X:147048078-147048100 GAAAACATTGGGGAAACTCCAGG + Intergenic
1199545450 X:149003588-149003610 GAAATTATTTGGAAAACCTCAGG - Intergenic
1199842206 X:151661267-151661289 GAAAATATTTTGAAAAATTCTGG - Intronic
1200295295 X:154913669-154913691 GAGAACATTTTGGAACTTTCAGG - Intronic
1201433222 Y:13927414-13927436 GAGTACATTTTGAAAACATCAGG + Intergenic
1201447083 Y:14069303-14069325 GAGAACAGTTTGAAAGTTTCTGG + Intergenic
1201866571 Y:18661932-18661954 GAAAACATTTGGAGAAATTTGGG + Intergenic